| Literature DB >> 34912848 |
Zhao-Wei Gao1, Chong Liu1, Lan Yang1, Ting He1, Xia-Nan Wu1, Hui-Zhong Zhang1, Ke Dong1.
Abstract
Background: Secreted protein acidic and rich in cysteine (SPARC) plays an important role in cancer development. The roles of SPARC in the liver hepatocellular carcinoma (LIHC) are unclear.Entities:
Keywords: SPARC; bioinformatics; liver cancer; proliferation; tumor growth
Year: 2021 PMID: 34912848 PMCID: PMC8668270 DOI: 10.3389/fmolb.2021.775743
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
Primer sequences.
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| SPARC | GCAGAGGAAACCGAAGAGGAG | AGTGGCAGGAAGAGTCGAAGG |
| GAPDH | CCACATCGCTCAGACACCAT | GGCAACAATATCCACTTTACCAGAGT |
FIGURE 1SPARC mRNA expression in LIHC tissues and normal controls. (A) Differential SPARC mRNA expression between the LIHC and normal live tissues in the GEPIA2 database. (B) Differential SPARC mRNA expression between the LIHC and normal controls in the UALCAN database. (C–E) Differential SPARC expression between the LIHC tissues and non-tumor tissues in GSE121248, GSE14520, and GSE14323 datasets. (F, G) Boxplot of SPARC expression based on the tumor stage and grade. (H) Boxplot of SPARC promoter methylation level. (I) IHC analysis of LIHC tissue microarray.
FIGURE 2SPARC levels in serum and PBMC from LIHC. (A) Human protein atlas (HPA) database showed the SPARC expression profile in blood. (B, C) Differential SPARC mRNA expression in PBMC between LIHC and normal controls in GSE49515 and GSE58208 datasets. (D) Serum SPARC protein levels in LIHC and healthy controls (HC). (E) SPARC mRNA expression levels in PBMC from our sample in this study.
FIGURE 3Endogenous SPARC overexpression promote liver cancer cells proliferation and tumor growth. (A) qRT-PCR showed the higher SPARC expression level in HepG2 . (B) SPARC overexpression promotes liver cancer cell proliferation. (C) FCM showed the effects of SPARC overexpression on cell cycle. (D) FCM showed the effects of SPARC overexpression on cell apoptosis. (E) SPARC overexpression promotes tumor growth in vivo.
FIGURE 4SPARC-associated genes and pathway enrichment in LIHC. (A) Heatmaps showing top 50 genes positively correlated (left) and top 50 genes negatively correlated with SPARC in LIHC (right). (B) Enriched KEGG pathways of SPARC-associated genes. (C–E) Enriched GO terms of SPARC-associated genes.