| Literature DB >> 34925436 |
Qi Jin1,2, Xiaohua Jiang2, Xin Du3, Weiping Hu4, Shun Bai2, Xian Wang5, Bo Xu2, Weidong Zhao1,4.
Abstract
Because the incidence of endometrial cancer is notably increasing worldwide, it has become the leading gynecologic cancer in the United States. Standard treatment results in the loss of reproductive function in women of childbearing age. Furthermore, advanced cancer stages are associated with poor overall survival. The aim of this study was to explore the abnormal expression profile of genes during the development of endometrial cancer, which is essential to provide a better understanding of the mechanisms involved. Five pairs of endometrial cancer tissues and normal endometrial tissues were subjected to next-generation transcriptome sequencing technology. Quantitative real-time PCR (RT-qPCR) was performed to validate the expression profile of key differentially expressed genes (2.0-fold change, adj. p < 0.05) (DEGs) identified in the RNA-seq result. GO and KEGG pathways were used for bioinformatic analyses. The transcriptomic sequencing results showed 1153 DEGs, including 673 upregulated and 480 downregulated genes, in the EC specimens. Decreased expression of ID1, IGF1, GDF7, SMAD9, TGF-beta and WNT4, as well as GDF5, INHBA and ERBB4 overexpression, were confirmed in EC using RT-qPCR. Additionally, EC tissue exhibited marked enrichment in genes promoting cellular adhesion, proliferation, migration and plasma membrane. KEGG analysis revealed changes in various pathways, such as the TGF-beta, PI3K-Akt, Wnt, and estrogen pathways. Our data describe the molecular events involved in the pathogenesis of EC, which may be potential diagnostic markers and targets of therapeutic interventions.Entities:
Keywords: PI3K-Akt pathway; TGF- β pathway; endometrial cancer; enrichment analysis; transcriptome sequencing
Year: 2021 PMID: 34925436 PMCID: PMC8678463 DOI: 10.3389/fgene.2021.680331
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Clinical-pathologic characteristics of patients.
| Patient ID | Age | Pathological type | Histological grade | TNM stage | Tumour size | Depth of myometrial invasion | Lymph node metastasis |
|---|---|---|---|---|---|---|---|
| EC 4 | 55 | Endometrioid carcinoma | Moderately differentiated | IIIC2 | >2 cm | <1/2 | Yes |
| EC 6 | 53 | Endometrioid carcinoma | Moderately differentiated | II | >2 cm | <1/2 | No |
| EC 9 | 61 | Endometrioid carcinoma | Poorly differentiated | II | <2 cm | <1/2 | No |
| EC 19 | 53 | Endometrioid carcinoma | Well differentiated | IA | >2 cm | <1/2 | No |
| EC 20 | 41 | Endometrioid carcinoma | Well differentiated | IB | >2 cm | ≥1/2 | No |
FIGURE 1Immunohistochemical markers of PCNA, CK7, Vim and β-catenin were expressed at higher levels in endometrial cancer tissues than in the control group.
Top 20 upregulated genes.
| Gene_id | log2FoldChange | pValue | Product |
|---|---|---|---|
| DKK4 | 9.49490016254192 | 1.04E-21 | Dickkopf WNT signaling pathway inhibitor 4 |
| CXCL5 | 7.06885630360606 | 1.98E-18 | C-X-C motif chemokine ligand 5 |
| KRT6A | 8.40409722553361 | 5.51E-18 | Keratin 6A |
| JCHAIN | 6.06198197453528 | 6.50E-17 | Joining chain of multimeric IgA and IgM |
| IGLL5 | 5.8619180160352 | 4.14E-14 | Immunoglobulin lambda like polypeptide 5 |
| MYH11 | 5.06142411741398 | 5.25E-13 | Myosin heavy chain 11 |
| DES | 5.77609393749455 | 2.15E-12 | Desmin |
| GRIA2 | 4.73036064253495 | 4.74E-12 | Glutamate ionotropic receptor AMPA type subunit 2 |
| CAPN13 | 5.35977088766126 | 1.37E-10 | Calpain 13 |
| TMC5 | 4.1761744996929 | 3.41E-10 | Transmembrane channel like 5 |
| LTF | 4.09383816510685 | 6.29E-10 | Lactotransferrin |
| CXCL9 | 4.88148392061089 | 8.35E-10 | C-X-C motif chemokine ligand 9 |
| CFB | 3.87428570966326 | 1.73E-09 | Complement factor B |
| HLA-DRB5 | 3.94547877462524 | 1.93E-09 | Major histocompatibility complex, class II, DR beta 5 |
| CHL1 | 4.12848580242201 | 2.38E-09 | Cell adhesion molecule L1 like |
| TFAP2A | 5.88842619477027 | 2.53E-09 | Transcription factor AP-2 alpha |
| SPP1 | 3.82435858149562 | 3.59E-09 | Secreted phosphoprotein 1 |
| COL8A1 | 5.77407427103097 | 4.62E-09 | Collagen type VIII alpha 1 chain |
| S100A9 | 4.45915743773891 | 9.05E-09 | S100 calcium binding protein A9 |
| HS3ST3A1 | 6.08509931162922 | 9.93E-09 | Heparan sulfate-glucosamine 3-sulfotransferase 3A1 |
Top 20 downregulated genes.
| Gene_id | log2FoldChange | pValue | Product |
|---|---|---|---|
| EPHA5 | -7.17216432676385 | 9.64E-16 | EPH receptor A5 |
| MMP26 | -6.12022585097862 | 1.59E-14 | Matrix metallopeptidase 26 |
| PENK | -8.34808303279188 | 8.70E-14 | Proenkephalin |
| NRXN1 | -7.43538544089878 | 4.04E-13 | Neurexin 1 |
| KIAA1210 | -4.85573980734559 | 1.25E-11 | KIAA1210 |
| CACNA1G | -4.67635324042015 | 2.63E-11 | Calcium voltage-gated channel subunit alpha1 G |
| P2RY14 | -4.35141244693077 | 5.57E-10 | Purinergic receptor P2Y14 |
| OGN | -3.97502184228362 | 8.89E-10 | Osteoglycin |
| ROBO3 | -5.28296919609017 | 9.48E-10 | Roundabout guidance receptor 3 |
| ADAMTS16 | -4.19653440305854 | 1.12E-09 | ADAM metallopeptidase with thrombospondin type 1 motif 16 |
| PKD1L2 | -4.37397769545082 | 1.17E-09 | Polycystin 1 like 2 (gene/pseudogene) |
| CCBE1 | -4.02495760723948 | 4.39E-09 | Collagen and calcium binding EGF domains 1 |
| NLGN1 | -4.16419236236428 | 5.62E-09 | Neuroligin 1 |
| VWC2 | -4.89442595363418 | 7.97E-09 | Von Willebrand factor C domain containing 2 |
| PCSK5 | -3.65263455895927 | 1.20E-08 | Proprotein convertase subtilisin/kexin type 5 |
| ECM1 | -3.78147598317963 | 1.83E-08 | Extracellular matrix protein 1 |
| PGBD5 | -4.58749330903002 | 1.91E-08 | PiggyBac transposable element derived 5 |
| MMP16 | -3.50208469660249 | 3.69E-08 | Matrix metallopeptidase 16 |
| OVGP1 | -3.47702587273636 | 4.79E-08 | Oviductal glycoprotein 1 |
| OLFM1 | -3.85033591812851 | 6.95E-08 | Olfactomedin 1 |
FIGURE 2The top 30 GO terms of total between endometrial cancer and normal endometrium.
FIGURE 3The top 30 GO terms of down between endometrial cancer and normal endometrium.
FIGURE 4KEGG pathway analysis of the total top 20 pathways between endometrial cancer and normal endometrium.
FIGURE 5KEGG pathway analysis of the down top 20 pathways between endometrial cancer and normal endometrium.
FIGURE 6Confirmation of the differentially expressed mRNAs between cancer and control endometrium tissue. Validation of the expression of 10 mRNAs by quantitative real-time PCR, showing increased expression of mRNAs (3) and decreased mRNA (7). The real-time PCR data with bars represent a mean ± SD from 3 independent experiments, and the sequencing data with bars represent the 95% CI.
qRT-PCR primer sequences.
| Gene symbol | Forward primer (5–3′) | Reverse primer (5–3′) |
|---|---|---|
| ID1 | CGTGCTGCTCTACGACATGA | CGACACAAGATGCGATCGTCC |
| GDF7 | TGATGTCGCTTTACCGGAGC | TGGACACGTCGAACAGGAAG |
| GDF5 | CACGAGAAAGCCCTGTTCCT | CCAGCCCATGTCCTTGAAGT |
| INHBA | GGAGTGTGATGGCAAGGTCA | ACATGGGTCTCAGCTTGGTG |
| TGF-beta | ATGGTTGTTTCCAGTTTGGTCAC | CAAGGAACTTCACAAGAGCAGTC |
| WNT4 | TCGTCTTCGCCGTCTTCTCAG | GAGTCGAGTGTGGAGCAGTT |
| SMAD9 | AGACATTCCAGGCTTCCTCC | ATAGTTGCAGTTCCGGCTCT |
| WNT5A | TTTGGCAGGGTGATGCAGAT | TTGGCAAAGCGGTAGCCATA |
| ERBB4 | ACAGGCTACGTGTTAGTGGC | GCAACGTCCACATCCTGAAC |
| IGF1 | ATCTCTTCTACCTGGCGCTG | CGCAATACATCTCCAGCCTC |
| Actinb | AATGAGCTGCGTGTGGCTC | ATAGCACAGCCTGGATAGCAAC |
FIGURE 7Immunohistochemical of the target protein such as ERBB4 and TGF-β1 between patients and control.