| Literature DB >> 34901152 |
Giulia Matusali1, Flavia Trionfetti2,3, Veronica Bordoni4, Roberta Nardacci5,6, Laura Falasca5, Daniele Colombo5, Michela Terri2,3, Claudia Montaldo3, Concetta Castilletti1, Davide Mariotti4, Franca Del Nonno5, Maria Rosaria Capobianchi1, Chiara Agrati4, Marco Tripodi2,3, Raffaele Strippoli2,3.
Abstract
Although lung fibrosis has a major impact in COVID-19 disease, its pathogenesis is incompletely understood. In particular, no direct evidence of pleura implication in COVID-19-related fibrotic damage has been reported so far. In this study, the expression of epithelial cytokeratins and Wilms tumor 1 (WT1), specific markers of mesothelial cells (MCs), was analyzed in COVID-19 and unrelated pleura autoptic samples. SARS-CoV-2 replication was analyzed by RT-PCR and confocal microscopy in MeT5A, a pleura MC line. SARS-CoV-2 receptors were analyzed by RT-PCR and western blot. Inflammatory cytokines from the supernatants of SARS-CoV-2-infected MeT5A cells were analysed by Luminex and ELLA assays. Immunohistochemistry of COVID-19 pleura patients highlighted disruption of pleura monolayer and fibrosis of the sub-mesothelial stroma, with the presence of MCs with fibroblastoid morphology in the sub-mesothelial stroma, but no evidence of direct infection in vivo. Interestingly, we found evidence of ACE2 expression in MCs from pleura of COVID-19 patients. In vitro analysis shown that MeT5A cells expressed ACE2, TMPRSS2, ADAM17 and NRP1, plasma membrane receptors implicated in SARS-CoV-2 cell entry and infectivity. Moreover, MeT5A cells sustained SARS-CoV-2 replication and productive infection. Infected MeT5A cells produced interferons, inflammatory cytokines and metalloproteases. Overall, our data highlight the potential role of pleura MCs as promoters of the fibrotic reaction and regulators of the immune response upon SARS-CoV-2 infection.Entities:
Keywords: SARS-CoV-2; WT1; inflammatory cytokines; mesothelial cells; mesothelial to mesenchymal transition; pulmonary fibrosis
Year: 2021 PMID: 34901152 PMCID: PMC8662383 DOI: 10.3389/fmolb.2021.752616
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
List of RT-PCR primers used in this study.
| Gene | Forward sequence | Reverse sequence |
|---|---|---|
| hACE2 | GGGATCAGAGATCGGAAGAAGAAA | AGGAGGTCTGAACATCATCAGTG |
| hADAM17 | GGGCAGAGGGGAAGAGAGTA | GACTTGAGAATGCGAATCTGCT |
| hIFNα | TGGTGCTCAGCTACAAATCC | CCCATTTGTGCCAGGAGTAT |
| hIFNβ | TGGGAGGCTTGAATACTGCCTCAA | TCTCATAGATGGTCAATGCGGCGT |
| hL34 | GTCCCGAACCCCTGGTAATAGA | GGCCCTGCTGACATGTTTCTT |
| hNRP1 | AAGGTTTCTCAGCAAACTACAGTG | GGGAAGAAGCTGTGATCTGGTC |
| hTMPRSS2 | AATCGGTGTGTTCGCCTCTAC | CGTAGTTCTCGTTCCAGTCGT |
Demographic and clinical features of COVID-19 patients.
| Patient number | Gender | Age | Comorbidities | Causes of death |
|---|---|---|---|---|
| 1 | M | 81 | Hypertension cardiomyopathy Aortic aneurysm | Myocardial infarction. Diffuse alveolar damage (ARDS). Interstitial pneumonia |
| 2 | M | 54 | None | Interstitial pneumonia. Myocarditis |
| 3 | M | 82 | Not known | Interstitial pneumonia. Cardiorespiratory failure |
| 4 | M | 74 | Hypertension. Knee arthroplasty | Interstitial pneumonia. Cardiorespiratory failure |
Demographic and clinical features of non-COVID-19 patients.
| Patient number | Gender | Age | Comorbidities | Causes of death |
|---|---|---|---|---|
| 1 | M | 58 | Hemicolectomy | H1N1 Pneumonia |
| 2 | M | 43 | Alcoholic cirrhosis | Interstitial pneumonia and pulmonary fibrosis |
| 3 | M | 47 | None | Cardiorespiratory failure |
| 4 | F | 47 | Surgery for frontotemporal meningioma and kidney cancer | Myocarditis and Interstitial pneumonia |
FIGURE 1(A) Masson’s trichrome staining in tissue from non COVID-19 patients; (B) Masson’s trichrome staining highlights the presence of collagen fibers (blue stain) in thickened submesothelial layer of visceral pleura from COVID-19 patients. (C) Visceral pleura from non COVID-19 patients show absence of staining (arrow) for WT1, a marker of reactive mesothelial cells. (D) Keratin AE1/AE3 staining, marker of mesothelial cells, shows a continuous monolayer of MCs in non COVID-19 patients. (E,F) Immunohistochemical labeling of WT1 shows positive submesothelial spindle cells in pleura from COVID-19 patients (E, arrow), and Keratin AE1/AE3 staining, performed on a consecutive section, show that the same cells (F, arrows) express both markers. Scale bars = 30 µm.
FIGURE 2(A) Left: Quantification of SARS-CoV-2 viral RNA expression in culture supernatants of MeT5A cells at 1.5, 24 and 72 h post viral inoculum (M.O.I. of 1). Six independent experiments were performed. Middle: Quantification of SARS-CoV-2 viral RNA expression in total RNA of MeT5A cultured as above. Five independent experiments were performed. Right: A TCID50 (Median Tissue Culture Infectious Dose) assay was performed adding serial dilutions of MeT5A cell culture supernatants to sub-confluent VeroE6 cells seeded in 96-well plates. Six independent experiments were performed. P was calculated with respect to time 0 of infection. Differences were considered significant at p < 0.05. (B) Immunofluorescence of MeT5A cells exposed for 120 h to SARS-CoV-2 (M.O.I. of 1) compared with non-infected (NI) cells. Fixed cells were stained with antibodies against SARS-CoV Nucleocapsid and dsRNA. Nuclei were stained with DRAQ5. A minimum of 150 cells per sample from two independent experiments were analyzed. Scale bar: 50 μm.
FIGURE 3(A) Quantitative RT-PCR expression analysis of ACE2, TMPRSS2, NRP1 and ADAM17 from total RNA of MeT5A cells exposed to SARS-CoV-2 infection (MOI = 1) for 24 or 72 h compared with non-infected (NI) cells. L34 mRNA levels were used for normalization. Bars represent the mean ± SEM of triplicate determinations in at least four independent experiments. P was calculated with respect to NI samples. Differences were considered significant at p < 0.05. (B) Western blot showing the expression of ACE2, TMPRSS2 and ADAM17, SARS-CoV-2 plasma membrane receptors, from total lysates of MeT5A cells treated as in A. I: SARS-CoV-2 infected cells. GAPDH was detected as a loading control. (C) Labeling with a specific antibody provides evidence of ACE2 expression (arrows) in MCs from visceral pleura of COVID-19 patients. Scale bar: 30 μm. (D) Quantitative RT-PCR expression analysis of IFNα and IFNβ in MeT5A cells exposed to SARS-CoV-2 for 1.5, 24 or 72 h (M.O.I. of 1) compared with NI cells. Quantitative RT-PCR was performed on total RNA. L34 mRNA levels were used for normalization. Bars represent the mean ± SEM of triplicate determinations in at least four independent experiments. P was calculated with respect to NI samples. Differences were considered significant at p < 0.05.
FIGURE 4Analysis of cytokine secretion from supernatants of MeT5A cells infected with SARS-CoV-2 or left uninfected for 72 h (M.O.I. of 1). SARS-CoV-2 infection promoted the production of IFN-related cytokines (A); TNFα-soluble receptors (B, left); anti-inflammatory cytokines (B, right); pro-inflammatory cytokines (C, left); immune modulators (C, right); mediators of ECM-bone remodeling (D). P was calculated with respect to NI samples. Differences were considered significant at p < 0.05.
FIGURE 5SARS-CoV-2, in combination with other local signals released by the stroma/immune cells, may promote a transient MC infection followed by cell death as well as by induction of MMT. Moreover, infected MCs secrete a number of extracellular mediators active in inflammation, fibrosis immunomodulation.