Suchittra Samuhasaneeto1, Gorawit Yusakul2. 1. School of Medicine, Walailak University, Nakhon Si Thammarat, 80160, Thailand. 2. School of Pharmacy, Walailak University, Nakhon Si Thammarat, 80160, Thailand.
Abstract
Benjakul, a traditional Thai formulation, has been used as a carminative and adaptogenic drug. It consists of five plants, Piper chaba Hunter, Piper sarmentosum Roxb., Piper interruptum Opiz., Plumbago indica Linn., and Zingiber officinale Roscoe, in equal ratios. Some individual herbs present in Benjakul were reported to modulate cytochrome P450 (CYP) enzymes. This study aimed to investigate the effects of Benjakul extract on the activities and mRNA expression levels of hepatic CYP2C11 and CYP3A1 in rats. Adult male rats were orally administered 200, 400, or 600 mg/kg BW Benjakul extract for 28 days. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatinine levels were assayed. CYP2C11 and CYP3A1 activities were analyzed using cytochrome P450 assay kits. The mRNA expression of CYP2C11 and CYP3A1 was measured using a quantitative real-time PCR assay. Benjakul treatment significantly increased the serum ALT and BUN levels. At doses of 200, 400, and 600 mg/kg BW, Benjakul treatment increased hepatic CYP3A1 activity and CYP3A1 mRNA expression. CYP2C11 mRNA expression was unchanged by treatment with Benjakul extract; however, treatment with the high and middle doses of Benjakul extract increased CYP2C11 activity. Treament with Benjakul extract induced CYP2C11 and CYP3A1 activity in rats. Concurrent use of Benjakul with conventional drugs should be considered to potentially induce herb-drug interactions.
Benjakul, a traditional Thai formulation, has been used as a carminative and adaptogenic drug. It consists of five plants, Piper chaba Hunter, Piper sarmentosum Roxb., Piper interruptum Opiz., Plumbago indica Linn., and Zingiber officinale Roscoe, in equal ratios. Some individual herbs present in Benjakul were reported to modulate cytochrome P450 (CYP) enzymes. This study aimed to investigate the effects of Benjakul extract on the activities and mRNA expression levels of hepatic CYP2C11 and CYP3A1 in rats. Adult male rats were orally administered 200, 400, or 600 mg/kg BW Benjakul extract for 28 days. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatinine levels were assayed. CYP2C11 and CYP3A1 activities were analyzed using cytochrome P450 assay kits. The mRNA expression of CYP2C11 and CYP3A1 was measured using a quantitative real-time PCR assay. Benjakul treatment significantly increased the serum ALT and BUN levels. At doses of 200, 400, and 600 mg/kg BW, Benjakul treatment increased hepatic CYP3A1 activity and CYP3A1 mRNA expression. CYP2C11 mRNA expression was unchanged by treatment with Benjakul extract; however, treatment with the high and middle doses of Benjakul extract increased CYP2C11 activity. Treament with Benjakul extract induced CYP2C11 and CYP3A1 activity in rats. Concurrent use of Benjakul with conventional drugs should be considered to potentially induce herb-drug interactions.
The use of herbal medicines as complimentary or alternative medicines has become increasingly common in many countries worldwide due to scientific support for their therapeutic effectiveness and fewer harmful side effects than conventional therapies [1]. The increasing use of herbal medicine with prescription medicine has raised concerns about herb-drug interactions [2, 3, 4]. Cytochrome P450 (CYP) enzymes are members of a superfamily of hemoproteins and are widely located on the endoplasmic reticulum in liver cells [5]. They play a key role in the oxidative metabolism (phase I) of clinical drugs, other xenobiotics and endogenous substances. More than 50 CYP enzymes have been identified in humans. In the human liver, the most important CYPs for drug metabolism are members of the CYP2C and CYP3A subfamilies [6]. CYP2C9 and CYP3A4 play dominant roles in the metabolism of drugs and other xenobiotics [6]. The combination of herbal medicines with conventional drugs may affect drug metabolism because herbal medicines have the potential to induce or inhibit CYP enzymes [7].Benjakul is a traditional Thai formulation that consists of equal amounts of five plants: the fruits of Piper chaba Hunter, the roots of Piper sarmentosum Roxb., the stems of Piper interruptum Opiz., the roots of Plumbago indica Linn. and the rhizomes of Zingiber officinale Roscoe. Benjakul is indicated as an herbal medicine and a carminative and adaptogenic drug in the Thailand National List of Essential Medicines [8]. In Southern Thai folk medicine, Benjakul is used prior to chemotherapy to balance patients’ symptoms. Phytochemical analysis of the Benjakul extract revealed various chemical compounds, such as myristicin, plumbagin, methyl piperate, 6-shogaol, 6-gingerol and piperine [9]. Pharmacological studies have shown that Benjakul and its isolated compounds possess a wide range of pharmacological activities, including anticancer, cytotoxic, anti-inflammatory, antiallergic and antidiabetic activities [9, 10, 11, 12, 13]. Recently, the Benjakul extract showed clinical efficacy and safety in relieving symptoms in the knees of patients with primary osteoarthritis [14]. Currently, limited data are available on the interaction of Benjakul with CYP enzymes. Only the active ingredients of individual plants have been reported to modulate CYP. In vitro microsomal incubation experiments revealed that piperine inhibits CYP3A4, CYP2C9 and CYP1A2 [15]. 6-Gingerol, an active ingredient of Z. officinale, potently inhibits CYP2C9 activity and moderately inhibits CYP2C19 and CYP3A4 activity [16]. Therefore, assessments of the ability of Benjakul to inhibit or induce CYP2C9 and CYP3A4 activities are important. Rat CYP2C11 and CYP3A1 are homologous to human CYP2C9 and CYP3A4 [17]. Therefore, the results obtained in rats may have clinical applications. The purpose of this study was to investigate the effects of Benjakul extract on the activities and mRNA expression levels of hepatic CYP2C11 and CYP3A1 in a rat model.
Materials and methods
Chemicals
Benjakul power was purchased from V.P. Pharmacy Ltd. (Bangkok, Thailand). 6-Gingerol was acquired from Glentham Life Sciences Ltd. (Corsham, UK). Piperine was obtained from Acros Organics (Belgium). Microsome isolation kits and CYP3A4 activity assay kits were purchased from Abcam (MA, USA). A CYP2C9 activity assay kit was purchased from Biovision (CA, USA). GENEzol™ reagent was acquired from Geneaid Biotech Ltd. (Taiwan). An iScript cDNA synthesis kit was obtained from Bio-Rad (CA, USA). The 5X HOT FIREPol® EvaGreen® qPCR Mix Plus (ROX) was purchased from Solis BioDyne (Estonia).
Preparation of the Benjakul extract
Two kilograms of Benjakul powder were macerated three times for three days each with 20 L of 95% ethanol at room temperature. The extract was filtered through No. 1 Whatman filter paper and then concentrated with a vacuum rotary evaporator to remove the ethanol. The extract yield was 5.9% of the Benjakul dry power. The ethanolic extract of the Benjakul formulation was stored at -20 °C until use in experiments.
High-performance liquid chromatography (HPLC) analysis of Benjakul extract
The Benjakul chemical fingerprint was obtained using a Thermo Scientific Dionex Ultimate 3000 HPLC system (Thermo Scientific, MA, USA). The instrument was composed of a tertiary pump (LPG-4300SD), an autosampler (WPS-3000SL), a column compartment (TCC-3000SL), and a variable wavelength detector (VWD-3100). Ten milligrams of Benjakul extract were dissolved in 1 mL of methanol and filtered through a 0.22 μm membrane filter before injection. The chemicals in the Benjakul extract were separated on a reverse-phase analytical column (VertiSep™ USP C18 HPLC column, 4.6 × 250 mm, 5 μm particle size; Vertical Chromatography Co., Ltd., Nonthaburi, Thailand). The mobile phases consisted of acetonitrile (solvent A) and 1% (v/v) acetic acid solution (solvent B). The gradient flow was 0 min, 20% (v/v) solvent A in solvent B. Then, the proportion of solvents was increased to 75% over 37.5 min. When the target compounds were eluted, the mobile phase was re-equilibrated with the initial condition (20%, v/v solvent A). The flow rate and injection volume were set to 1.0 mL/min and 10 μL, respectively. Detection was performed at UV-Vis wavelengths of 282 nm for 6-gingerol and 341 nm for piperine. Two markers of Benjakul extract were identified by comparing the retention time with each of the standards. The absorbance spectrum profile was used to confirm the peak.The sensitivity of the HPLC analysis was expressed as the limit of detection (LOD) and limit of quantification (LOQ). The precision of the analysis was determined by performing triplicate injections of concentrations of the standard solution. Then, the accuracy of the method was investigated by conducting recovery experiments. The standard was spiked into the Benjakul extract at a final concentration of 20–100 μg/mL. The total concentration of both compounds was determined, and the recovery was calculated using the following Eq. (1):The total concentrations of the compounds in spiked (SS) and nonspiked samples (NS) were analyzed. The recovery indicates the closeness of the determined concentration to the theoretical spiked concentration (TC).
Animals
Adult male Wistar rats weighing 170–200 g were purchased from Nomura Siam International Co., Ltd. (Bangkok, Thailand). The rats were housed in a room with controlled temperature (23 ± 1 °C) and humidity (50–70%) on a 12-hour light/dark cycle, and the rats were fed a rodent chow diet and provided water ad libitum. The rats were acclimated for 1 week before use in an experiment, and the experimental protocol was approved by the Animal Ethics Committee of Walailak University.
Experimental design
Benjakul extract was dissolved in a mixed solution composed of 7% Tween 80 and 3% ethanol. The doses of Benjakul extract used in this experiment were based on the doses used in humans, as described in the Thailand National List of Essential Medicines [8]. Benjakul is administered in doses of 800–1,000 mg three times a day (2,400–3,000 mg/day or 40–50 mg/kg BW/day). In the present study, the dose of 200 mg/kg BW was calculated to be the human equivalent dose of 32 mg/kg BW or approximately 1,920 mg/60 kg BW [18]. Then, the dose was doubled to calculate the other doses (400 and 600 mg/kg BW). The rats were randomly divided into four groups of six each. The treated groups were orally administered Benjakul extract daily at doses of 200, 400, or 600 mg/kg BW for 28 days. The control group was administered a daily oral dose (1 mL) of a mixed solution composed of 7% Tween 80 and 3% ethanol for 28 days. At the end of the experiment, the rats were anesthetized using Zoletil™ (25 mg/kg BW), and blood samples were collected from the heart by cardiac puncture for biochemical studies. The livers were removed immediately and rinsed with ice-cold 0.9% NaCl. The liver samples were stored at 80 °C until use in hepatic CYP2C11 and CYP3A1 analyses.
Analysis of serum biochemical parameters
Blood samples were centrifuged at 2,000 × g for 15 min, and sera were collected to test liver and kidney function. The serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatinine levels were measured using kinetic methods. All measurements were performed using an ABX Pentra 400 automated biochemistry analyzer (Horiba Medical, France).
CYP2C11 and CYP3A1 activity assays
Preparation of rat liver microsomes
Liver microsomes were isolated using a microsome isolation kit (Abcam, MA, USA). Briefly, 500 mg of liver were homogenized with 1 mL of cold homogenization buffer containing 2 μL/mL protease inhibitors and centrifuged at 10,000 × g for 15 min. The supernatant was collected and centrifuged at 100,000 × g for 20 min at 4 °C. The resulting microsomal pellet was washed gently with homogenization buffer, and the excess buffer was discarded. Then, the microsomal pellet was resuspended in ice-cold storage buffer (250 μL). The protein concentration was determined using the Lowry method [19]. The suspended microsomes were aliquoted and stored at -80 °C for future use.
Analysis of CYP2C11 and CYP3A1 activities
The activities of CYP2C11 and CYP3A1 were measured using cytochrome P450 assay kits (Biovision, CA, USA and Abcam, MA, USA for CYP2C11 and CYP3A1, respectively). The assays were performed in black 96-well microplates. Each experiment was performed in duplicate. Twenty micrograms of microsomal protein were mixed with 2 μL of the NADPH-generating system, and the volume was adjusted to 50 μL/reaction with assay buffer. Twenty microliters of assay buffer and inhibitor were added to the samples and inhibition controls for each sample, respectively. After an incubation at 37 οC (30 and 15 min for CYP2C11 and CYP3A1, respectively), the enzymatic reaction was initiated by adding a mixture of β-NADP+ and the substrate. Then, the fluorescence of the samples was immediately measured (CYP2C11; Ex/Em = 415/502 nm, CYP3A1; Ex/Em = 535/587 nm) in kinetic mode for 30 min at 37 °C. 7-HFC and resorufin were used as the standards for the calibration curves of CYP2C11 and CYP3A1, respectively. The activities of CYP2C11 and CYP3A1 in the sample were calculated from Eq. (2):where:B = the amount of substrate metabolized to 7-HFC (resorufin) by CYP2C11 (CYP3A1) in a sample well based on the standard (pmol);ΔT = linear phase reaction time T2 – T1 (min); andP = amount of protein in the well (mg).
Measurement of CYP2C11 and CYP3A1 mRNA expression
Total RNA isolation and cDNA synthesis
Total RNA was extracted from liver tissues using GENEzol™ reagent (Geneaid Biotech Ltd, Taiwan) according to the manufacturer's instructions. The RNA pellet was dissolved in RNase-free water, and the total RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). One microgram of total RNA was converted to cDNAs using an iScript cDNA synthesis kit (Bio-Rad, CA, USA). The cDNA templates were used for quantitative real-time PCR (qRT-PCR).
qRT-PCR was performed in triplicate using the StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). The sequences of the forward and reverse primers used in this experiment are shown in Table 1. Reactions were performed in a final volume of 20 μL that contained 10 ng of cDNAs, 5X HOT FIREPol® EvaGreen® qPCR Mix Plus (ROX) (Solis BioDyne, Estonia), 250 nM forward primer, 250 nM reverse primer and PCR-grade H2O. The qRT-PCR conditions were as follows: initial denaturation at 95 °C for 12 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 56 °C for 20 s, and extension at 72 °C for 20 s β-Actin was used as the endogenous control to normalize the target gene expression levels. The data were analyzed using the 2−ΔΔCt method.
Table 1
Primer sequences used to analyze CYP2C11 and CYP3A1 mRNA expression [20].
Gene
Primer sequence (5′3′)
CYP2C11
Forward: AAAAGCACAATCCGCAGTCT
Reverse: GCATCTGGCTCCTGTCTTTC
CYP3A1
Forward: TCTGTGCAGAAGCATCGAGTG
Reverse: TGGGAGGTGCCTTATTGGG
β-Actin
Forward: GACCTCTATGCCAACACAGT
Reverse: GGTGTAAAACGCAGCTCAGTA
Primer sequences used to analyze CYP2C11 and CYP3A1 mRNA expression [20].
Statistical analysis
The results are reported as the means ± standard deviations (SD). Differences between the control and treated groups were assessed using one-way analysis of variance (ANOVA) followed by Tukey's post hoc test. Kruskal-Wallis tests were conducted if the data had a nonnormal distribution or homogeneity of variance. P values <0.05 were considered statistically significant for all data.
Results
Quantification of the two marker compounds in Benjakul extract
The chromatograms of the 6-gingerol (1) and piperine (2) standards are shown in Figure 1, and the retention times were 26.161 and 28.899 min, respectively (Figure 1A,B). The peaks of 6-gingerol (1) and piperine (2) in the Benjakul extract were identified (1C and 1D). The LOD, LOQ, linearity range of the calibration curve, precision, and analytical method accuracy are shown in Table 2.
Figure 1
Chromatograms of the standards (25 μg/mL) of 6-gingerol (1), and piperine (2), which were detected at 282 nm (A) and 341 nm (B), respectively. Both compounds were identified in the sample solution of Benjakul extract (10 mg/mL), in which 6-gingerol (1) and piperine (2) were detected at 282 nm (C) and 341 nm (D), respectively.
Table 2
The analytical performance of HPLC for 6-gingerol (1) and piperine (2) determinations.
Analytical parameters
Analyte
6-gingerol (1)
piperine (2)
Limitation of detection (LOD)
0.204 μg/mL
0.916 μg/mL
Limitation of quantification (LOQ)
0.618 μg/mL
2.775 μg/mL
Linearity range of calibration curve (R2)
1.56–100 μg/mL (R2 = 0.9997)
3.13–100 μg/mL (R2 = 0.9993)
Precision (% CV)
0.13–0.92%
0.12–4.40%
Accuracy (% recovery)
97.5–109%
98.7–104%
Chromatograms of the standards (25 μg/mL) of 6-gingerol (1), and piperine (2), which were detected at 282 nm (A) and 341 nm (B), respectively. Both compounds were identified in the sample solution of Benjakul extract (10 mg/mL), in which 6-gingerol (1) and piperine (2) were detected at 282 nm (C) and 341 nm (D), respectively.The analytical performance of HPLC for 6-gingerol (1) and piperine (2) determinations.The analytical performance indicated the reliable character of HPLC for this analysis. The analysis revealed that 3.50 ± 0.03 μg/mg 6-gingerol and 88.7 ± 0.48 μg/mg piperine were present in the Benjakul extract.
Effect of Benjakul extract on serum biochemical parameters
After feeding Benjakul extract to the rats for 28 days, the Benjakul-treated groups (400 and 600 mg/kg BW) exhibited increased serum ALT levels (P < 0.05) compared to the control group. The serum BUN levels were significantly increased in the Benjakul-treated groups (200, 400 and 600 mg/kg BW) compared with the control group (P < 0.05). No significant differences in AST and creatinine levels were observed among the experimental groups (Table 3).
Table 3
Effect of Benjakul extract on serum biochemical parameters.
Group
ALT (U/L)
AST (U/L)
BUN (mg/dL)
Creatinine (mg/dL)
Control
20.67 ± 2.42
83.00 ± 5.62
14.17 ± 1.17
0.30 ± 0
BJK 200
20.33 ± 2.16
78.83 ± 6.31
19.00 ± 2.10∗
0.27 ± 0.05
BJK 400
24.83 ± 2.14∗
73.00 ± 7.56
19.17 ± 1.72∗
0.30 ± 0
BJK 600
31.33 ± 8.94∗
76.00 ± 10.18
19.83 ± 2.86∗
0.30 ± 0
Values are presented as the means ± SD (n = 6). ∗P < 0.05 compared with the control group. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Effect of Benjakul extract on serum biochemical parameters.Values are presented as the means ± SD (n = 6). ∗P < 0.05 compared with the control group. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Effect of Benjakul extract on CYP2C11 and CYP3A1 activities
The effects of Benjakul extract on CYP2C11 and CYP3A1 activities are shown in Figure 2. Compared with the control condition, treatment with 400 and 600 mg/kg BW Benjakul increased rat hepatic CYP2C11 activity (P < 0.05) (Figure 2A). No significant change in CYP2C11 activity was detected after low-dose Benjakul treatment. Additionally, compared with the control condition, the administration of Benjakul extract (200, 400 and 600 mg/kg BW) increased CYP3A1 activity (P < 0.05) (Figure 2B).
Figure 2
Effect of Benjakul extract on CYP2C11 activity (A) and CYP3A1 activity (B). Values are reported as the means ± SD (n = 6). ∗P < 0.05 compared with the control group. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Effect of Benjakul extract on CYP2C11 activity (A) and CYP3A1 activity (B). Values are reported as the means ± SD (n = 6). ∗P < 0.05 compared with the control group. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Effect of Benjakul extract on CYP2C11 and CYP3A1 mRNA expression
The CYP2C11 and CYP3A1 mRNA expression levels in the liver determined using qRT-PCR are shown in Figure 3. Compared with the control condition, Benjakul treatments (200, 400 and 600 mg/kg BW) significantly (P < 0.05) upregulated CYP3A1 mRNA expression (Figure 3A). However, the hepatic CYP2C11 mRNA expression levels in the Benjakul treatment groups were not different from that of the control group (P < 0.05) (Figure 3B).
Figure 3
Relative CYP3A1 (A) and CYP2C11 (B) mRNA expression levels in different experimental groups of rats (n = 4). The mRNA levels of CYP3A1 and CYP2C11 were normalized to the β-actin level. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Relative CYP3A1 (A) and CYP2C11 (B) mRNA expression levels in different experimental groups of rats (n = 4). The mRNA levels of CYP3A1 and CYP2C11 were normalized to the β-actin level. BJK 200, 200 mg/kg BW Benjakul; BJK 400, 400 mg/kg BW Benjakul; BJK 600, 600 mg/kg BW Benjakul.
Discussion
In the present study, the administration of Benjakul extract increased CYP2C11 and CYP3A1 activities and upregulated CYP3A1 mRNA expression in the rat liver. Benjakul treatment for 28 days might lead to liver and kidney injury. In addition, piperine and 6-gingerol were identified in the Benjakul extract. The piperine content in the Benjakul extract was similar to that reported in a previous study [9]. However, we detected a low 6-gingerol content in the Benjakul extract. The difference in the 6-gingerol content in this report might be due to differences in plant cultivation, harvesting period and extraction procedure.Concurrent use of herbal plants and conventional drugs results in potential herb-drug interactions. The most common mechanisms of herb-drug interactions involve pharmacokinetic interference, namely, the induction or inhibition of CYP enzymes [7]. The induction of CYP enzymes increases drug clearance, resulting in a decreased therapeutic effect, while inhibition leads to a decrease in drug excretion and then increases the drug plasma concentration, potentially leading to toxicity.The CYP3A subfamily comprises more than 40% of all CYP enzymes in humans [7]. CYP3A4 is most abundantly expressed isoform in the liver and participates in the metabolism of 50% of clinical drugs, such as macrolide antibiotics, midazolam, immune system modulators, and calcium channel blockers. Regarding the metabolism of endogenous substances, CYP3A4 metabolizes testosterone, progesterone, and androstenedione [5]. Human CYP3A4 is homologous to rat CYP3A1 [17]. Thus, rodent models are commonly used to predict human CYP3A4 activity in vivo. No report has assessed the effect of Benjakul extract on CYP3A4. Some individual herbs present in Benjakul formulations or active ingredients were shown to inhibit CYP3A4. For example, P. indica and one of its active compounds (plumbagin) suppress the mRNA and protein expression of CYP3A11 in mice [21]. P. chaba and P. indica potently inhibit CYP3A4 activity in human liver microsomes [22]. In addition, piperine, an active compound of P. chaba, inhibits recombinant human CYP3A4 [15]. In HepG2 cells, 6-gingerol, an active ingredient of Z. officinale, moderately inhibits CYP3A4 [16]. In the present study, mRNA levels and enzyme activities were measured to evaluate both enzyme inhibition and induction during Benjakul treatment. The Benjakul extract treatment significantly increased CYP3A1 activity and CYP3A1 mRNA expression in rats. The Benjakul formulation is composed of five herbal plants that contain several bioactive compounds. The formulation induced CYP3A1 expression and activity. CYP3A4 expression is regulated by ligand-activated nuclear receptors such as pregnane nuclear receptor (PXR) and constitutive androstane receptor (CAR) [23]. Piperine activates human PXR to induce CYP3A4 expression in human hepatocytes. In another study, piperine increased PXR activity in human hepatoma cells [24]. In the present study, piperine was identified as a major compound in Benjakul extract. Therefore, the mechanism by which Benjakul extract mediates the upregulation of CYP3A1 expression and activity may involve the activation of PXR. Recently, Benjakul has been used to treat patients with allergic rhinitis and lung cancer [25, 26]. Herb-drug interactions may occur if Benjakul extract is combined with drugs metabolized by CYP3A4. For example, if it is used in combination with loratadine or paclitaxel, it may decrease drug plasma concentrations to subtherapeutic levels, leading to therapeutic failure.CYP2C9 is a member of the CYP2C subfamily that is expressed at high levels in the human liver [27]. It metabolizes approximately 15% of all drugs, such as the anticoagulant warfarin, the antidiabetic agent tolbutamide, nonsteroidal anti-inflammatory drugs, angiotensin II blockers and antiepileptics [27]. Rat CYP2C11 is functionally similar to human CYP2C9. In the present study, the CYP2C11 mRNA expression level was not significantly modified by Benjakul extract, but Benjakul extract did increase CYP2C11 activity at doses of 400 and 600 mg/kg BW. Some studies reported that gene expression levels are not correlated with CYP activities [28, 29]. Moreover, increased CYP2C9 activity might be regulated at the posttranscriptional level. Thus, further investigations of the mechanism underlying this effect are necessary. Our results reveal that Benjakul extract increases CYP2C11 activity. Therefore, coadministration of Benjakul extract with drugs metabolized by CYP2C9, i.e., warfarin, tolbutamide, diclofenac and phenytoin, may increase the elimination of these drugs and decrease the therapeutic effect. For instance, concomitant use of Benjakul extract and warfarin may decrease plasma concentrations and reduce the clinical effects of warfarin.In addition to investigating the safety of Benjakul treatment in rats, serum biochemical markers of liver and kidney damage were determined. The doses of Benjakul extract administered to the animals were based on the Benjakul doses used in humans [8]. A Benjakul dose of 200 mg/kg BW can be converted into the human equivalent dose of 32 mg/kg BW or approximately 1,920 mg/60 kg BW [18]. Benjakul extract doses ranging from 300 to 1,200 mg/kg were used in animal studies [11, 13]. High-dose and moderate-dose Benjakul extract treatments increased serum ALT levels, indicating hepatocellular damage. Likewise, BUN levels were increased in Benjakul-treated rats, which indicates kidney injury. These findings differ from those of a previous toxicity test. The administration of Benjakul extract for 6 months had no effect on the tested animals or their blood chemistry [30]. The doses administered in our study (400 and 600 mg/kg BW) may be sufficiently high to induce hepatotoxicity and nephrotoxicity in rats. Therefore, the use of high doses and long-term treatment with Benjakul should be avoided.Our study has a few limitations. First, as species-specific differences exist for drug-metabolizing enzymes, our results may not accurately reflect the potential to induce CYP activity in humans. In addition, an initial Benjakul extract dose of 200 mg/kg BW induced CYP activity in rats. We were unable to clearly determine whether doses lower than 200 mg/kg will affect CYPs in rats. Thus, studies using a range of doses in animal models should be performed. Last, several substances are present in Benjakul extract; however, information about active substances involved in CYP induction is limited. Further studies of Benjakul extract should focus on the substances in Benjakul extract involved in CYP induction and PXR activation. Furthermore, human studies are needed to confirm the interactions of Benjakul extract with CYP isoforms in humans.In conclusion, the data in this study indicate that Benjakul extract activates CYP2C11 and CYP3A1 in rats. Coadministration of Benjakul with conventional drugs should be considered to potentially induce herb-drug interactions.
Declarations
Author contribution statement
Suchittra Samuhasaneeto: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Gorawit Yusakul: Analyzed and interpreted the data; Wrote the paper.
Funding statement
This work was supported by a grant from , grant number WU-IRG-63-051.
Data availability statement
Data will be made available on request.
Declaration of interests statement
The authors declare no conflict of interest.
Additional information
No additional information is available for this paper.