Long non-coding RNA musculin antisense RNA 1 promotes proliferation and suppresses apoptosis in osteoarthritic chondrocytes via the microRNA-369-3p/Janus kinase-2/ signal transducers and activators of transcription 3 axis.

Increasing evidence indicates that long non-coding RNAs (lncRNAs) play critical roles in osteoarthritis (OA). The present study aimed to investigate the underlying molecular mechanism of lncRNA musculin antisense RNA 1 (MSC-AS1) in OA. RT-qPCR was used to detect MSC-AS1 levels in cartilage tissues from patients with OA. The effects of MSC-AS1 knockdown on the viability and apoptosis in OA were evaluated via CCK-8 and TUNEL assays. The StarBase database was used to predict the binding sites between microRNA (miR)-369-3p and MSC-AS1 or JAK2, which were confirmed via the dual-luciferase reporter assay. The results demonstrated that MSC-AS1 expression was downregulated in OA. Functional analysis indicated that the addition of MSC-AS1 promoted viability and inhibited inflammation and the apoptosis of chondrocytes. In addition, MSC-AS1 regulated the survival of OA chondrocytes by sponging miR-369-3p. JAK2 was confirmed as a direct target of miR-369-3p, and MSC-AS1 regulated JAK2/STAT3 signaling via miR-369-3p in OA chondrocytes. Taken together, our results suggest that MSC-AS1 may regulate the miR-369-3p/JAK2/STAT3 signaling pathway to accelerate the viability, and inhibit inflammation and cell apoptosis in OA chondrocytes.

Introduction

Osteoarthritis (OA) is a common age-related chronic joint disease characterized by progressive loss of articular cartilage, subchondral bone sclerosis, osteophyte formation, changes in the synovial membrane, and increased volume of synovial fluid [1,2]. OA causes several physical disabilities, such as pain and decreased mobility, as well as loss of joint function [3]. OA has become the main cause of disability in the elderly [3]. Despite advancements, there are still no effective treatment methods for patients with OA [4]. Thus, it is urgent to investigate the pathogenesis of OA to discover novel therapeutic strategies for patients with OA.

Long non-coding RNAs (lncRNAs) are a class of RNAs of >200 nucleotides in length, without protein-coding capacity [5]. Previous studies have reported that lncRNAs play essential roles in several biological processes, such as proliferation, inflammation and cell differentiation [6-8]. Recently, increasing evidence suggests that the aberrant expression of lncRNAs is involved in different diseases, including OA. For example, lncRNA-p21 induces chondrocyte apoptosis in OA by sponging microRNA (miRNA/miR)‑451 [9]. Furthermore, lncRNA Angelman syndrome chromosome region promotes the proliferation of chondrocytes in OA by downregulating tumor growth factor-β1 expression [10]. Upregulation of lncRNA-corepressor interacting with RBPJ promotes the degradation of the extracellular matrix of chondrocytes in OA [11]. Notably, lncRNA musculin antisense RNA 1 (MSC-AS1) was discovered to accelerate osteogenic differentiation of bone marrow stem cells in osteoporosis by targeting the miR-140-5p/bone morphogenetic protein 2 axis [12]. However, the role of MSC-AS1 in OA progression remains unclear.

miRNAs are a type of small non-coding RNA (19–25 nucleotides) that modulate gene expression by binding to the 3ʹ-untranslated (UTR) of target mRNAs [13,14]. Increasing evidence suggests that the dysregulation of miRNAs is closely associated with OA development [15]. For example, miR-1236 increases chondrocyte apoptosis in OA by inhibiting phosphoinositide-3-kinase regulatory subunit 3 expression [16]. Furthermore, miR-10a-5p contributes to OA progression by targeting homeobox A3 [17]. miR-103 induces chondrocyte apoptosis by regulating the PI3K/AKT signaling pathway in OA [18]. miR-369 has been reported to inhibit the proliferation of human mesenchymal stromal cells isolated from human bone marrow [19]. In addition, a recent study indicated that miR-369 could decrease the proliferation of chondrocytes [20]. Nevertheless, the molecular mechanisms of miR-369 in OA should be further explored.

This study was aimed to investigate the effects of MSC-AS1 on proliferation and apoptosis in osteoarthritic chondrocytes and to investigate the molecular mechanisms of MSC-AS1 in inhibiting OA progression in vitro. We hypothesized that MSC-AS1 might promote proliferation and suppress apoptosis in osteoarthritic chondrocytes via the miR-369-3p/JAK2/STAT3 axis.

Materials and methods

Samples

A total of 28 OA cartilage tissues were collected from patients who underwent total knee replacement surgery and normal cartilage tissues were collected from 28 traumatic amputees who had no history of OA disease, no OA-related symptoms, and no signs of radiographic knee OA confirmed by X-ray. Samples were collected from patients with OA at grades III and IV, according to the Kellgren-Lawrence classification [21]. This study was approved by the Ethics Committee of The First People’s Hospital of Changzhou and written informed consent was provided by the participants. Clinical features of the patients with OA and healthy controls are shown in Table 1.

Table 1.

Clinical characteristics of the patients and healthy controls

Clinical characteristic	Patients (n = 28)	Healthy controls (n = 28)	P-value
Age (years)	56.66 ± 7.12	57.18 ± 6.48	0.874
Sex (male/female)	15/13	14/14	0.761
Body mass index (kg/m2)	23.76 ± 2.15	23.91 ± 1.98	0.812

Cell culture

Briefly, cartilage slices were initially digested with 0.25% trypsin for 1 h, and were incubated with 0.04% collagenase type II overnight in a 37°C water bath. Cells were maintained in DMEM/F12 (Hyclone) supplemented with 10% FSB (Gibco) at 37°C with 5% CO2. For blocking JAK2/STAT3 signaling, AZD1480 (Sigma-Aldrich) was directly added into the culture medium at 20 ng/mL for 24 h.

Cell transfection

miR-369-3p mimics, negative control (NC) mimics, miR-369-3p inhibitor, NC inhibitor, as well as short hairpin RNAs (shRNAs/sh) targeting MSC-AS1 (shMSC-AS1) and shNC were synthesized by Shanghai GenePharma Co., Ltd. The transfection was performed in cultured chondrocytes using Lipofectamine® 2000 (Invitrogen).

RT-qPCR

Total RNA was isolated from cartilage and chondrocytes using TRIzol® reagent (Invitrogen), and reverse transcribed into cDNA using the PrimeScript RT reagent kits (Takara, Inc.) at 37°C for 15 min. The quality and quantity of total RNA were evaluated by NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). qPCR was subsequently performed using the SYBR Green PCR Master Mix (Thermo Fisher Scientific, Inc.) on a LightCycler 480 II Real-Time PCR system (Roche). Relative expression levels were calculated using the 2−ΔΔCq method [22] and normalized to the housekeeping gene GAPDH or U6 snRNA. The primer sequences are presented in Table 2.

Table 2.

Primer sequences used for RT-qPCR

Gene	Direction	Sequence (5ʹ-3ʹ)
MSC-AS1	forward	ACGTAGCCGTTCTCATAGCG
	reverse	CCTTGGACGTGGCAGGTATT
miR-369	forward	TCGACCGTGTTATATTCG
	reverse	GAACATGTCTGCGTATCTC
JAK2	forward	CCAGATGGAAACTGTTCGCTCAG
	reverse	GAGGTTGGTACATCAGAAACACC
IL-6	forward	AGACAGCCACTCACCTCTTCAG
	reverse	TTCTGCCAGTGCCTCTTTGCTG
IL-8	forward	GAGAGTGATTGAGAGTGGACCAC
	reverse	CACAACCCTCTGCACCCAGTTT
GAPDH	forward	GTCAACGGATTTGGTCTGTATT
	reverse	AGTCTTCTGGGTGGCAGTGAT
U6	forward	CTCGCTTCGGCAGCACA
	reverse	AACGCTTCACGAATTTGCGT

CCK-8 assay

Chondrocytes were seeded into 96-well plates at a density of 2 × 103 cells/well. Following culture for 0, 24, 48 and 72 h, 10 μl CCK-8 reagent (Dojindo Molecular Technologies. Inc.) was added to each well and the cells were incubated for an additional 4 h. The optical density value was measured at a wavelength of 450 nm using a microplate reader (Bio-Rad Laboratories, Inc.) [23].

TUNEL assay

The apoptosis of chondrocytes was assessed using the One-Step TUNEL Apoptosis Assay kit (Beyotime) [24]. Briefly, chondrocytes were seeded onto coverslips and fixed with 4% paraformaldehyde and subsequently treated with DAPI solution. TUNEL-positive cells were observed under a fluorescence microscope (Olympus Corporation).

Dual-luciferase reporter assay

Wild-type (WT) or mutant (MUT) MSC-AS1 and JAK2 constructs, purchased from GenePharma (Shanghai, China), were cloned into the pmirGLO reporter vectors. Chondrocytes were co-transfected with NC mimics, miR-369-3p mimics, NC inhibitor and miR-369-3p inhibitor, as well as the pmirGLO vectors, using Lipofectamine 2000. The relative luciferase activities were detected using a Dual-Luciferase Reporter assay system (Promega Corporation) [24].

Western blotting

Total protein was extracted from cells using RIPA lysis buffer, separated by 10% SDS-PAGE, and transferred onto PVDF membranes (Thermo Fisher Scientific, Inc.). The membranes were incubated with primary antibodies of STAT3, p-STAT3, JAK2, p-JAK2 and GAPDH at 4°C overnight. Then, membranes were incubated with HRP-conjugated secondary antibodies for 1 h. Protein bands were visualized using an ECL kit (Thermo Fisher Scientific, Inc.) [25].

RNA immunoprecipitation (RIP) assay

The RIP assay was performed using an EZ-Magna RIP kit (EMD Millipore) [26]. Briefly, chondrocytes were lysed with Lysis Buffer (EMD Millipore). Argonaute 2 (Ago2) and IgG were incubated with A/G magnetic beads for 1 h at 4°C. Then, cell lysates were conjugated to magnetic beads (Thermo Fisher Scientific) for 4 h. The relative enrichment of MSC-AS1, miR-369-3p and JAK2 were analyzed via RT-qPCR analysis.

Statistical analysis

All experiments were performed in triplicate and data are presented as the mean ± standard deviation. Student’s t-test or one-way ANOVA was used to compare differences between two groups. Pearson’s correlation analysis was used for analyzing the correlation among gene expression. P < 0.05 was considered to indicate a statistically significant difference.

Results

This work aimed to evaluate the expression pattern of MSC-AS1 in OA and explore the potential mechanisms and effects of MSC-AS1 in OA. In vitro assays, we found that MSC-AS1 could promote proliferation and suppress apoptosis of osteoarthritic chondrocytes via miR-369-3p/JAK2/STAT3 pathway. Our study might offer a novel insight into the pathogenesis of OA.

MSC-AS1 promotes chondrocytes viability, as well as inhibits cell apoptosis in OA

The function of MSC-AS1 in OA chondrocytes was investigated. RT-qPCR demonstrated that MSC-AS1 expression was lower in patients with end-stage OA than that normal tissues (Figure 1(a)). The levels of COL2A1 and PRG4 were significantly reduced, while the levels of MMP13 were increased in OA tissues compared with normal tissues (Figure 1(b)). MSC-AS1 expression was decreased in chondrocytes transfected with shMSC-AS1, and the effects of which were reversed following addition of MSC-AS1 (Figure 1(c,d)). The expression levels of the inflammatory factors, IL-6 and IL-8, were increased in chondrocytes following MSC-AS1 knockdown, which decreased following the overexpression of MSC-AS1 (Figure 1(e,f)). The results of the CCK-8 assay demonstrated that MSC-AS1 knockdown suppressed the cell viability of chondrocytes, while addition of MSC-AS1 accelerated cell viability (Figure 1(g,h)). TUNEL assay demonstrated that depletion of MSC-AS1 promoted the apoptosis, while overexpression of MSC-AS1 exerted opposite effects in chondrocytes (Figure 1(i,j)). These results suggest that MSC-AS1 inhibits OA progression by accelerating the viability, and inhibiting the inflammation and apoptosis of chondrocytes.

Figure 1.

MSC-AS1 expression is downregulated in patients with OA and MSC-AS1 knockdown suppresses chondrocytes viability, as well as induces cell apoptosis in OA. (a and b) RT-qPCR showed the relative expression of MSC-AS1, COL2A1, PRG4 and MMP13 in articular cartilage samples from normal patients and OA patients. (c and d) RT-qPCR showed the relative expression of MSC-AS1 in OA chondrocytes transfected with shMSC-AS1 and shNC or pcDNA3.1 and pcDNA3.1/MSC-AS1. (e and f) RT-qPCR showed the level of inflammatory factors (IL-6 and IL-8) in OA chondrocytes transfected with shMSC-AS1 and shNC or pcDNA3.1 and pcDNA3.1/MSC-AS1. (g and h) CCK-8 assay showed the proliferation of OA chondrocytes transfected with shMSC-AS1 and shNC or pcDNA3.1 and pcDNA3.1/MSC-AS1. (i and j) TUNEL assay showed that the apoptosis of OA chondrocytes transfected with shMSC-AS1 and shNC or pcDNA3.1 and pcDNA3.1/MSC-AS1. *p < 0.05.

MSC-AS1 inhibits miR-369 expression in OA chondrocytes

LncRNAs can act as miRNA sponges to interact with miRNAs to regulate the pathogenesis of OA [27,28]. Therefore, the downstream target genes of MSC-AS1 were screened. The StarBase database predicted that the MSC-AS1 3ʹ-untranslated region (UTR) had binding sites for miR-369-3p (Figure 2(a)). The dual-luciferase reporter assay demonstrated that miR-369-3p mimics notably decreased the luciferase activity of the MSC-AS1-WT reporter in chondrocytes, whereas the activity of the MSC-AS1-MUT reporter was not affected (Figure 2(b)). The results of the RIP assay demonstrated that MSC-AS1 and miR-369-3p expression were enriched in the anti-Ago2 group compared with the anti-IgG group (Figure 2(c)). RT-qPCR analysis indicated that MSC-AS1 knockdown elevated miR-369-3p expression (Figure 2(d)). In addition, miR-369-3p expression was substantially increased in OA cartilage tissues (Figure 2(e)). Pearson’s correlation analysis exhibited a negative correlation between MSC-AS1 and miR-369-3p expression in patients with OA (Figure 2(f)). Collectively, these results suggested that MSC-AS1 could negatively regulate miR-369 expression in OA chondrocytes.

Figure 2.

miR-369-3p is a target of MSC-AS1 in OA chondrocytes.

To determine the effect of miR-369-3p on OA progression, OA chondrocytes were transfected with shNC, shMSC-AS1 and shMSC-AS1 + miR-369-3p inhibitor. RT-qPCR analysis demonstrated that MSC-AS1 interference increased miR-369-3p expression in OA chondrocytes, whereas this effect was abrogated following transfection with miR-369-3p inhibitor (Figure 3(a)). In addition, MSC-AS1 knockdown increased IL-6 and IL-8 levels, and the effects of which were reversed following transfection with the miR-369-3p inhibitor (Figure 3(b)). Similarly, the results of the CCK-8 assay demonstrated that the repressive effect of cell viability caused by MSC-AS1 knockdown was reversed following transfection with the miR-369-3p inhibitor (Figure 3(c)). The promoting effect on the apoptosis of chondrocytes induced by MSC-AS1 depletion was abrogated by miR-369-3p knockdown (Figure 3(d)). Taken together, these results suggest that MSC-AS1 facilitates the viability, and suppresses the inflammation and apoptosis of OA chondrocytes by regulating miR-369-3p expression.

Figure 3.

MSC-AS1 knockdown suppresses chondrocytes viability and induces cell apoptosis in OA via miR-369-3p.

The StarBase database predicted that miR-369-3p may interact with JAK2 (Figure 4(a)). The dual-luciferase reporter assay demonstrated that addition of miR-369-3p increased the luciferase activity of JAK2-WT reporter, but did not affect the luciferase activity of JAK2-MUT reporter (Figure 4(b)). In addition, the results of the RIP assay indicated that miR-369-3p and JAK2 were both enriched in the Ago2 group (Figure 4(c)). The addition of miR-369-3p decreased the mRNA and protein levels of JAK2 in chondrocytes (Figure 4(d,e)). Furthermore, RT-qPCR demonstrated that JAK2 expression was downregulated in patients with OA (Figure 4(f)). In addition, JAK2 expression was inversely correlated with miR-369-3p in OA tissues (Figure 4g). Collectively, these data reveal that JAK2 is a downstream target of miR-369-3p.

Figure 4.

JAK2 is a direct target of miR-369-3p.

MSC-AS1 sponges miR-369-3p to modulate the JAK2/STAT3 signaling pathway in OA chondrocytes

Previous studies have reported that JAK2/STAT3 signaling plays a crucial role in OA [29,30]. The regulatory role of the MSC-AS1/miR-369-3p/JAK2/STAT3 signaling pathway in OA was further investigated. RT-qPCR analysis demonstrated that MSC-AS1 inhibition notably decreased JAK2 expression in OA chondrocytes, which was reversed by miR-369-3p interference (Figure 5(a)). In addition, MSC-AS1 knockdown notably decreased JAK2 expression, as well as the phosphorylation of JAK2 and STAT3, the effects of which were restored following miR-369-3p deletion (Figure 5(b)). Pearson’s correlation analysis revealed that miR-369-3p was positively correlated with JAK2 expression in patients with OA (Figure 5(c)). Taken together, these results suggest that MSC-AS1 modulates JAK2/STAT3 expression via miR-369-3p in OA chondrocytes.

Figure 5.

MSC-AS1 sponges miR-369-3p to modulate the JAK2/STAT3 signaling in OA chondrocytes.

MSC-AS1 promotes chondrocytes proliferation and suppresses apoptosis via regulating the JAK2/STAT3 signaling pathway

To assess whether MSC-AS1 regulates the pathogenesis of OA via the JAK2/STAT3 signaling pathway, AZD1480, a specific JAK2/STAT3 signaling inhibitor, was used to block the JAK2/STAT3 signaling pathway. RT-qPCR revealed that AZD1480 partially abolished the inhibitory effects of MSC-AS1 overexpression on levels of IL-6 and IL-8 (Figure 6(a)). Furthermore, AZD1480 restored the MSC-AS1 overexpression-induced changes in cell proliferation and apoptosis (Figure 6(b,c)). These results demonstrated MSC-AS1 might regulate OA progression via the JAK2/STAT3 signaling pathway.

Figure 6.

MSC-AS1 promotes chondrocytes proliferation and suppresses apoptosis via regulating JAK2/STAT3 signaling pathway.

Discussion

Several studies have implied that abnormally expressed lncRNAs are closely associated with numerous pathological processes of OA [31-33]. Zhou et al. [34] revealed that downregulated lncRNA prostate cancer associated transcript 1 suppresses apoptosis of chondrocytes in OA by targeting miR-27b-3p. Li et al. [35] demonstrated that lncRNA nuclear paraspeckle assembly transcript 1 accelerates viability of chondrocytes by decreasing miR-16-5p expression in OA. It has also been reported that lncRNA MSC-AS1 was increased with osteogenic differentiation of bone marrow stem cells, as well as osteogenesis-related genes, including osteopontin, osteocalcin, and RUNX2 [12]. However, the molecular mechanism of MSC-AS1 in OA remains unclear. Our results demonstrated that MSC-AS1 expression was downregulated in patients with end-stage OA. Notably, MSC-AS1 knockdown suppressed the viability and induced apoptosis, while overexpression of MSC-AS1 promoted the viability and suppressed apoptosis of OA chondrocytes. It has been reported that high concentrations of inflammatory factors, such as IL-6 and IL-8, promote OA progression by promoting cartilage degradation [36]. Our data indicated that inhibition of MSC-AS1 significantly increased the levels of IL-6 and IL-8; however, overexpression of MSC-AS1 reversed these effects in OA chondrocytes. These results revealed that lncRNA MSC-AS1 regulates OA progression by promoting cell proliferation and repressing cell apoptosis and inflammation.

Accumulating studies identified the critical roles of miRNAs in OA progression. For example, miR-197 promotes chondrocyte viability and represses inflammation in OA pathogenesis by regulating eukaryotic translation initiation factor 4 γ 2 expression [37]. Furthermore, miR-940 regulates the inflammatory response of chondrocytes via myeloid differentiation factor 88 in OA [38]. Increasing evidence has indicated that lncRNAs interact with miRNAs via ceRNA network, which further regulate the development and progression of OA [39-41]. The present study confirmed that miR-369-3p is a potential target of MSC-AS1. In addition, MSC-AS1 knockdown elevated miR-369-3p expression in OA chondrocytes. Functional analysis demonstrated that MSC-AS1 interference attenuated cell viability, and promoted inflammation and cell apoptosis, while miR-369-3p depletion reversed these effects. Collectively, these data suggest that MSC-AS1 regulates the viability, inflammation, and apoptosis of OA chondrocytes by sponging miR-369-3p.

miRNAs have been reported to exert their functional roles via interaction with their target mRNAs [42]. The present study verified that JAK2 is a target gene of miR-369-3p, and overexpression of miR-369-3p restrained JAK2 expression in OA chondrocytes. In addition, previous studies have confirmed that the JAK2/STAT3 signaling pathway participates in OA development [30,43]. The results of the present study demonstrated that addition of miR-369-3p suppressed JAK2 protein expression, thus inhibiting the activation of JAK2/STAT3 signaling. Notably, transfection with miR-369-3p inhibitor rescued the suppressive effect of the mRNA and protein levels of JAK2 induced by MSC-AS1 knockdown. Taken together, these results indicate that MSC-AS1 inhibits OA progression via the miR-369-3p/JAK2/STAT3 pathway.

Conclusions

Our findings demonstrated that MSC-AS1 facilitated cell viability, and inhibited inflammation and apoptosis in OA chondrocytes by regulating miR-369-3p/JAK2/STAT3 signaling. These findings may improve the current understanding of the molecular mechanism of OA etiology, and provide a novel therapeutic target for the prevention and treatment of OA. However, the present study is not without limitations. First, all experiments were performed in vitro, thus the regulatory mechanisms of MSC-AS1 in OA in vivo warrant further investigation. Second, in the future study, the functional experiments performed in normal chondrocytes and the relationship between MSC-AS1 and miR-369-3p in normal tissues should be investigated.