Giulia Venturi1,2, Federico Zacchini1,2, Cinzia Lucia Vaccari1,2, Davide Trerè1,3, Lorenzo Montanaro1,2,3. 1. Dipartimento di Medicina Specialistica, Diagnostica e Sperimentale (DIMES), Alma Mater Studiorum-Università di Bologna, Bologna, Italia. 2. Centro di Ricerca Biomedica Applicata-CRBA, Università̀ di Bologna, Policlinico di Sant'Orsola, Bologna, Italia. 3. Programma Dipartimentale di Medicina di Laboratorio, IRCCS Azienda Ospedaliero-Universitaria di Bologna, Bologna, Italia.
Abstract
The ribosomal RNA 5.8S is one of the four rRNAs that constitute ribosomes. In human cells, like in all eukaryotes, it derives from the extensive processing of a long precursor containing the sequence of 18S, 5.8S and 28S rRNAs. It has been confirmed also in human cells the presence of three isoforms of 5.8S rRNA: one more abundant called 5.8S short, one called 5.8S long bearing 5 extra-nucleotides at its 5' end and one 10 nucleotide shorter called 5.8S cropped. So far, little is known about 5.8S long specific role in cell biology and its function in human pathology. The lack of studies on the three 5.8S isoforms could be due to the techniques usually applied to study ribosome biogenesis, such as Northern blot with radioactively labelled probes, that require strict protective measures, and abundant and high-quality samples. To overcome this issue, we optimized a method that combines primer extension with a fluorescently labeled reverse primer designed on the 3' of 5.8S rRNA sequence and fragment analysis. The resulting electropherogram shows the peaks corresponding to the three isoforms of 5.8S rRNA. The estimation of the area underneath the peaks allows to directly quantify the isoforms and to express their relative abundance. The relative abundance of 5.8S long and 5.8S short remains constant using scalar dilution of RNA and in samples subjected to partial degradation. 5.8S cropped abundance varies significantly in lower concentrate RNA samples. This method allows to analyze rapidly and safely the abundance of 5.8S rRNA isoforms in samples that have been so far considered not suitable such as poorly concentrated samples, RNA derived from frozen tissue or unique samples.
The ribosomal RNA 5.8S is one of the four rRNAs that constitute ribosomes. In human cells, like in all eukaryotes, it derives from the extensive processing of a long precursor containing the sequence of 18S, 5.8S and 28S rRNAs. It has been confirmed also in human cells the presence of three isoforms of 5.8S rRNA: one more abundant called 5.8S short, one called 5.8S long bearing 5 extra-nucleotides at its 5' end and one 10 nucleotide shorter called 5.8S cropped. So far, little is known about 5.8S long specific role in cell biology and its function in human pathology. The lack of studies on the three 5.8S isoforms could be due to the techniques usually applied to study ribosome biogenesis, such as Northern blot with radioactively labelled probes, that require strict protective measures, and abundant and high-quality samples. To overcome this issue, we optimized a method that combines primer extension with a fluorescently labeled reverse primer designed on the 3' of 5.8S rRNA sequence and fragment analysis. The resulting electropherogram shows the peaks corresponding to the three isoforms of 5.8S rRNA. The estimation of the area underneath the peaks allows to directly quantify the isoforms and to express their relative abundance. The relative abundance of 5.8S long and 5.8S short remains constant using scalar dilution of RNA and in samples subjected to partial degradation. 5.8S cropped abundance varies significantly in lower concentrate RNA samples. This method allows to analyze rapidly and safely the abundance of 5.8S rRNA isoforms in samples that have been so far considered not suitable such as poorly concentrated samples, RNA derived from frozen tissue or unique samples.
5.8S ribosomal RNA (rRNA) is one of the four RNA species that compose eukaryotic ribosomes. It derives from a highly coordinated biogenesis process that starts in the nucleolus with the transcription of a long precursor followed by extensive editing and a number of sequential cleavages (see Box 1 for a schematic representation of the key steps of rRNA processing) [1]. Ribosome biogenesis has been widely studied in yeast and only recently several studies have been conducted on human cell lines. Three isoforms of 5.8S rRNA have been described: a long form (5.8S long—l -), a shorter one missing 5 nucleotides at the 5’ of the sequence (5.8S short—s -) [2, 3] and a 5’-truncated isoform (5.8S cropped—c-) [4]. One of the current models for 5.8S short biogenesis involves the cleavage at the internal transcribed spacer 1 (ITS1) operated by RNAse MRP and the following exonucleolytic 5’-3’ trimming [5-7]. However, there are reports challenging this viewpoint, indicating that ITS1 cleavage could be RNase MRP-independent [8]. On the other hand, at least in yeast, the long isoform derives from direct ITS1 cleavage by a still uncharacterized enzyme [9]. A specific role for the 5.8S long isoform has not been characterized. This is probably due to technical difficulties that researchers face when studying ribosomal RNA. In fact, the most used technique to analyze rRNAs and their processing is Northern blot using probes labelled with radioactive tag. This technique is highly useful to study rRNA biogenesis since it allows to determine the size of rRNA intermediates and even small changes derived by their processing. However, Northern blot cannot be applied on a large systematic scale due to the use of hazardous reagents, such as radioactive probes, that require dedicated rooms and strict protective measures. Recently, chemiluminescent probes have been introduced to reduce the problems derived from radioactive reagents, but their use reduces the sensitivity of the method. On the other hand, due to their inherent methodological features, structural approaches also failed to characterize the properties of 5.8S long isoform [10]. To overcome these issues, we propose to exploit primer extension and fragment analysis to study 5.8S rRNA isoforms and their relative representation. In fact, the method we optimized permits a rapid, safe and easy quantification of the three 5.8S isoforms, allowing their analysis in a wide range of possible samples, including difficult and poorly concentrated samples.
Box 1. Schematic representation of ribosomal RNA processing
Pre-ribosomal RNA processing in mammalian cells starts in the nucleolus with the transcription, operated by RNA polymerase I, of a long precursor (47S) from the numerous repeats of rDNA genes. The 47S pre-rRNA is then extensively cleaved and modified to originate the mature 18S, 28S and 5.8S rRNA (widely reviewed in [11]) while 5S rRNA follows a different pathway. In the 47S precursor 18S, 5.8S and 28S rRNA are flanked by two external transcribed spacer (5’ and 3’ ETS) and separated by two internal transcribed spacers (ITS1 and ITS2). An initial cleavage at site A’ in the 5’ETS and at site 2 in the 3’ETS originates 45S pre-rRNA that is processed following alternative pathways either starting in the 5’ETS or in the ITS1 [12]. The major pathway described in HeLa cells starts with the endonucleolytic cleavage at site 2 of ITS1 [13] and leads to the formation of 30S rRNA and 32.5S rRNA. From this point the two precursors will follow separated pathways. In fact, 30S rRNA is cleaved at site A0 and 1 originating 21S that is processed by 3’-5’ trimming [14]. The product then undergoes cleavage at site E [15] and 3’-5’ trimming by PARN before cytoplasmic export [16]. In the cytoplasm 18S rRNA is obtained by cleavage at site 3 by NOB1 [14]. In parallel, 32.5S rRNA is processed through 5’-3’ exonucleolytic cleavage at its 5’ end by XRN2 originating in this way the two variants of the 5.8S rRNA 5’ end [17], followed by LAS1 action on site 4 that separates 5.8S and 28S precursors [18]. Eventually, before cytoplasmic export, 5.8S precursor is progressively trimmed at the 3’ end by DIS3, ISG20L2 and RRP6 exonucleases while the 5’ end of 28S rRNA is tailored by XRN2 [11, 17].
Materials and methods
Cell culture
HeLa and U2OS cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with high glucose supplemented with 10% FBS, 2 mM L-Glutamine, 100 U/ml Penicillin and 100 μg/ml Streptomycin (all provided by EuroClone) at 37°C in a humidified incubator with 5% CO2.
RNA extraction
Total RNA was extracted from cells at 70–80% confluence using Purezol reagent (BioRad) following manufacturer’s instruction. RNA concentration was assessed using NanoDrop (Life Technologies) at 260 nm.
Ribosome isolation
Ribosomes from U2OS cells were isolated essentially as previously described [19]. Briefly, 1x106 cells were plated in five 150 mm dishes and cultured for 72 hours before lysis. Cell lysis was carried out for 10 minutes on ice using lysis buffer containing 10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2 and 0.5% (vol/vol) Nonidet P40 followed by centrifugation at 20 000g for 10 minutes at 4°C. Highly purified ribosomes were pelleted by ultracentrifugation of the cell lysate on a discontinuous sucrose gradient at 120 000g at 4°C for 16 hours and quantified measuring their absorbance at 260 nm. Ribosomal RNA was extracted from 8 pmol of ribosomes using Purezol reagent (BioRad).
Simulation of RNA degradation
Total RNA from HeLa cells (1.5 μg) was incubated at 90°C for 0, 10, 20, 30, 40 and 50 minutes (adapted from [20]). After incubation half of the sample was run on 1% agarose gel with Ethidium Bromide 0.5 μg/ml in TBE buffer to assess RNA degradation.
Primer extension and fragment analysis
To perform primer extension, from 0.06 to 1 μg of total RNA from cell lines or Human XpressRef Universal Total RNA (Qiagen) complexed with 10 pmol of 5.8S Rev FAM primer and 2 pmol of 5S Rev Hex primer (Integrated DNA Technologies, HPLC purification) in a total volume of 3 μl was denatured at 92°C for 2.5 minutes and incubated at 59°C for 30 minutes for primer annealing followed by 5 minutes on ice. Then the mix containing water, GoScript Reaction Buffer, 5 mM MgCl2, dNTPs (0.5 mM each), 10 u of RNase inhibitor and 160 u of GoScript Reverse Transcriptase (GoScript Reverse Transcriptase kit Promega) was added to the sample to obtain a final volume of 10 μl and incubated at 42°C for 1 hour. This reaction is carried out in 0.2 ml tubes (Multiply-Pro cup PP Sarstedt) in a thermal cycler (T100 Bio-Rad). After primer extension, 1 μl of sample was added to 8.8 μl of Hi-Di Formamide (Applied Biosystems) and 0.2 μl of GeneScan 500 Liz dye size standard (Applied Biosystems). Samples were separated on 36 cm capillary array using POP-7 Polymer on an Abi 3730 Sequencer (Applied Biosystems) using DS-33 Matrix (Dye Set G5) for spectra calibration.
Evaluation of 5.8S isoforms and statistical analysis
The fragment analysis data file obtained from the sequencer was analyzed using Peak Scanner software (Thermo Scientific Cloud). We evaluated each single isoform as a ratio between the area underneath the corresponding peak and the sum of the total areas of all the three peaks that can be ascribed to 5.8S (5.8Sc + 5.8Ss + 5.8Sl). Data in Fig 4 were analyzed using SPSS software. We performed Student’s T test to compare differences between samples.
Fig 4
Robustness of the method.
A Evaluation of 5.8S isoforms using scalar dilutions of standard RNA in triplicate. The average values are consistent in the range of the quantities used except for 5.8Sc whose level remained stable only when using at least 0.5 μg of RNA. Comparison between the higher concentrated samples and each other concentration were performed using Student’s T test. B Representative electrophoresis image showing RNA degradation in samples incubated from 0 to 50 minutes at 90°C. C Evaluation of 5.8S isoforms using RNA degraded for 0, 10, 20, 30, 40, and 50 minutes at 90°C. The average values obtained from four replicates is similar from 0 to 20 minutes at 90°C. After 20 minutes the values of 5.8Sl and 5.8Sc resulted significantly different from the non-degraded samples. Comparison between the undegraded samples and each other condition were performed using Student’s T test. *<0.05, **<0.01, ***<0.001.
5’RACE (rapid amplification of cDNA end)
5’RACE (5’/3’ RACE kit 2nd generation Roche) was performed using total and ribosomal RNA from U2OS cells following manufacturers’ instructions with few modifications to the protocol. We added a denaturation step at 90°C for 2 minutes and an annealing step at 59°C for 30 minutes to the suggested first strand cDNA synthesis protocol using the primer 5.8S Rev (Table 1). Reverse transcription (RT) was carried out at 42°C for 1 hour. First strand cDNA was then purified using PCR purification kit (Qiagen). Poly(A) or poly(T) tailing of the first strand cDNA was then performed. Finally, a PCR using AccuPrime, a high fidelity Taq DNA polymerase (Invitrogen), was performed using 5.8S Rev primer (Table 1) and the degenerated oligo dT-anchor Primer of the kit in the case of poly(A) tailing or a degenerated oligo dA-anchor primer (IDT) in the case of poly(T) tailing. The PCR product was then purified using PCR purification kit (Qiagen) and Sanger sequenced.
Table 1
Name and sequence of the used primers.
Primer name
Primer sequence (5’-3’)
5.8S Rev FAM
/56-FAM/AAGCGACGCTCAGACAGGCGTA
5.8S Rev
AAGCGACGCTCAGACAGGCGTA
5S Rev HEX
/5HEX/CCTACAGCACCCGGTATTCC CA
oligo dA-anchor primer
GACCACGCGTATCGATGTCGACAAAAAAAAAAAAAAA/T/C/G
Results
Evaluation of 5.8S cropped, short and long rRNA using primer extension and fragment analysis
The method described to evaluate 5.8S rRNA isoforms consist in a primer extension using two different primers: one reverse primer conjugated with FAM fluorophore designed to fully reverse-transcribe 5.8S rRNA sequence, and a second reverse primer conjugated with HEX fluorophore that mediates the reverse transcription of 5S rRNA used as internal standard (Table 1). The protocol starts with a denaturation step at 92°C, important to fully unfold rRNA secondary structures, followed by an annealing step at 59°C before the RT reaction. The samples are mixed with formamide and size standard, then undergo fragment analysis in which the fluorescently labeled DNA fragments are separated according to their size (Fig 1A). The output consists in an electropherogram showing one HEX fluorescent peak at 114 nucleotides corresponding to 5S rRNA, plus one FAM peak at 141 nucleotides, one more abundant FAM peak at 153 nucleotides and one FAM peak at 158 nucleotides that we identified as 5.8S rRNA cropped, short, and long, respectively (Fig 1B). The analysis of the electropherogram using the software Peak Scanner available at Thermo Fisher Cloud allows to measure the area underneath the peaks used to calculate the ratio between each peak of interest (cropped, short or long) and the sum of the three peaks. Considering how we designed the primers, we noticed a difference between the expected 5S and 5.8S size, of 117 and 157 nucleotides respectively, and what observed. Since this difference involves both the transcripts analyzed it can be due to the effect of the fluorescent dye on the fragment mobility or to an imperfect alignment between the size standard and the sample. These limited differences in size determination are also expected according to technical approach employed and are not surprising. In addition, the peaks that we identify in the electropherogram appear in the same position in all performed experiments. Thus, although the sizing of the peaks may not be completely accurate, the results can still be considered precise and reproducible if the samples are run in the same conditions.
Fig 1
Schematic representation of the method.
A sample containing RNA, 5.8S Rev FAM and 5S Rev HEX primers is denatured then incubated for annealing. Then, the reverse transcription reaction is performed. An aliquot of the reaction product is complexed with formamide and size standard and run through capillary electrophoresis. The three isoforms are indicated as follows: c stands for 5.8S cropped, s for 5.8S short and l for 5.8S long. B The fragment analysis file generated by the sequencer can be analyzed using Peak Scanner Software. Yellow peaks are the size standard, the green peak is the internal reference 5S rRNA, whereas blue peaks are the products of the primer extension reaction. Upper X axis represents the base length of each fragment; Y axis represents the relative fluorescence of each detected fragment.
Schematic representation of the method.
A sample containing RNA, 5.8S Rev FAM and 5S Rev HEX primers is denatured then incubated for annealing. Then, the reverse transcription reaction is performed. An aliquot of the reaction product is complexed with formamide and size standard and run through capillary electrophoresis. The three isoforms are indicated as follows: c stands for 5.8S cropped, s for 5.8S short and l for 5.8S long. B The fragment analysis file generated by the sequencer can be analyzed using Peak Scanner Software. Yellow peaks are the size standard, the green peak is the internal reference 5S rRNA, whereas blue peaks are the products of the primer extension reaction. Upper X axis represents the base length of each fragment; Y axis represents the relative fluorescence of each detected fragment.To confirm that this assay was able to reverse transcribe specifically 5.8S rRNA, we performed a 5’ rapid amplification of cDNA ends (RACE) reaction on total and ribosomal RNA using a non-fluorescent 5.8S Rev primer (Fig 2A). The product of the reaction performed on total RNA from U2OS cells underwent Sanger sequencing (Fig 2B). It resulted in a predominant sequence corresponding to the registered 5.8S (NR_003285.3) and in a less abundant sequence four or five nucleotides longer at its 5’. This sequence corresponds to the sequence at the 5’ end of 5.8S published sequence in the 45S precursor (Fig 2C) (NR_046235.3) but, due to the used method, the first T was uncertain. Therefore, we performed a second 5’ RACE reaction in which we carried out a poly(T) tailing instead of poly(A) tailing. In order to avoid the confounding effect of pre-rRNA present in total RNA, we performed this evaluation solely on mature rRNA, derived from purified ribosomes. The result confirmed that the predominant sequence corresponded to the deposited 5.8S sequence (NR_003285.3) and that a five nucleotides longer sequence (terminating with a T at the 5’ end) was also present (Fig 2D). A less represented T peak was also identified in correspondence of the first C at the 5’ of 5.8S short sequence in line with the known presence of one nucleotide heterogeneity at the 5’ end [4]. In this assay it was not possible to selectively identify the cropped isoform due to its limited quantitative representation with respect to the 5.8S short isoform.
Fig 2
5’RACE and sequence of 5.8S short and long isoforms.
A Schematic representation of 5.8S rRNA short and long and 5.8S Rev primer used for 5’RACE. B Sequencing of the product obtained from 5’RACE and poly(A) tailing using total RNA. 5.8S short sequence is reported in black on top of the chromatogram while the five extra nucleotide of 5.8S long are in bold. C 45S precursor rRNA sequence in which is possible to see in pink the 5.8S Rev primer sequence, in blue the 5.8S short published sequence and in orange the longer sequence of 5.8S long. D Sequencing of the product obtained from 5’RACE and poly(T) tailing using ribosomal RNA. We confirmed that the first T (in red) is part of the 5.8S long sequence.
5’RACE and sequence of 5.8S short and long isoforms.
A Schematic representation of 5.8S rRNA short and long and 5.8S Rev primer used for 5’RACE. B Sequencing of the product obtained from 5’RACE and poly(A) tailing using total RNA. 5.8S short sequence is reported in black on top of the chromatogram while the five extra nucleotide of 5.8S long are in bold. C 45S precursor rRNA sequence in which is possible to see in pink the 5.8S Rev primer sequence, in blue the 5.8S short published sequence and in orange the longer sequence of 5.8S long. D Sequencing of the product obtained from 5’RACE and poly(T) tailing using ribosomal RNA. We confirmed that the first T (in red) is part of the 5.8S long sequence.Taken together these results demonstrate that our 5.8S Rev primer is suitable for the reverse transcription of the 5.8S rRNA sequence. In addition, we could also confirm that the longer isoform contains a sequence of five extra nucleotides (TCGTA) at its 5’ end in line with what has been previously reported by Heindl et al [2].
Optimization of RNA and primer amount
To determine the quantity of 5.8S rRNA reverse primer suitable for our assay we performed primer extension with two amounts of primer (1 pmol and 10 pmol) combined with several quantities of total RNA (0.06 to 1 μg) from U2OS cell line (Fig 3A) and we evaluated the area of the 5.8S short peak. Based on the results, we selected 10 pmol primer amount, which ensured a linear correlation between RNA input and 5.8S detection (R square value of the calculated regression line: 0.97 for 10 pmol of primer versus 0.85 for 1 pmol of primer). To optimize 5S reverse primer amount we evaluated 5S peak area corresponding to 1, 2, 5 and 7 pmol of primer in reactions containing 10 pmol of 5.8S primer and total RNA from U2OS cells (Fig 2B). We selected the amount of 5S primer (2 pmol) that allowed to obtain similar area values for 5S peak and 5.8S short peak, while not altering 5.8S reverse transcription reaction (Fig 3C).
Fig 3
5.8S Rev FAM and 5S Rev HEX primers optimization.
A Evaluation of two 5.8S Rev FAM primer quantities, 1 pmol and 10 pmol, using 0.06, 0.125, 0.25, 0.5 and 1 μg of RNA from U2OS cells. The plot reports 5.8S short peak area and R2 values were obtained by linear regression. B and C Optimization of 5S Rev HEX primer using 1, 2, 5 and 7 pmol of primer in a reaction with 10 pmol of 5.8S Rev FAM primer and 0.125 μg of total RNA from U2OS cells. The introduction of the second primer did not affect the detection of 5.8S rRNA.
5.8S Rev FAM and 5S Rev HEX primers optimization.
A Evaluation of two 5.8S Rev FAM primer quantities, 1 pmol and 10 pmol, using 0.06, 0.125, 0.25, 0.5 and 1 μg of RNA from U2OS cells. The plot reports 5.8S short peak area and R2 values were obtained by linear regression. B and C Optimization of 5S Rev HEX primer using 1, 2, 5 and 7 pmol of primer in a reaction with 10 pmol of 5.8S Rev FAM primer and 0.125 μg of total RNA from U2OS cells. The introduction of the second primer did not affect the detection of 5.8S rRNA.
Robustness of the method
To determine the robustness of the method we evaluated the amount of 5.8S isoforms using scalar dilutions of a standard RNA derived from different human tissues (Fig 4A). We observed that the average ratio values of 5.8Sl and 5.8Ss remained stable when RNA amount decreased (Fig 4A). However, when we evaluated 5.8Sc, the average ratio value was significantly increased when RNA amount was reduced, indicating that the evaluation of 5.8Sc with this method is more efficient in more concentrated samples. In addition, to assess the state of 5.8S isoforms over sample degradation, we performed primer extension and fragment analysis on total RNA from HeLa cells subjected to heat degradation at 90°C from 0 to 50 minutes (Fig 4B). Results showed that the average value of each isoform was constant up to 20 minutes. When RNA degradation increased, we observed a rise in 5.8Sl values and a decrease of 5.8Sc values, suggesting a different sensitivity to degradation of the different isoforms (Fig 4C). These results indicate that the method described here can be considered reliable in the tested RNA quantity range and that it can detect efficiently all the three isoforms in partially degraded samples whose aspect is similar to the sample incubated at 90°C for 20 minutes.
Robustness of the method.
A Evaluation of 5.8S isoforms using scalar dilutions of standard RNA in triplicate. The average values are consistent in the range of the quantities used except for 5.8Sc whose level remained stable only when using at least 0.5 μg of RNA. Comparison between the higher concentrated samples and each other concentration were performed using Student’s T test. B Representative electrophoresis image showing RNA degradation in samples incubated from 0 to 50 minutes at 90°C. C Evaluation of 5.8S isoforms using RNA degraded for 0, 10, 20, 30, 40, and 50 minutes at 90°C. The average values obtained from four replicates is similar from 0 to 20 minutes at 90°C. After 20 minutes the values of 5.8Sl and 5.8Sc resulted significantly different from the non-degraded samples. Comparison between the undegraded samples and each other condition were performed using Student’s T test. *<0.05, **<0.01, ***<0.001.
Discussion
From a literature search, it emerged that recent studies on 5.8S rRNA potential role in healthy and pathological tissues are currently lacking, in particular regarding 5.8S long. This could be due to the fact that in most NGS-based gene expression techniques rRNA is usually excluded from analyses. A second reason for the lack of studies on 5.8S rRNA could be ascribed to the fact that the most common technique used to study rRNA processing is Northern Blot. In fact, this technique is highly efficient for rRNA intermediates size detection but shows limitations in rRNA quantification. Moreover, it requires high quantities of good quality RNA (typically from 1.5 to 2.5 μg). In addition, given the use of radioactively labeled probes, dedicated rooms and strict protective measures to work with are necessary. On the contrary, the method that we propose, based on primer extension with fluorescent reverse primer designed on the 3’ of 5.8S rRNA followed by fragment analysis, results more easy and rapid compared to Northern Blot and it shows higher resolution. The determination of the area underneath the peaks using Peak Scanner software enables a direct quantification of the different peaks, identifying the different isoforms. Moreover, we demonstrated that it can be performed with limited amounts of RNA and with partially degraded samples (Fig 4). These features allow the analysis of 5.8S rRNA in so far excluded samples, such as RNA derived from frozen tissue, precious samples, or poorly concentrated samples.A further aspect worth of consideration is represented by the heterogeneity of peaks detected with the described technique. In fact, comparing 5S and 5.8S short peaks in Figs 1 and 3C, it is possible to see that they present a different shape. All RNA samples analyzed presented the same pattern that consist in a sharp and thin 5S peak (in green) and a larger 5.8S short peak (in blue) presenting two to three humps: a higher one corresponding to 153 nucleotides plus one 1-base shorter and one 1-base longer, not always detected. This difference can be due to the to the different reverse transcription efficiency on 5.8S rRNA, that presents several secondary structures. In addition, the M-MLV reverse transcriptase used here is known to append non-templated nucleotides to the 3’ end of RNA/cDNA duplexes, thus generating products with a random extra nucleotide [21-23]. This kind of event should occur on all 5’ uncapped RNA templates present in the reaction not affecting the possibility to discriminate the different RNA isoforms. Nonetheless, since 5’ portion of 5.8S originate from the exonucleolytic activity of XRN2 and other enzymes, as reported in literature [5-8], this heterogeneous peak could also represent trimming intermediates. Another possibility to consider, is that because of the previously mentioned one nucleotide heterogeneity at 5’ end of 5.8S short [4] additional isoforms of 5.8S could be present in cells, thus increasing the complexity of ribosomes. This possibility is in line with what reported by the studies describing 5.8S isoforms for the first time in human cells [3]. These results may suggest that ribosomes could differ from one another due to the presence of different 5.8S rRNA isoforms contributing, together with other elements, to ribosome heterogeneity. Therefore, these isoforms can be identified and further characterized using this method, given its high resolution. In this sense the method here described could be applied to characterize the 5.8S composition of ribosomes from different tissues (including normal and pathological tissues) or with different functional properties.(PDF)Click here for additional data file.25 Oct 2021PONE-D-21-30501Primer extension coupled with fragment analysis for rapid and quantitative evaluation of 5.8S rRNA isoformsPLOS ONEDear Dr. Montanaro,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.In addition to carefully addressing the concerns and comments raised by the reviewers, please take care of the following issues: 1) Line 104, please specify A260 for RNA quantification.2) Please consider adding a diagram in Fig.1 (possibly as Fig.1B and put current Fig.1B as 1C) to illustrate the mechanism of the method, including the labeling of the 5.8S rRNA (three forms) and the 5S rRNA by respective labeled primers in reverse transcription, the separation of the cDNA, the detection and the quantification.3) Please check sentence 241 for readability.4)Fig4B, line 254, please check whether the ratio decreases or rises.Please submit your revised manuscript by Dec 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Baisong Lu, Ph.DAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for stating the following in the Acknowledgments Section of your manuscript:[The Authors would like to thank Dr. Simona Ferrari for technical help and for the access to the sequencing facility and Dr. Marianna Penzo for critically reading the manuscript. This work was funded by Fondazione AIRC to LM (grant number IG 21562 - www.airc.it) and by Bologna University funds (www.unibo.it) from the Pallotti Legacy for Cancer Research to LM (no grant number available). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.]We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:[This work was funded by Fondazione AIRC to LM (grant number IG 21562 - www.airc.it) and by Bologna University funds (www.unibo.it) from the Pallotti Legacy for Cancer Research to LM (no grant number available). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.]Please include your amended statements within your cover letter; we will change the online submission form on your behalf.3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: N/AReviewer #2: N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: In this manuscript, Venturi and colleagues describe a useful primer extension technique based on fluorescently labeled primers, with reaction products analyzed by the capillary gel electrophoresis. This method does not require radioactively labeled probes, conventional denaturing polyacrylamide gels, and autoradiography. The described experimental protocol is applicable for the analysis of alternatively processed 5.8S forms and also provides a starting point for a similar type of analysis of other rRNAs. However, from what I see, there is one potentially significant methodological issue concerning the interpretation of key results, and a missing link with the previous literature directly relevant to the RNAs in question. These issues need to be corrected. There are also some statements regarding the processing pathway that are not fully accurate if one considers recent developments in the literature.Major issues.1. Lines 49-51: "Two isoforms of 5.8S rRNA have been described: a short form (5.8S short) and a longer one with 5 extra nucleotides at the 5’ of the sequence (5.8S long) (2, 3)".The authors cite 2010-2011 studies here. I wonder if the authors are familiar with a more recent study, which indicated the presence of 3 isoforms of 5.8S in both mouse and human cells, with two forms seemingly dependent on exonuclease activity (Wang et al., RNA 2015, 21(7):1240-8. doi: 10.1261/rna.051169.115). From looking at the data in Fig 1, it appears the authors are also seeing three isoforms: the electropherogram shows nicely an additional peak, at the expected position for where the 5' end of the 5.8S-cropped is supposed to be, as described by Wang et al (2015). This should be addressed in the discussion of the data, and the Abstract modified as well.2. Reverse transcriptases are known to efficiently append nontemplated nucleotides to the 3' end of RNA/cDNA duplexes, typically adding a single residue when working on a 5' uncapped RNA template, which is the case here (Biotechniques 2001, 30(3):574-80, 582; Scientific Reports 2017, 7:41769; J Biol Chem. 2019, 294(48):18220–18231). The protocol the authors used does not appear to include blunting of the ends of the RT reaction products. This will affect both the size of the RT products detected in the capillary electrophoresis setting (Fig 1), and the heterogeneity of any detected 5' ends in the sequencing analysis (Fig 2). Because this directly bears on the interpretation of the key results, the authors need, at the very least, discuss this caveat and re-evaluate their data with regard to the precise 5' end identification of different isoforms, taking into account this RT activity.Minor issues.1. The principal protocol (line 119 and the following) would be more valuable to other researchers if some additional details were provided to facilitate its application in other labs. In addition to the range of RNA concentrations tested in this study, please indicate the RNA amount you consider optimal for the technique. What kind of tubes did you use to minimize evaporation during incubation of these small volumes? Please indicate the source of the fluorescently labeled primers and the type of purification (if any was used) after the synthesis of these oligos.2. 48-49: "Ribosome biogenesis has been widely studied in yeast and only a few studies have been conducted on human cell lines." While it is true that this pathway used to be more intensely studied in yeast, there has been steady progress in human cells in recent years, certainly not 'only a few' studies. Consider, for example, the recent work on the human small subunit assembly, no less detailed than any work done in yeast (Sameer Singh et al, Science (2021). DOI:10.1126/science.abj5338).3. Lines 51-55 "the cleavage at the internal transcribed spacer 1 (ITS1) operated by RNAse MRP", "the long isoform derives from direct ITS1 cleavage by a still uncharacterized enzyme (8)". The model of ITS1 cleavages to which the authors are referring is debatable, and as the recent literature shows, is very likely incorrect, please see Li et al., Int. J. Mol. Sci. 2021, 22(13), 6690; https://doi.org/10.3390/ijms22136690. Nick Watkins' group also showed that MRP deletion had no appreciable effects on ITS1 cleavage in human cells (Ref 7).5. Refs 13 and 14 are identical.Reviewer #2: In the manuscript, Venturi and colleagues developed a method based on primer extension and fragment analysis for the peak in the electropherogram to evaluate 5.8S rRNA isoforms. The authors optimized the method by adjusting the RNA and primer amount and confirmed the 5.8rRNA isoforms by reverse transcription and 5’RACE. The results showed that the newly established method was able to analyze the abundance of two isoforms of 5.8S rRNA in samples with small amount or low quality rapidly and safely. It can be a very useful 5.8S rRNA isoform analysis method for basic research and clinical diagnostic applications. The authors provided a clear description for the methodology. However, the manuscript can be improved with some small changes.Minor concerns1. In the manuscript, the RNA samples were from cell lines or XpressRef Universal Total RNA. It will be great if the author provide normal patient frozen tissue data to confirm that the method can be used in clinical application.2. The authors mention that common technique such as Northern Blot requires high quantities of good quality RNA. The authors are recommended to provide the range of RNA amount used in traditional method to show that the new method is more sensitive.3. Where is Box1 in the Introduction part? I can only find it from the reference paper.4. In Materials and Methods, line98, the concentration of L-Glutamine and antibiotics should use specified (e.g. 2mM L-Gln) rather than stating 1%.5. In Materials and Methods, line108, “1X106 cells” 6 should be superscript.6. A and B labels were missing from Figure1.7. In Fig 1. legend, it is unnecessary to repeat the details which are already described in method part.8. There is no statistical analysis in the Materials and Methods. It will be better to do a statistical analysis for figure 4A and B.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.23 Nov 2021Academic Editor’s comments:1) Line 104, please specify A260 for RNA quantification.we added to the text absorbance 260 nm2) Please consider adding a diagram in Fig.1 (possibly as Fig.1B and put current Fig.1B as 1C) to illustrate the mechanism of the method, including the labeling of the 5.8S rRNA (three forms) and the 5S rRNA by respective labeled primers in reverse transcription, the separation of the cDNA, the detection and the quantification.thank you for your suggestion. we preferred to implement Fig.1A with additional details illustrating the mechanism of the method. Fig1B shows a typical electropherogram resulting from its application.3) Please check sentence 241 for readability.we changed the sentence: We observed that in two independent experiments 5.8S long/short value is similar in each sample, and that the average ratio value of the ratio results is stable when RNA amount decreases.4)Fig4B, line 254, please check whether the ratio decreases or rises.we changed the approach to calculate the amount of the different 5.8S rRNA isoforms, figures and text has been changed accordingly.Reviewer #1major1. Lines 49-51: "Two isoforms of 5.8S rRNA have been described: a short form (5.8S short) and a longer one with 5 extra nucleotides at the 5’ of the sequence (5.8S long) (2, 3)".The authors cite 2010-2011 studies here. I wonder if the authors are familiar with a more recent study, which indicated the presence of 3 isoforms of 5.8S in both mouse and human cells, with two forms seemingly dependent on exonuclease activity (Wang et al., RNA 2015, 21(7):1240-8. doi: 10.1261/rna.051169.115). From looking at the data in Fig 1, it appears the authors are also seeing three isoforms: the electropherogram shows nicely an additional peak, at the expected position for where the 5' end of the 5.8S-cropped is supposed to be, as described by Wang et al (2015). This should be addressed in the discussion of the data, and the Abstract modified as well.Thank you for the comment. We amended the text, the figure and the bibliography mentioning the additional cropped isoform and included its evaluation in our study.2. Reverse transcriptases are known to efficiently append nontemplated nucleotides to the 3' end of RNA/cDNA duplexes, typically adding a single residue when working on a 5' uncapped RNA template, which is the case here (Biotechniques 2001, 30(3):574-80, 582; Scientific Reports 2017, 7:41769; J Biol Chem. 2019, 294(48):18220–18231). The protocol the authors used does not appear to include blunting of the ends of the RT reaction products. This will affect both the size of the RT products detected in the capillary electrophoresis setting (Fig 1), and the heterogeneity of any detected 5' ends in the sequencing analysis (Fig 2). Because this directly bears on the interpretation of the key results, the authors need, at the very least, discuss this caveat and re-evaluate their data with regard to the precise 5' end identification of different isoforms, taking into account this RT activity.The issue regarding RT-mediated extra nucleotide addition was considered in the discussion (lines 302-308).Minor1. The principal protocol (line 119 and the following) would be more valuable to other researchers if some additional details were provided to facilitate its application in other labs. In addition to the range of RNA concentrations tested in this study, please indicate the RNA amount you consider optimal for the technique. What kind of tubes did you use to minimize evaporation during incubation of these small volumes? Please indicate the source of the fluorescently labeled primers and the type of purification (if any was used) after the synthesis of these oligos.we added these details in the protocol. The optimal RNA amount is 250 ng. tubes multiply-Pro cup 0.2ml PP sarstedt. The source of fluorescently labeled primers is IDT and they have been purified by HPLC.2. 48-49: "Ribosome biogenesis has been widely studied in yeast and only a few studies have been conducted on human cell lines." While it is true that this pathway used to be more intensely studied in yeast, there has been steady progress in human cells in recent years, certainly not 'only a few' studies. Consider, for example, the recent work on the human small subunit assembly, no less detailed than any work done in yeast (Sameer Singh et al, Science (2021). DOI:10.1126/science.abj5338).thank you for the suggestion, we changed the sentence accordingly.3. Lines 51-55 "the cleavage at the internal transcribed spacer 1 (ITS1) operated by RNAse MRP", "the long isoform derives from direct ITS1 cleavage by a still uncharacterized enzyme (8)". The model of ITS1 cleavages to which the authors are referring is debatable, and as the recent literature shows, is very likely incorrect, please see Li et al., Int. J. Mol. Sci. 2021, 22(13), 6690; https://doi.org/10.3390/ijms22136690. Nick Watkins' group also showed that MRP deletion had no appreciable effects on ITS1 cleavage in human cells (Ref 7).We thank the reviewer, we changed the text in the introduction and in the box1 to show how this specific issue is currently under debate.4. Refs 13 and 14 are identical.We corrected the error.Minor concerns1. In the manuscript, the RNA samples were from cell lines or XpressRef Universal Total RNA. It will be great if the author provide normal patient frozen tissue data to confirm that the method can be used in clinical application.We agree with the reviewer on the importance of the issue. We considered that using a limited number of pathological samples could not provide a definitive confirmation of the possibility to use the method on clinical samples. To test the method in controlled conditions we preferred to perform the experiment reported in Figure 4C.2. The authors mention that common technique such as Northern Blot requires high quantities of good quality RNA. The authors are recommended to provide the range of RNA amount used in traditional method to show that the new method is more sensitive.We reported RNA concentration typically used in northern blot analysis in the discussion paragraph.3. Where is Box1 in the Introduction part? I can only find it from the reference paper.The text of box1 is reported in the text file while the image is uploaded as a figure.4. In Materials and Methods, line98, the concentration of L-Glutamine and antibiotics should use specified (e.g. 2mM L-Gln) rather than stating 1%.We modified the text specifying the exact concentration of L-Glutamine, Penicillin and Streptomycin.5. In Materials and Methods, line108, “1X106 cells” 6 should be superscript.We corrected the error.6. A and B labels were missing from Figure1.We corrected the figure.7. In Fig 1. legend, it is unnecessary to repeat the details which are already described in method part.We modified the figure legend accordingly.8. There is no statistical analysis in the Materials and Methods. It will be better to do a statistical analysis for figure 4A and B.We added paragraph to the Materials and methods indicating the statistical analysis performed. We included statistical analysis in figure 4A and B.Submitted filename: Response to Reviewers - 2021-11-26T005323.482.docxClick here for additional data file.29 Nov 2021PONE-D-21-30501R1Primer extension coupled with fragment analysis for rapid and quantitative evaluation of 5.8S rRNA isoformsPLOS ONEDear Dr. Montanaro,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================Legend for Fig.1A should define the short names for the three isoforms.Line 28 and 76, ”two 5.8S isoforms” should be “three 5.8s isoforms”.==============================Please submit your revised manuscript by Jan 13 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Baisong Lu, Ph.DAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.30 Nov 2021Academic Editor’s comments:Legend for Fig.1A should define the short names for the three isoforms.We amended the figure legendLine 28 and 76, ”two 5.8S isoforms” should be “three 5.8s isoforms”.We corrected the errorsSubmitted filename: Response to Reviewers2.docxClick here for additional data file.3 Dec 2021Primer extension coupled with fragment analysis for rapid and quantitative evaluation of 5.8S rRNA isoformsPONE-D-21-30501R2Dear Dr. Montanaro,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Baisong Lu, Ph.DAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:7 Dec 2021PONE-D-21-30501R2Primer extension coupled with fragment analysis for rapid and quantitative evaluation of 5.8S rRNA isoformsDear Dr. Montanaro:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Baisong LuAcademic EditorPLOS ONE
Authors: Katherine E Sloan; Sandy Mattijssen; Simon Lebaron; David Tollervey; Ger J M Pruijn; Nicholas J Watkins Journal: J Cell Biol Date: 2013-02-25 Impact factor: 10.539
Authors: Madalee G Wulf; Sean Maguire; Paul Humbert; Nan Dai; Yanxia Bei; Nicole M Nichols; Ivan R Corrêa; Shengxi Guan Journal: J Biol Chem Date: 2019-10-22 Impact factor: 5.157