| Literature DB >> 34899857 |
Esther K Elliott1,2, Lloyd N Hopkins1, Robert Hensen2, Heidi G Sutherland1, Larisa M Haupt1, Lyn R Griffiths1.
Abstract
MicroRNAs (miRNAs) are well known for their ability to regulate the expression of specific target genes through degradation or inhibition of translation of the target mRNA. In various cancers, miRNAs regulate gene expression by altering the epigenetic status of candidate genes that are implicated in various difficult to treat haematological malignancies such as non-Hodgkin lymphoma by acting as either oncogenes or tumour suppressor genes. Cellular and circulating miRNA biomarkers could also be directly utilised as disease markers for diagnosis and monitoring of non-Hodgkin lymphoma (NHL); however, the role of DNA methylation in miRNA expression regulation in NHL requires further scientific inquiry. In this study, we investigated the methylation levels of CpGs in CpG islands spanning the promoter regions of the miR-17-92 cluster host gene and the TET2 gene and correlated them with the expression levels of TET2 mRNA and miR-92a-3p and miR-92a-5p mature miRNAs in NHL cell lines, tumour samples, and the whole blood gDNA of an NHL case control cohort. Increased expression of both miR-92a-3p and miR-92a-5p and aberrant expression of TET2 was observed in NHL cell lines and tumour tissues, as well as disparate levels of dysfunctional promoter CGI methylation. Both miR-92a and TET2 may play a concerted role in NHL malignancy and disease pathogenesis.Entities:
Keywords: Burkitt lymphoma; DNA methylation; diffuse large B-cell lymphoma; epigenetic regulation; mantle cell lymphoma; miR-17∼92; micro-RNA (miRNA/miR)
Year: 2021 PMID: 34899857 PMCID: PMC8661906 DOI: 10.3389/fgene.2021.768913
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
GLP NHL case cohort with subtypes and number of cases for each subtype listed.
| NHL Subtype | Number of cases |
|---|---|
| FL | 23 |
| DLBCL | 14 |
| Chronic lymphocytic leukemia (CLL) | 5 |
| Lymphoblastic lymphoma (LBL) | 5 |
| MCL | 3 |
| Mucosa-associated lymphoid tumour (MALT) | 2 |
| BL | 2 |
| Other B-Cell Lymphoma | 26 |
| Total | 80 |
Pathology of NHL tumour samples, including immunohistochemistry and comments from pathologist.
| GLP ID | Diagnosis | Gender | Age | Anatomy | Immunohistochemistry | Pathologist comments |
|---|---|---|---|---|---|---|
| DLBCL03 | DLBCL | M | 71 | Bowel | CD45+, CD20+, CD30+, CD15− | Multilobulated Reed-Sternberg like cells, extension into perinodal soft tissue |
| DLBCL04 | DLBCL | F | 57 | Groin | CD10+, CD20+, CD5−, CD3+, BCL-2+, BCL-6+, Ki-67+, CD1+, CD30− | Consistent with transformed lymphoma |
| DLBCL05 | FL; DLBCL | F | 52 | Bowel | CD20+, BCL2+, CD10+, BCL6+, Ki67+ | Not tested |
| DLBCL06 | DLBCL | F | 68 | Axillary | CD20+, BCL6+, BCL2+, MUM1+, CD3−, CD10−, CD138- | Non-GCB origin |
| DLBCL09 | DLBCL | F | 50 | Submandibular | CD20+, BCL2+, CD10−, CD3−, Kappa, Ki67+ | t(6:22) |
| DLBCL10 | DLBCL | M | 87 | Supraclavicular | CD20+, CD30+, Ki67+, BLC2 +, BCL1-, CD3−, CD5−, CD10−, CD23− | Negative for cytogenetics |
| FL01 | FL | M | 60 | Testis | CD20+, CD3+ T-cells, BCL2- | Not tested |
| FL03 | FL | M | 62 | Groin | CD20+, CD19+ and FMC7, CD10, CD5− | Not tested |
| FL08 | FL | F | 47 | Groin | CD3−, CD20+, BCL2+, Kappa+, Lambda- | Not tested |
| FL09 | FL | F | 59 | Groin | Ki67+, CD10+, CD20+, CD19+ | Not tested |
| FL10 | FL | F | 63 | Axillary | CD10+, BCL2+, CD23−, CD3 T-cell, CD5+ T-cell, ki67+ | Not tested |
Gene expression forward and reverse primer sequences with transcript accession numbers. miRNA expression assays utilised miScript universal reverse primer (Qiagen).
| Gene | Primer Sequence (5’—3’) | Product size | Accession | |
|---|---|---|---|---|
| TET2 | F | TGGCAAACATTCAGCAGCAC | 153 bp | NM_001127208.2 |
| R | AGTTGAATTCAGCAGCTCAGT | NM_017628.4 | ||
| 92a-5p | F | GAGGTTGGGATCGGTTG | ∼87 bp | MIMAT0004507 |
| 92a-3p | F | CGCAGTATTGCACTTGC | ∼87 bp | MIMAT0000092 |
FIGURE 1Location of amplicons for the MIR17HG and TET2 methylation assays. Two regions of four CpGs each were identified within the promoter CGI of the MIR17HG gene (A), and one region in the first exon of the TET2 gene (B), each containing several regulatory motifs and transcription factor binding sites. Created with BioRender.com.
PCR and Pyrosequencing primers for TET2 and MIR17HG regulatory regions.
| Gene | Primer Sequence (5’—3′) |
|---|---|
| TET2 prom CGI Forward primer: | GGAGTAGGGGTTAGGGTT |
| TET2 prom CGI Reverse primer: | bio-ACTCTACTTCTTCTCCCAAAAAT |
| TET2 prom CGI sequencing primer: | TAGGGGTTAGGGTTG |
| miR-17–92 R1 Forward primer: | GGTTGGTTTGGAGTAGGTTTTTAATT |
| miR-17–92 R1 Reverse primer: | bio-CTTCCCCAAACTTCCTAAAAACCCTACTCT |
| miR-17–92 R1 Sequencing primer: | GGTAGGTAAAGTAATAAATTGTGAT |
| miR-17–92 R2 Forward primer: | GAGGGGAGGTTTAGGTATTG |
| miR-17–92 R2 Reverse primer: | bio-AAACCCAAAAATAAATACATTACACCC |
| miR-17–92 R2 Sequencing primer: | TGTAGTTGTGAAATTTTTGT |
FIGURE 2Expression miRNA 92a-3p, miRNA 92a-3p, and TET2 mRNA, and promoter DNA methylation of CpGs in two regions of the promoter CGI of the miR-17∼92 cluster and one region in the promoter CGI of the TET2 gene in NHL cell lines and in healthy control PBMCs. The expression of miR-92a-3p (A), miR-92a-5p (B) and TET2 mRNA (C) was assayed by RT-qPCR in commercially available NHL cell lines SU-DHL-4, Mino, Raji, and Toledo, and in healthy control PBMCs. Bisulfite pyrosequencing was performed on two regions in the promoter CGIs of the miR-17–92 cluster and in one region of the TET2 gene in the same cells and controls. Mean methylation levels of 4 CpGs in the two regions, 532 bp (D) and bp (E) upstream of the MIR17HG TSS were assayed, and mean methylation levels of 6 CpGs in the first exon of TET2 were also assayed (F). Bars denote mean and error bars denote SEM. Statistical significance calculated by KW test of significance and a post-hoc Dunn test for comparison of cell lines to controls, with significance denoted as: **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05.
FIGURE 3Expression miRNA 92a-3p, miRNA 92a-3p, and TET2 mRNA, and promoter DNA methylation of CpGs in two regions of the promoter CGI of the miR-17∼92 cluster and one region in the promoter CGI of the TET2 gene in NHL tumours compared to healthy control PBMCs. The expression of miR-92a-3p (A), miR-92a-5p (B) and TET2 mRNA (C) was assayed in by RT-qPCR in malignant lymphatic tissue of NHL patients and in healthy control PBMCs. Bisulfite pyrosequencing was performed on two regions in the promoter CGIs of the miR-17–92 cluster and in one region of the TET2 gene. Mean methylation levels of 4 CpGs in the two regions, 532 bp (D) and 774 bp (E) upstream of the MIR17HG TSS were assayed, and mean methylation levels of 6 CpGs in the first exon of TET2 were also assayed (F). Bars denote mean and error bars denote SEM. Statistical significance calculated by KW test of significance and a post-hoc Dunn test for comparison of cell lines to controls, with significance denoted as: **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05.
FIGURE 4Promoter DNA methylation of CpGs in two regions of the promoter CGI of the miR-17∼92 cluster and one region in the promoter CGI of the TET2 gene in whole blood gDNA of a retrospective NHL case-control cohort. Bisulfite pyrosequencing was performed on two regions in the promoter CGIs of the miR-17–92 cluster and in one region of the TET2 gene. Mean methylation levels of 4 CpGs in the two regions, 532 bp (A–B) and 774 bp (C–D) upstream of the MIR17HG TSS were assayed, and mean methylation levels of 6 CpGs in the first exon of TET2 were also assayed (E–F). Patients were categorised by NHL subtype, with mean methylation levels compared between subtype and controls. Individuals without a specific subtype were not included in comparison between diagnosis. Bars denote mean and error bars denote SEM. Statistical significance calculated by KW test of significance and a post-hoc Dunn test for comparison of cell lines to controls, with significance denoted as: **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05.