Pan Wu1, Xiao Yu2, Yue Peng3, Qian-Lu Wang3, Long-Tian Deng3, Wei Xing4. 1. Hematology Department, Hunan Children's Hospital, Changsha, 410007, Hunan Province, P.R. China. 2. Department of Nursing, The Third Xiangya Hospital of Central South University, Changsha, 410013, Hunan Province, P.R. China. 3. Department of Critical Care Medicine, The Third Xiangya Hospital of Central South University, No.138, Tongzipo Road, Changsha, 410013, Hunan Province, P.R. China. 4. Department of Critical Care Medicine, The Third Xiangya Hospital of Central South University, No.138, Tongzipo Road, Changsha, 410013, Hunan Province, P.R. China. xy3yyxw@csu.edu.cn.
Abstract
BACKGROUND: Studies have shown that ginsenoside R3 (Rg3) plays a protective role in sepsis-induced organ injuries and mitochondrial dysfunction. Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is regarded as a regulator in sepsis. However, the association between TUG1 and Rg3 remains elusive. METHODS: A sepsis mouse model was established by caecal ligation and puncture (CLP), and liver injury was induced by haematoxylin-eosin (H&E) staining. Lipopolysaccharide (LPS) was used to induce hepatocyte damage. The expression levels of TUG1, microRNA (miR)-200a-3p, and silencing information regulator 1 (SIRT1) were examined by quantitative real-time polymerase chain reaction (qRT-PCR) assays. Cell viability was monitored using the Cell Counting Kit-8 (CCK-8) assay. MitoSOX Red staining and CBIC2 (JC-1) dye were employed to detect mitochondrial reactive oxygen species (ROS) and mitochondrial transmembrane potential (MTP) levels, respectively. The interaction between miR-200a-3p and TUG1 or SIRT1 was confirmed via dual-luciferase reporter or RNA immunoprecipitation (RIP) assay. RESULTS: Rg3 upregulated TUG1 expression in liver tissues of CLP mice and LPS-induced hepatocytes. Rg3 could activate autophagy to improve mitochondrial dysfunction in LPS-treated hepatocytes, which was partially reversed by TUG1 depletion or miR-200a-3p overexpression. Importantly, TUG1 targeted miR-200a-3p to activate the SIRT1/AMP-activated protein kinase (AMPK) pathway in LPS-treated hepatocytes. Moreover, gain of TUG1 ameliorated mitochondrial dysfunction in LPS-treated hepatocytes by sequestering miR-200a-3p. CONCLUSION: Our study revealed that Rg3 increased TUG1 expression and reduced miR-200a-3p expression to stimulate the SIRT1/AMPK pathway, thereby enhancing autophagy to improve sepsis-induced liver injury and mitochondrial dysfunction.
BACKGROUND: Studies have shown that ginsenoside R3 (Rg3) plays a protective role in sepsis-induced organ injuries and mitochondrial dysfunction. Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is regarded as a regulator in sepsis. However, the association between TUG1 and Rg3 remains elusive. METHODS: A sepsis mouse model was established by caecal ligation and puncture (CLP), and liver injury was induced by haematoxylin-eosin (H&E) staining. Lipopolysaccharide (LPS) was used to induce hepatocyte damage. The expression levels of TUG1, microRNA (miR)-200a-3p, and silencing information regulator 1 (SIRT1) were examined by quantitative real-time polymerase chain reaction (qRT-PCR) assays. Cell viability was monitored using the Cell Counting Kit-8 (CCK-8) assay. MitoSOX Red staining and CBIC2 (JC-1) dye were employed to detect mitochondrial reactive oxygen species (ROS) and mitochondrial transmembrane potential (MTP) levels, respectively. The interaction between miR-200a-3p and TUG1 or SIRT1 was confirmed via dual-luciferase reporter or RNA immunoprecipitation (RIP) assay. RESULTS: Rg3 upregulated TUG1 expression in liver tissues of CLP mice and LPS-induced hepatocytes. Rg3 could activate autophagy to improve mitochondrial dysfunction in LPS-treated hepatocytes, which was partially reversed by TUG1 depletion or miR-200a-3p overexpression. Importantly, TUG1 targeted miR-200a-3p to activate the SIRT1/AMP-activated protein kinase (AMPK) pathway in LPS-treated hepatocytes. Moreover, gain of TUG1 ameliorated mitochondrial dysfunction in LPS-treated hepatocytes by sequestering miR-200a-3p. CONCLUSION: Our study revealed that Rg3 increased TUG1 expression and reduced miR-200a-3p expression to stimulate the SIRT1/AMPK pathway, thereby enhancing autophagy to improve sepsis-induced liver injury and mitochondrial dysfunction.
In China, sepsis is a severe threat to human health because of its high mortality, especially with regard to its subtypes, severe sepsis and septic shock [1, 2]. As the major contributor of death for patients admitted to the intensive care unit (ICU), sepsis generally induces dysfunction of multiple organs through diverse mechanistic pathways [3, 4]. The pathophysiology of sepsis is extremely complex, making current treatment less effective [5]. In sepsis, the liver can act as a lymphoid organ that mediates the immune response, removing bacteria and toxins, as well as inflammation, immune suppression, and organ injuries [6]. Notably, reducing liver injury and restoring liver function are regarded as important strategies that can decrease the morbidity and mortality of patients with sepsis. Therefore, it is necessary to explore in detail the molecular mechanism of sepsis progression to develop novel therapeutic targets and drugs.Mitochondria are the largest intracellular suppliers of energy. Sepsis-induced mitochondrial impairment has a close connection with clinical severity and organ dysfunction [7]. Mitophagy is a process by which cells clear away damaged mitochondria and has protective effects on sepsis-induced organ dysfunction [8]. Previous research proved that inhibition of mitophagy could improve the outcome of sepsis patients [9]. Moreover, autophagy may serve as a promising target for sepsis treatment [10].Ginsenoside Rg3 is a steroid glycoside derived from ginseng with anti-cancer and anti-inflammatory properties [11, 12]. For example, Yoon et al. showed that Rg3 is able to repress the NLR family pyrin domain containing 3 (NLRP3) inflammasome and oxidative stress colorectal neoplasia differentially expressed (CRNDE) by decreasing inducible nitric oxide synthase (iNOS) expression [13]. Previous research suggested that Rg3 could protect against cell and organ injuries and mitochondrial dysfunction caused by sepsis by improving AMP-activated protein kinase (AMPK)-mediated autophagy [14]. However, the particular mechanism of Rg3 in septic liver injury remains to be investigated.Long noncoding RNAs (lncRNAs) are a group of RNAs exceeding 200 nucleotides in length that have critical biological functions in human biological processes [15]. Numerous studies have elucidated that lncRNAs are involved in the regulation of sepsis-induced cell or organ injuries, such as lncRNA X inactivate-specific transcript (XIST) [16], lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) [17], and lncRNA colorectal neoplasia differentially expressed (CRNDE) [18]. Taurine-upregulated gene 1 (TUG1) is located at chromosome 22q12 and has a sequence length of 7.1 kb. Recently, an increasing number of investigations have highlighted the protective roles of TUG1 in various abnormal physical processes caused by sepsis, including acute lung injury [19]. Whether TUG1 participates in the regulatory role of Rg3 in sepsis-induced liver injury warrants further exploration.LncRNAs can act as competing endogenous RNAs (ceRNAs) of microRNAs (miRNAs), thereby increasing the expression of target genes [20]. In addition, an online database (starBase) predicted that both TUG1 and silencing information regulator 1 (SIRT1) had complementary binding regions with miR-200a-3p, implying an association between miR-200a-3p and TUG1 or SIRT1 in sepsis-induced liver injury. Furthermore, SIRT1 is essential for the activation of the AMPK pathway, which is required for reducing inflammation and organ dysfunction in sepsis [21, 22]. Hence, this study was conducted to explore the involvement of the TUG1/miR-200a-3p/SIRT1 axis in Rg3-mediated liver injury and mitochondrial dysfunction.
Methods
Caecal ligation and puncture (CLP)-induced sepsis model
Animal experiments in this assay were ethically approved by the Third Xiangya Hospital of Central South University. Eighteen C57BL/6 mice (male, 23–25 g, 7 weeks old) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The mice were kept at 25 °C with 12 h light each day in a single cage and supplied with regular diet and water. The abovementioned mice were randomly divided into three groups: (1) Sham group, (2) CLP group, and (3) CLP + Rg3 group (n = 6). The CLP-induced sepsis model was established in accordance with previous reports [23, 24]. Mice in the sham group were subjected to laparotomy without ligation and perforation. After intraperitoneal inoculation with Rg3 (20 mg/kg) (Sigma–Aldrich, St. Louis, MO, USA) for 1 h, mice in the CLP + Rg3 group underwent CLP. At 6 h post CLP treatment, all animals were sacrificed, and livers were resected for subsequent assays.
Haematoxylin-eosin(H&E) staining
This assay was implemented to detect liver tissue injury. After fixation with 10% formaldehyde for 2 days, live tissues were embedded in paraffin. Generated paraffin sections (4 μm) were dyed with an H&E staining kit (Solarbio, Beijing, China) according to the manufacturer’s instructions and then observed under a light microscope (magnification: 100 ×).
Cell culture and LPS treatment
Human primary hepatocytes (Corning Inc., Corning, NY, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; HyClone, Logan, UT, USA) supplemented with 10% FBS (HyClone) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA).LPS (1 μg/mL, Sigma–Aldrich) was added to treat cells for 12 h until 80% confluence, and the cells were recorded as LPS group. 100 mM stock solution of Rg3 was prepared with dimethyl sulfoxide (DMSO) and diluted to the indicated 25 μM concentration with culture medium before treatment. For cells in the LPS + Rg3 group, cells pretreated with 25 μM Rg3 for 6 h were exposed to 1 μg/mL LPS.
Cell transfection
Small hairpin RNA (shRNA) targeting lncRNA TUG1 (sh-TUG1) was transfected into human primary hepatocytes to silence its expression, with sh-NC as a negative control. The total sequence of TUG1 was inserted into the pcDNA3.1 vector to generate a TUG1-overexpressing vector (pcDNA3.1-TUG1), and pcDNA3.1-NC was used as a negative control. miR-200a-3p mimics were introduced into human primary hepatocytes to upregulate miR-200a-3p expression, with miR-NC as a negative control. The above oligonucleotides and plasmids were obtained from GenePharma (Shanghai, China). Cell transfection assays were conducted using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s directions. After 48 h, transfection efficiency was determined by qRT–PCR assays.
Isolation of mitochondria
Mitochondria derived from human primary hepatocytes were extracted using the Mitochondria Isolation Kit (Cat. NO. 89874, Thermo Fisher Scientific, Waltham, MA, USA) in accordance with the user’s manual and then kept on ice before downstream processing.
Western blot analysis
Radioimmunoprecipitation assay (RIPA) buffer (CWBIO, Beijing, China) was utilized to prepare protein samples according to the manufacturer’s instructions. After determining the concentration of samples with a bicinchoninic acid assay (BCA) kit (Sigma–Aldrich), 30 μg protein samples were separated through 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) by a wet electrophoretic transfer approach. After blockage with 5% bovine serum albumin (BSA) (Sigma–Aldrich) at room temperature for 1 h, membranes were incubated with primary mouse antibodies against mitochondrial respiratory chain-related proteins Complex I (ab110245, 1:1000 dilution, Abcam, Shanghai, China), Complex II (ab110410, 1:1000 dilution, Abcam), and OPA1 Mitochondrial Dynamin Like GTPase (OPA1) (ab119685, 1:2000 dilution, Abcam), autophagy-related proteins light chain 3 (LC3) (ab243506, 1:3000 dilution, Abcam), P62 (ab56416, 1:3000 dilution, Abcam), and Beclin-1 (ab118148, 1:2000 dilution, Abcam), mitochondrial biogenesis related transcription factors peroxisome proliferator-activated receptor-γ coactivator 1-α (PGC1-α) (ab77210, 1:3000 dilution, Abcam), Nuclear Respiratory Factor 1 (NRF-1) (ab55744, 1:2000 dilution, Abcam), and Transcription Factor A (Tfam) (ab119684, 1:1000 dilution, Abcam), SIRT1 (ab110304, 1:3000 dilution, Abcam), AMPK (ab80039, 1:3000 dilution, Abcam), Acetyl-CoA Carboxylase (ACC) (sc-137,104, 1:2000 dilution, Santa Cruz), p-ACC (sc-271,965, 1:1500 dilution, Santa Cruz), Voltage Dependent Anion Channel 1 (VDAC1) (ab186321, 1:5000 dilution, Abcam), β-Actin (ab8226, 1:5000 dilution, Abcam), or primary rabbit antibody against p-AMPK (Cat. NO. PA5–110151, 1:2000 dilution, Invitrogen) at 4 °C overnight and then probed with goat anti-mouse immunoglobulin G (IgG) H&L (HRP) (ab205719, 1:8000 dilution, Abcam) or goat anti-rabbit IgG H&L (HRP) (ab205718, 1:8000 dilution, Abcam) secondary antibodies at room temperature for 2 h. Subsequently, protein signals were generated by using an enhanced chemiluminescence (ECL) Western blot detection system (Millipore) and analysed by ImageJ software (NIH, Bethesda, MD, USA). Anti-VDAC1 or anti-β-Actin acted as internal controls for mitochondria and cytoplasm, respectively.
Live tissues or treated human primary hepatocytes were exposed to TRIzol reagent (Invitrogen) for extraction of total RNA. To detect lncRNA TUG1 and SIRT1 expression, total RNA was subjected to complementary DNA (cDNA) synthesis utilizing M-MLV Reverse Transcriptase (Invitrogen), and then qRT–PCR assay was performed with SYBR Master Mix (Applied Biosystems, Foster City, CA, USA). For the miR-200a-3p expression assay, cDNA was generated using a TaqMan miRNA Reverse Transcription Kit (Applied Biosystems), followed by qRT–PCR assay utilizing a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). All primers involved in the qRT–PCR assay were listed in Table 1. The relative expression was determined via 2-ΔΔCt method. GAPDH and U6 were used as the internal parameters for genes (TUG1 and SIRT1) and miR-200a-3p, respectively.
Table 1
Primers used for qRT-PCR assay
Gene
Sequence (5′ → 3′)
TUG1 (mouse)
Forward: GAGACACGACTCACCAAGCA
Reverse: GAAGGTCATTGGCAGGTCCA
TUG1 (human)
Forward: ACGACTGAGCAAGCACTACC
Reverse: CTCAGCAATCAGGAGGCACA
miR-200a-3p
Forward: CGCCGTAACACTGTCTGGTAA
Reverse: TCCTCCTCTCCTTCCTTCTC
SIRT1
Forward: CAGTGGCTGGAACAGTGAGA
Reverse: TCTGGCATGTCCCACTATCA
GAPDH (mouse)
Forward: AGCCCAAGATGCCCTTCAGT
Reverse: CCGTGTTCCTACCCCCAATG
GAPDH (human)
Forward: CCAGGTGGTCTCCTCTGA
Reverse: GCTGTAGCCAAATCGTTGT
U6
Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT
Primers used for qRT-PCR assay
Cell counting Kit-8 (CCK-8) assay
After treatment with LPS or LPS + Rg3, human primary hepatocytes were plated in 96-well plates (5 × 103 cells/per well). Then, 10 μL CCK-8 solution (Sigma–Aldrich) was added to each well. After 1 h of incubation with CCK-8 solution, cell viability was evaluated by measuring the absorbance at 450 nm using a microplate reader.
Reactive oxygen species (ROS) measurement
MitoSOX™ Red reagent (Cat. NO. M36008, Thermo Fisher Scientific) was applied to detect mitochondrial ROS level in human primary hepatocytes based on the protocol supplied by the manufacturer. Human primary hepatocytes after treatment and/or transfection were washed by PBS twice, then incubated with l μM MitoSOX Red for 20 min. Subsequently, cells were trypsinized and suspended in PBS. Later, a fluorescence spectrophotometer was used to assess fluorescent intensity (Ex/Em = 510/580 nm).
Detection of mitochondrial transmembrane potential (MTP)
JC-1 (CBIC2) dye (ab141387, Abcam) was employed to measure the MTP of human primary hepatocytes. JC-1 (10 μM) in DMEM was added to human primary hepatocytes at 37 °C for 20 min, followed by measurement of JC-1 aggregate fluorescence (red) (Ex/Em = 488/583 nm) and JC-1 monomer fluorescence (green) (Ex/Em = 488/525 nm) under a fluorescence microscope.
Bioinformatic analysis
In the present study, the putative binding site between miR-200a-3p and TUG1 or SIRT1 was analysed using the starBase online database (http://starbase.sysu.edu.cn/).
Dual-luciferase reporter assay
For the dual-luciferase reporter assay, wild-type luciferase reporter plasmids (TUG1-WT and SIRT1-WT) containing predicted binding sites with miR-200a-3p, as well as mutant plasmids (TUG1-MUT and SIRT1-MUT) containing mutant binding sites, were established by RIBOBIO (Guangzhou, China). Subsequently, human primary hepatocytes were cotransfected with 100 ng luciferase reporter plasmid and 40 nM miR-NC or miR-200a-3p mimic. At 48 h post transfection, the relative luciferase density was evaluated utilising a Dual-Luciferase Reporter detection System (Promega, Shanghai, China) and normalised to Renilla luciferase activity.
RNA immunoprecipitation (RIP) assay
RIP assay was carried out to validate the binding efficiency between lncRNA TUG1 and miR-200a-3p using the Magna RIP Kit (Millipore) following the recommended instructions. Human primary hepatocytes were subjected to lysis in specific lysis buffer. Generated cell lysate was mixed with magnetic beads conjugated with anti-Argonaute-2 (Ago2) antibody or anti-immunoglobulin G (IgG) antibody overnight on a shaker. Afterwards, proteinase K was added to purify RNA. Enrichment of lncRNA TUG1 and miR-200a-3p was measured by qRT–PCR assays.
Statistical analysis
Quantitative data derived from at least 3 independent experiments were presented as the mean ± standard deviation (SD). Statistical significance in groups was determined by the Mann–Whitney U test (for 2 groups) or Kruskal–Wallis-Wallis test (for 3 or more groups). A P value < 0.05 was defined as statistically significant.
Results
LncRNA TUG1 was involved in sepsis-induced liver injury and mitochondrial dysfunction improvement triggered by Rg3
LncRNA TUG1 was proven to be associated with the development of sepsis [25]. First, we constructed a standard sepsis mouse model utilizing CLP [26]. As shown in Fig. 1A, Rg3 significantly attenuated sepsis-induced liver injury in mouse liver tissues. Western blot assays revealed that mitochondrial respiratory chain-related proteins, including complex I, complex II, and OPA1, were obviously downregulated in liver tissues of the CLP group, and all of which were efficiently relieved by Rg3 administration (Fig. 1B-C). Moreover, apparently decreased TUG1 expression was detected in liver tissues of CLP group, while Rg3 pretreatment upregulated TUG1 expression (Fig. 1D). We then investigated the impact of Rg3 on LPS-induced human primary hepatocytes. CCK-8 assay showed that pretreatment with Rg3 increased the viability of LPS-induced human primary hepatocytes (Fig. 1E). Furthermore, Rg3 also ameliorated LPS-induced downregulation of the protein levels of complex I, complex II, and OPA1 in hepatocytes (Fig. 1F-G). LPS-induced downregulation of TUG1 expression in LPS-induced hepatocytes was largely recovered by Rg3 pretreatment (Fig. 1H). The above results suggested that TUG1 might participate in sepsis-induced liver injury and mitochondrial dysfunction improvement triggered by Rg3.
Fig. 1
LncRNA TUG1 was involved in sepsis-induced liver injury and mitochondrial dysfunction improvement triggered by Rg3. (A-D) C57BL/6 mice were randomly divided into sham group, CLP group, and CLP + Rg3 group (n = 6). (A) H&E staining for liver injury in mouse liver tissues. (B-C) Western blot assay for the protein levels of complex I, complex II, and OPA1 in mouse liver tissues. (D) qRT–PCR assay for the relative expression of TUG1 in liver tissues. (E-H) Human primary hepatocytes were treated with LPS or LPS + Rg3. (E) CCK-8 assay for the cell viability of treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (H) qRT–PCR assay for the relative expression of TUG1 in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
LncRNA TUG1 was involved in sepsis-induced liver injury and mitochondrial dysfunction improvement triggered by Rg3. (A-D) C57BL/6 mice were randomly divided into sham group, CLP group, and CLP + Rg3 group (n = 6). (A) H&E staining for liver injury in mouse liver tissues. (B-C) Western blot assay for the protein levels of complex I, complex II, and OPA1 in mouse liver tissues. (D) qRT–PCR assay for the relative expression of TUG1 in liver tissues. (E-H) Human primary hepatocytes were treated with LPS or LPS + Rg3. (E) CCK-8 assay for the cell viability of treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (H) qRT–PCR assay for the relative expression of TUG1 in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
TUG1 knockdown almost reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes
In view of the possible connection of lncRNA TUG1 with the role of Rg3 in sepsis-induced liver injury and mitochondrial dysfunction, the effect of TUG1 on Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes was explored. First, TUG1 expression in LPS-treated hepatocytes was significantly decreased due to transfection with sh-TUG1 in contrast to cells transfected with sh-NC (Fig. 2A). Later, we found that Rg3 significantly increased the levels of LC3 II/LC3 I and Beclin-1 in LPS-treated hepatocytes, while TUG1 knockdown obviously abated Rg3-induced the upregulation of LC3 II/LC3 I and Beclin-1, while the p62 level was changeless (Fig. 2B-C). Rg3 pretreatment significantly inhibited LPS-induced mitochondrial ROS production in hepatocytes, which was almost relieved by TUG1 depletion (Fig. 2D, Fig. S1A). As reported, green fluorescence at 525 nm could indicate a low MTP level [27]. As illustrated in Fig. 2E-F, Rg3 efficiently reduced the LPS-induced high level of green fluorescence in hepatocytes, which was enhanced by silencing TUG1. In other words, TUG1 knockdown rescued the promoting effect of Rg3 on the LPS-induced decrease in MTP level. Moreover, Rg3-induced downregulation of OPA1, complex I, and complex II in LPS-induced hepatocytes were impaired by depletion of TUG1 (Fig. 2G-H). Meanwhile, the results from western blot assay also suggested that Rg3 increased the protein levels of PGC1-α, NRF-1, and Tfam, while TUG1 knockdown attenuated these facilitating effects (Fig. 2I-J). These results suggest that Rg3 activated autophagy to improve mitochondrial dysfunction in LPS-treated hepatocytes by increasing TUG1 expression.
Fig. 2
TUG1 knockdown almost reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes. (A) qRT–PCR assay for the relative expression of TUG1 in hepatocytes transfected with sh-NC, or sh-TUG1. (B-J) Hepatocytes were treated with LPS, LPS + Rg3, LPS + Rg3 combined with sh-NC transfection, or LPS + Rg3 combined with sh-TUG1 transfection. (B-C) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (D) MitoSOX Red staining for the mitochondrial ROS level in treated cells. (E-F) JC-1 staining for the MTP level in treated cells. (G-H) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (I-J) Western blot assay for the protein levels of PGC1-α, NRF-1, and Tfam in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
TUG1 knockdown almost reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes. (A) qRT–PCR assay for the relative expression of TUG1 in hepatocytes transfected with sh-NC, or sh-TUG1. (B-J) Hepatocytes were treated with LPS, LPS + Rg3, LPS + Rg3 combined with sh-NC transfection, or LPS + Rg3 combined with sh-TUG1 transfection. (B-C) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (D) MitoSOX Red staining for the mitochondrial ROS level in treated cells. (E-F) JC-1 staining for the MTP level in treated cells. (G-H) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (I-J) Western blot assay for the protein levels of PGC1-α, NRF-1, and Tfam in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
TUG1 sponged miR-200a-3p to activate the SIRT1/AMPK pathway
It is widely accepted that lncRNAs can indirectly regulate the expression and functions of target mRNAs by absorbing miRNAs [28]. In this study, starBase predicted that TUG1 had binding sites for miR-200a-3p (Fig. 3A). In addition, gain of miR-200a-3p resulted in a notable reduction in the luciferase activity of TUG1-WT relative to miR-NC, while no significant change was observed in the luciferase activity of TUG1-MUT (Fig. 3B). The RIP assay also demonstrated the binding efficiency between TUG1 and miR-200a-3p, evidenced by the high enrichment of TUG1 and miR-200a-3p in the Ago2 pellet, rather than IgG (Fig. 3C). qRT–PCR assays revealed that Rg3 evidently repressed LPS-induced miR-200a-3p expression in hepatocytes, which was regained by transfection with sh-TUG1 (Fig. 3D). Moreover, Rg3 pretreatment restored the LPS-induced downregulation of SIRT1, p-AMPK, and p-ACC protein levels in hepatocytes, while introduction of sh-TUG1 partially reversed the effect of Rg3 (Fig. 3E-F). Furthermore, starBase identified that miR-200a-3p might interact with SIRT1 via base pairing (Fig. 3G). The dual-luciferase reporter assay showed that transfection with miR-200a-3p mimic greatly reduced the luciferase density of SIRT1-WT in contrast to miR-NC, while it had no significant impact on that of SIRT1-MUT (Fig. 3H). As exhibited in Fig. 3I, when compared to pcDNA3.1-NC, introduction with pcDNA3.1-TUG1 markedly increased TUG1 and SIRT1 expression while downregulating miR-200a-3p expression in hepatocytes. In comparison with miR-NC, enforced expression of miR-200a-3p decreased SIRT1 expression in hepatocytes (Fig. 3J). In addition, overexpression of TUG1 recovered the decreased protein levels of SIRT1, p-AMPK, and p-ACC in LPS-treated hepatocytes, which was undermined by upregulated miR-200a-3p (Fig. 3K-L). Collectively, TUG1 can activate the SIRT1/AMPK pathway by sponging miR-200a-3p.
Fig. 3
TUG1 sponged miR-200a-3p to activate the SIRT1/AMPK pathway. (A) Binding position between TUG1 and miR-200a-3p predicted by starBase. (B) Dual-luciferase reporter assay for the luciferase density of TUG1-WT and TUG1-MUT in hepatocytes cotransfected with miR-NC or miR-200a-3p mimic. (C) RIP assay for the binding potency between TUG1 and miR-200a-3p. (D-F) Hepatocytes were divided into control, LPS, LPS + Rg3, LPS + Rg3 combined with sh-NC transfection, or LPS + Rg3 combined with sh-TUG1 transfection. (D) qRT–PCR assay for the relative expression of miR-200a-3p in treated cells. (E-F) Western blot assay for the protein levels of SIRT1, p-AMPK, AMPK, p-ACC, and ACC in treated cells. (G) Binding position between miR-200a-3p and SIRT1 predicted by starBase. (H) Dual-luciferase reporter assay for the luciferase density of SIRT1-WT and SIRT1-MUT in hepatocytes cotransfected with miR-NC or miR-200a-3p mimic. (I) qRT–PCR assay for the relative expression of TUG1, miR-200a-3p, and SIRT1 in hepatocytes transfected with pcDNA3.1-NC or pcDNA3.1-TUG1. (J) qRT–PCR assay for the relative expression of miR-200a-3p and SIRT1 in hepatocytes transfected with miR-NC or miR-200a-3p mimic. (K-L) Western blot assay for the protein levels of SIRT1, p-AMPK, AMPK, p-ACC, and ACC in hepatocytes divided into control, LPS, LPS combined with pcDNA3.1-NC transfection, LPS combined with pcDNA3.1-TUG1 transfection, LPS combined with pcDNA3.1-TUG1 + miR-NC transfection, or LPS combined with pcDNA3.1-TUG1 + miR-200a-3p mimic transfection. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
TUG1 sponged miR-200a-3p to activate the SIRT1/AMPK pathway. (A) Binding position between TUG1 and miR-200a-3p predicted by starBase. (B) Dual-luciferase reporter assay for the luciferase density of TUG1-WT and TUG1-MUT in hepatocytes cotransfected with miR-NC or miR-200a-3p mimic. (C) RIP assay for the binding potency between TUG1 and miR-200a-3p. (D-F) Hepatocytes were divided into control, LPS, LPS + Rg3, LPS + Rg3 combined with sh-NC transfection, or LPS + Rg3 combined with sh-TUG1 transfection. (D) qRT–PCR assay for the relative expression of miR-200a-3p in treated cells. (E-F) Western blot assay for the protein levels of SIRT1, p-AMPK, AMPK, p-ACC, and ACC in treated cells. (G) Binding position between miR-200a-3p and SIRT1 predicted by starBase. (H) Dual-luciferase reporter assay for the luciferase density of SIRT1-WT and SIRT1-MUT in hepatocytes cotransfected with miR-NC or miR-200a-3p mimic. (I) qRT–PCR assay for the relative expression of TUG1, miR-200a-3p, and SIRT1 in hepatocytes transfected with pcDNA3.1-NC or pcDNA3.1-TUG1. (J) qRT–PCR assay for the relative expression of miR-200a-3p and SIRT1 in hepatocytes transfected with miR-NC or miR-200a-3p mimic. (K-L) Western blot assay for the protein levels of SIRT1, p-AMPK, AMPK, p-ACC, and ACC in hepatocytes divided into control, LPS, LPS combined with pcDNA3.1-NC transfection, LPS combined with pcDNA3.1-TUG1 transfection, LPS combined with pcDNA3.1-TUG1 + miR-NC transfection, or LPS combined with pcDNA3.1-TUG1 + miR-200a-3p mimic transfection. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
Overexpression of miR-200a-3p weakened the TUG1-mediated improvement in mitochondrial dysfunction in LPS-treated hepatocytes
After determining that TUG1 sponges miR-200a-3p to activate the SIRT1/AMPK pathway in hepatocytes, we further explored the role of miR-200a-3p in TUG1-mediated amelioration of mitochondrial dysfunction. The results indicated that upregulation of TUG1 enhanced autophagy activation, while these effects were reversed by miR-200a-3p mimics (Fig. 4A-B). Gain of TUG1 reduced ROS levels in LPS-treated hepatocytes, while cotransfection with miR-200a-3p largely recovered mitochondrial ROS levels (Fig. 4C, Fig. S1B). As shown in Fig. 4D-E, overexpression of miR-200a-3p almost restored the upregulated TUG1 expression-induced decrease in MTP levels in LPS-treated hepatocytes. Western blot analysis showed that overexpression of TUG1 could increase mitochondrial dysfunction in LPS-treated hepatocytes by enhancing complex I, complex II, and OPA levels, which were all significantly diminished by miR-200a-3p (Fig. 4F-G). Moreover, the protective impact of overexpressed TUG1 on mitochondrial biogenesis in promoting the levels of PGC-1α, NRF-1, and Tfam in LPS-treated hepatocytes was restrained by cotransfection of miR-200a-3p (Fig. 4H-I). Therefore, overexpression of TUG1 improved mitochondrial dysfunction in LPS-treated hepatocytes, which might be attributed to its downregulation effect on miR-200a-3p expression.
Fig. 4
Overexpression of miR-200a-3p weakened the TUG1-mediated improvement in mitochondrial dysfunction in LPS-treated hepatocytes. Hepatocytes were treated with control (blank), LPS, LPS combined with pcDNA3.1-NC transfection, LPS combined with pcDNA3.1-TUG1 transfection, LPS combined with pcDNA3.1-TUG1 + miR-NC transfection, or LPS combined with pcDNA3.1-TUG1 + miR-200a-3p mimic transfection. (A-B) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (C) MitoSOX Red staining for the mitochondrial ROS level in treated cells. (D-E) JC-1 staining for the MTP level in treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (H-I) Western blot assay for the protein levels of PGC1-α, NRF-1, and Tfam in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
Overexpression of miR-200a-3p weakened the TUG1-mediated improvement in mitochondrial dysfunction in LPS-treated hepatocytes. Hepatocytes were treated with control (blank), LPS, LPS combined with pcDNA3.1-NC transfection, LPS combined with pcDNA3.1-TUG1 transfection, LPS combined with pcDNA3.1-TUG1 + miR-NC transfection, or LPS combined with pcDNA3.1-TUG1 + miR-200a-3p mimic transfection. (A-B) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (C) MitoSOX Red staining for the mitochondrial ROS level in treated cells. (D-E) JC-1 staining for the MTP level in treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. (H-I) Western blot assay for the protein levels of PGC1-α, NRF-1, and Tfam in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
Gain of miR-200a-3p partially reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes
After observing the restorative effects of miR-200a-3p on the TUG1-mediated improvement in mitochondrial dysfunction in LPS-treated hepatocytes, we then investigated the influence of miR-200a-3p on the role of Rg3 in LPS-treated hepatocytes. We found that gain of miR-200a-3p partially reversed the autophagy activation mediated by Rg3 treatment in LPS-treated hepatocytes (Fig. 5A-B). As exhibited in Fig. 5C, the reduction in mitochondrial ROS levels caused by Rg3 administration in LPS-treated hepatocytes was attenuated by miR-200a-3p overexpression. Additionally, overexpression of miR-200a-3p also alleviated the suppressive effects of Rg3 on MTP levels in LPS-treated hepatocytes (Fig. 5D-E). Cotransfection with miR-200a-3p largely ameliorated the effects of Rg3 on mitochondrial proteins (complex I, complex II, and OPA) (Fig. 5F-G). In summary, Rg3 might activate autophagy to improve mitochondrial dysfunction in LPS-treated hepatocytes by reducing miR-200a-3p expression.
Fig. 5
Gain of miR-200a-3p partially reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes. Hepatocytes were divided into control LPS, LPS + Rg3, LPS + Rg3 combined with miR-NC transfection, or LPS + Rg3 combined with miR-200a-3p mimic transfection. (A-B) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (C) MitoSOX™ Red staining for the mitochondrial ROS level in treated cells. (D-E) JC-1 staining for the MTP level in treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
Gain of miR-200a-3p partially reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes. Hepatocytes were divided into control LPS, LPS + Rg3, LPS + Rg3 combined with miR-NC transfection, or LPS + Rg3 combined with miR-200a-3p mimic transfection. (A-B) Western blot assay for the protein levels of LC3, P62, and Beclin-1 in treated cells. (C) MitoSOX™ Red staining for the mitochondrial ROS level in treated cells. (D-E) JC-1 staining for the MTP level in treated cells. (F-G) Western blot assay for the protein levels of complex I, complex II, and OPA1 in treated cells. n = 3 independent experiments. Differences between groups were compared using the Mann–Whitney U test or Kruskal–Wallis-Wallis test. *P < 0.05, **P < 0.01
Discussion
Sepsis is characterized by multiple organ failure, and directly targeted interventions currently remain unsuccessful [29]. Therefore, the exploration of novel therapeutic methods is crucial. Ginsenoside Rg3 suppresses tumour growth by enhancing apoptosis, decelerating proliferation, metastasis, and angiogenesis, increasing the chemosensitivity of tumour cells, and promoting host immunity [11]. As a multifunctional factor, Rg3 can also exert a protective effect on diabetic kidney disease by repressing the inflammatory response [30]. Additionally, Rg3 effectively ameliorated LPS-induced acute lung injury through certain specific pathways [14, 31, 32]. This study showed that Rg3 attenuated sepsis-induced liver injury and mitochondrial dysfunction by regulating the TUG1/miR-200a-3p/SIRT1/AMPK axis.Noncoding RNAs, including lncRNAs, can affect septic organ injury. For example, knockdown of lncRNA metastasis associated with lung adenocarcinoma transcript 1 (MALAT1) ameliorated cardiac inflammation and damage caused by sepsis by regulating miR-125b/p38 MAPK/NF-κB signalling [33]. Depletion of NEAT1 suppressed sepsis-induced acute liver injury and inflammation by targeting the let-7a/TLR4 axis [17]. Moreover, lncRNA TUG1 weakened septic acute lung injury by inhibiting inflammation and apoptosis [19]. Similarly, TUG1 was observed to be downregulated in the plasma of sepsis patients [25]. Consistent with our data, the downregulation of TUG1 was detected in liver tissues of CLP mice and LPS-induced hepatocytes, implying the potential role of TUG1 in sepsis, which was upregulated by Rg3 pretreatment. Importantly, TUG1 knockdown almost reversed Rg3-induced mitochondrial dysfunction improvement in LPS-treated hepatocytes, suggesting its protective impact in organ injury. Zhao et al. revealed that TUG1 promoted the expression of Beclin 1 and LC3 II/I but decreased p62 expression to activate autophagy, thus protecting against LPS-induced podocyte injury [34]. Likewise, overexpression of TUG1 was also confirmed to be associated with mitochondrial biochemistry in diabetic mouse podocytes [35]. These observations further supported that TUG1 might be a protector against sepsis.LncRNAs can function as ceRNAs to sponge miRNAs to post-transcriptionally regulate mRNA expression [36]. Herein, starBase was employed to identify the target miRNAs of TUG1. miR-200a-3p was confirmed as a candidate, and its expression was negatively regulated by TUG1. MiR-200a-3p has been widely investigated in human malignancies [37, 38]. However, there are few reports of miR-200a-3p in sepsis. Xiao et al. also discovered that miR-200a-3p aggravated oxidative stress-stimulated liver cell death [39]. Yu et al. reported that miR-200a-3p was upregulated in a sepsis model, and miR-200a-3p overexpression facilitated inflammation in sepsis-induced brain injury [40]. Our data identified that enforced expression of miR-200a-3p impaired mitochondrial functions and autophagy, which partially reversed the protective roles of TUG1 overexpression and Rg3 treatment in LPS-treated hepatocytes. These data indicated that miR-200a-3p worked as a target of TUG1 to participate in the Rg3-mediated regulatory network in sepsis.In the present study, our data confirmed that SIRT1 acted as a target for miR-200a-3p that could be positively regulated by TUG1. SIRT1, a member of the Sirtuin family, is an enzyme responsible for the cellular regulation of protein deacetylation and has been widely implicated in metabolic control and mitochondrial biogenesis [41]. Additionally, evidence has revealed that SIRT1 is involved in the remission of multiple organ damage resulting from sepsis [42-44]. AMPK is an evolutionarily conserved serine/threonine-protein kinase that acts as an important activator of autophagy by modulating autophagy-associated proteins or genes [45]. Additionally, SIRT was confirmed to accelerate AMPK-activated autophagy [46]. Interestingly, in this work, our data proved that TUG1 promoted SIRT1/AMPK signalling by sponging miR-200a-3p, implying that the effects of the TUG1/miR-200a-3p axis on mitochondrial functions and autophagy might be dependent on regulating SIRT1/AMPK signalling.
Conclusions
In conclusion, our results manifested that Rg3 activated AMPK-dependent autophagy by regulating the TUG1/miR-200a-3p/SIRT1 signalling pathway, thus improving sepsis-induced mitochondrial dysfunction and liver injury. This study provided a novel molecular mechanistic pathway by which Rg3 functions in sepsis-induced liver injury, highlighting the important role of Rg3. However, certain limitations should be recognized. The in vivo data were relatively limited, and more assays in a sepsis mouse model will need to be performed in the near future.Additional file 1.
Authors: Jun Zhou; Ye Chen; Guo-Qing Huang; Jun Li; Gang-Ming Wu; Li Liu; Yi-Ping Bai; Jian Wang Journal: J Surg Res Date: 2012-04-01 Impact factor: 2.192