Sibu Ma1, Qiong Wu2, Zelin Zhao2, Jiangyan Xiong3, Jianjun Niu4, Chunyan Liu4, Tingjiang Liu5, Yihui Chai6, Xiangling Qu5, Zili Ma2, Liyan Zhang2, Xiang Pu6. 1. College of Humanities and Management, Guizhou University of Traditional Chinese Medicine, China. 2. School of Pharmacy, Guizhou University of Traditional Chinese Medicine, China. 3. The First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine, China. 4. Dejiang Nation Hospital of Traditional Chinese Medicine, Dejiang County, Tongren City, Guizhou Province, China. 5. The Second Affiliated Hospital of Guizhou University of Traditional Chinese Medicine, China. 6. School of Basic Medicine, Guizhou University of Traditional Chinese Medicine, China.
Abstract
The present study aimed to investigate the protective effects and molecular mechanisms of Dendrobium officinale polysaccharides on gastric mucosal injuries. Following one week of continuous intragastric administration, a gastric mucosal injury model was established using intragastric administration of anhydrous ethanol. The area of gastric ulcer was measured, the contents of interleukin- 6 (IL-6), epidermal growth factor receptor (EGFR), and thyroid transcription factor 1 (TFF-1) in serum were detected by enzyme linked immunosorbent assay (ELISA), and the expressions of EGFR, TFF-1, IL-6, Raf-2, MAP kinase kinase 1 (MEK1), MEK2, and ERK1 in the gastric tissue were determined utilizing qPCR, Western blotting and immunohistochemistry. Simultaneously, Dendrobium officinale polysaccharides and anhydrous ethanol were added to the gastric mucosal cells (GES1) cultured in vitro, and the protective effects of Dendrobium officinale polysaccharides on cell viability was detected using Cell Counting Kit (CCK)-8. The addition of Dendrobium officinale polysaccharides markedly improved the gastric epithelial defect, inflammatory cell infiltration, and redness and swelling stemmed from gastric mucosal injuries and greatly reduced the area of gastric ulcer. The inhibition rates of gastric ulcer were 48.12 ± 2.98, 42.95 ± 1.52, and 27.96 ± 2.05% in the high, medium, and low concentration Dendrobium officinale polysaccharide groups, respectively. Dendrobium officinale polysaccharides could increase the expressions of EGFR and TFF-1 and decrease the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1. Dendrobium officinale polysaccharides could reduce the level of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.
The present study aimed to investigate the protective effects and molecular mechanisms of Dendrobium officinale polysaccharides on gastric mucosal injuries. Following one week of continuous intragastric administration, a gastric mucosal injury model was established using intragastric administration of anhydrous ethanol. The area of gastric ulcer was measured, the contents of interleukin- 6 (IL-6), epidermal growth factor receptor (EGFR), and thyroid transcription factor 1 (TFF-1) in serum were detected by enzyme linked immunosorbent assay (ELISA), and the expressions of EGFR, TFF-1, IL-6, Raf-2, MAP kinase kinase 1 (MEK1), MEK2, and ERK1 in the gastric tissue were determined utilizing qPCR, Western blotting and immunohistochemistry. Simultaneously, Dendrobium officinale polysaccharides and anhydrous ethanol were added to the gastric mucosal cells (GES1) cultured in vitro, and the protective effects of Dendrobium officinale polysaccharides on cell viability was detected using Cell Counting Kit (CCK)-8. The addition of Dendrobium officinale polysaccharides markedly improved the gastric epithelial defect, inflammatory cell infiltration, and redness and swelling stemmed from gastric mucosal injuries and greatly reduced the area of gastric ulcer. The inhibition rates of gastric ulcer were 48.12 ± 2.98, 42.95 ± 1.52, and 27.96 ± 2.05% in the high, medium, and low concentration Dendrobium officinale polysaccharide groups, respectively. Dendrobium officinale polysaccharides could increase the expressions of EGFR and TFF-1 and decrease the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1. Dendrobium officinale polysaccharides could reduce the level of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.
Gastric mucosal injury is an inflammatory response of the body to resist the invasion of foreign substances. Despite mild ulcers can be relieved by the autologous defense factors of the body, the properties of poor recovery and easy recurrence have perplexed most patients with gastropathy [1,2]. Clinical observations have demonstrated that multiple symptoms of ulcers and bleeding stem from pathogenic factors of overdrinking and improper diets. The p38MAPK signaling pathway has been verified as one of the important pathways mediating the inflammatory response of gastritis, which connects extracellular stimulation with intracellular transcription and gene expression [3,4].Dendrobium officinale represents a precious Chinese medicinal material functioning in multiple pharmacological activities. It produces pharmacological effects on immunity enhancement, anti-tumor, antioxidation, anti-hepatic injury, and antidiabetics [5,6]. Together with Ganoderma Lucidum, ginseng, and Cordyceps Sinensis, it also boasts one of the top-grade traditional Chinese medicine and honor of the ‘gold in medicine’. Dendrobium officinale is slightly cold in nature and sweet in flavor. It can nourish yin and benefit the stomach, clear heat and invigorate fluid, enhance intelligence and tranquilize the mind. As a result, it has been applied in treating several diseases including fluid deficiency due to pyreticosis, polydypsia, and deficiency-heat after an illness [7]. The principal chemical components of Dendrobium officinale contain polysaccharides, alkaloids, amino acids, and trace elements. But Dendrobium polysaccharides represent its major component exerting medicinal effects. Dendrobium decoction can fortify the gastric mucosal barrier, improve the digestive functions of the stomach by proliferating normal master cells and parietal cells for gastric mucosal restitution, and repair damaged gastric mucosa by reducing the infiltration of inflammatory cells [8]. Dendrobium officinale polysaccharides are characterized by several physiological activities, including anti-oxidation, anti-fatigue, anti-tumor, and immune regulations.It has been shown that Dendrobium polysaccharides can protect cardiomyocytes by regulating the PI3K/AKT pathway and the MAPK pathway in a model of H2O2-induced oxidative damage [9]. And polysaccharides from Dendrobium officinale Kimura & Migo leaves were proved to protect gastric mucosa by regulating the AMPK/mTOR pathway [10]. Despite its medicinal value for gastric mucosal injury has been verified in medical practices, the protective effects and mechanisms of Dendrobium officinale polysaccharides on the stomach remain to be fully explored.We hypothesize that Dendrobium officinale polysaccharide can reduce the damage of gastric ulcers caused by absolute ethanol by regulating the MAPK signaling pathway. In order to clarify this hypothesis, this study investigated the protective effects of Dendrobium officinale polysaccharides on gastric mucosa by constructing a rat model of gastric ulcer and using GES1 cells cultured in vitro and detected the expression of MAPK signaling pathway genes and inflammatory factors so that the protective effects and regulatory mechanisms on the gastric mucosa could be clarified.
Materials and methods
Experimental animals and construction of the gastric ulcer model
Forty-eight male SD rats weighing 200–250 g were provided by Chongqing Byrness Weil Biotech Ltd. The rats were kept in animal houses and exposed to 12 h light-dark cycles. They had free access to food and water at a temperature of 23–25°C after one week of adaptive feeding for the experiment. All experiments were performed following the Regulations of Experimental Animal Administration issued by the Ministry of Science and Technology of the People’s Republic of China. These experiments were approved by the Ethics Committee of Guizhou University of Traditional Chinese Medicine (GY-20170512S). The animals were divided into the following groups: a control group, a model group, a model + Omeprazole group (20 mg/kg, dissolved in saline) [11] (positive control group, Hunan Dino Pharmaceutical Limited by Share Ltd), a high dose Dendrobium officinale polysaccharide group (model group + 0.46 g/kg, dissolved in saline) (ACMEC biochemical, China), a medium dose Dendrobium officinale polysaccharide group (model group + 0.23 g/kg), and a low dose Dendrobium officinale polysaccharide group (model group + 0.12 g/kg) [12]. There were 6 groups, 8 rats in each group, 48 in total.The rats in the control group and the model group were given the same amount of normal saline by intragastric administration once a day for 1 week. Anhydrous ethanol (5 mL/kg) (Biyuntian, China) was given 1 h after the last administration to construct a gastric mucosal injury (gastric ulcer) model [13]. Another one hour later, all of the Sprague Dawley (SD) rats were sacrificed under anesthesia with excessive pentobarbital sodium (100 mg/kg) to collected the gastric tissue and serum [14,15].
Determination of gastric ulcer area and inhibition rate
The gastric tissue was initially fixed, cut open along the great curvature of the stomach, and spread for the determination of the gastric ulcer area and its inhibition rate. The calculation formula was as following: Inhibition rate of gastric ulcer = (Gastric ulcer area in the model rat group – Gastric ulcer area in the administration group)/Gastric ulcer area in the model rat group × 100% [15,16].
Detection of gastric tissue structure by HE (hematoxylin-eosin) staining
Gastric tissue samples were fixed with 4% paraformaldehyde (Beyotime, China). The HE staining detection was performed according to the instructions of Leagene Biotechnology Co., Ltd. Briefly, paraffin sections were dewaxed and put into Harris hematoxylin stain for 5 min. The sections were stained in eosin staining solution for 1 min. The sections were taken out of xylene to dry slightly and sealed with neutral gum. Microscopic examination, image acquisition, and analysis. The paraffin sections of gastric tissue were stained initially and photographed for image acquisition using a Mshot MF53 microscope produced by Guangzhou Mingmei Optoelectronic Technology Co., Ltd. The entire tissue and outline of each section were observed at low magnification and the specific area to be observed for image acquisition at 200 folds was selected for visualizing specific morphology [17,18].
Contents of IL-6, EGFR, and TFF-1 in rat serum were detected by ELISA (enzyme linked immunosorbent assay)
According to the instructions of the ELISA kit, the expression levels of IL-6 (EK306/3-01, MultiSciences (Lianke) Biotech Co., Ltd, China), EGFR (ml003425, Shanghai Biological Technology Co., Ltd. Enzyme Research, China), and TFF-1 (ml059554, Shanghai Biological Technology Co., Ltd. Enzyme Research, China) in rat serum were detected. 40 μL of sample dilution were added followed by 10 μL of sample to be tested in the enzyme plate. 100 μL of enzyme reagent was added to each well and incubated at 37°C for 60 minutes. After washing for 5 times, 50 μL of chromogenic agent A and 50 μL of chromogenic agent B were added to each well, shacked gently, and mixed well, and incubated for 15 minutes at 37°C. 50 μL of termination solution were added to each well to terminate the reaction and the absorbance at 450 nm was determined using a Multifunctional Enzyme Labeler (Thermo, USA) [19,20].
Protein expression was detected by Western blot
The gastric tissue samples were added with lysate, kept on ice for 30 min, centrifugated at 13,000 g for 15 min and the supernatant was subsequently obtained. The protein concentration was determined using the BCA method, diluted with loading buffer, and boiled for 5 min at 100°C. The protein was separated in 10% SDS-polyacrylamide gel by electrophoresis at 80 V for 2 h, subsequently transferred to a PVDF membrane, blocked with 5% skimmed milk for 1 h at room temperature, and incubated with the following antibodies at 4°C overnight: anti-EGFR (1: 8 000, Abcam), anti-TFF-1 (1: 1 000, CST), anti-IL-6 (1: 1 000, Proteintech), anti-Raf-2 (1: 1 000, Abcam), anti-MEK1 (1: 1 000, Abcam), anti-MEK2 (1: 1 000, Abcam), and anti-ERK1 (1: 1 000, Abcam). Anti-β-Actin (1: 1 000, Beyotime) was used as the internal control. Following three cycles of membrane washing with TBST, 10 min each time, secondary antibodies (HRP Goat Anti-Rabbit IgG, 1:1 000, ABclonal) were added and incubated at room temperature for 1 h. Following three cycles of membrane washing with TBST, 10 min each time, ECL reaction solution was supplied, and Bio-Rad developer was used for development. The Image Lab software was employed for quantitative analysis of the bands.The procedures of reverse transcription reaction were performed based on the instructions of the TAKARA kit. The reaction system contained 2.2 μg RNA, 2 μL OligodT, 4 μL dNTP, 4 μL 5× buffer, 1 μL Reverse Transcriptase, 0.5 μL RNAase inhibitor, and up to 20 μL RNAase free ddH2O. The reaction conditions were set at 25°C for 5 min, 50°C for 15 min, 85°C for 5 min, and 4°C for 10 min. qPCR experiments were carried out following the instructions of the qPCR kit from Tsingke Biological Technology, Beijing, China. The reaction system included 0.4 μL forward primer, 0.4 μL reverse primer, 10 μL SYBR Green, and 5.2 μL H2O. The reaction conditions were 50 C for 2 min, 95°C for 10 min, 95°C for 30 sec and 60°C for 30 sec and 40 cycles in total. The Raf-2 primers included Raf-2-F, 5ʹ-ATAGATATTGCACGACAGAC-3ʹ and Raf-2-R, 5ʹ-ATCTTGCATTCTGATGACTTC-3ʹ. The MEK1 primers included MEK1-F, 5ʹ‐TGAGAAGATCAGTGAGCTGG‐3ʹ, and MEK1-R, 5ʹ‐ACTTGATCCAGAGAACCTCC‐3ʹ. The MEK2 primers included MEK2-F, 5ʹ-AACTCAAAGACGATGACTTCG-3ʹ and MEK2-R, 5ʹ-CCATGCAAATGCTGATCTCC-3ʹ. The ERK1 primers included ERK1-F, 5ʹ-cctggaagccatgagggatgtctac-3ʹ, and ERK1-R, 5ʹ-gcagatgtggtcgttgcttagttgc-3ʹ. The primers of internal reference β-Actin were β-Actin-F, 5ʹ-GACCTGACTGACTACCTCATGAAGAT-3ʹ and β-Actin-R, 5ʹ-GTCACACTTCATGATGGAGTTGAAGG-3ʹ.
Immunohistochemistry
The paraffin sections of gastric tissue were treated with 3% hydrogen peroxide at room temperature for 15 min and washed 3 times with PBS, 5 min each time. Following goat serum blocking at room temperature for 30 min, the sections were taken out, dried the sealing solution, and incubated with primary antibodies at 4°C overnight. The primary antibodies were as follows: anti-Raf-2 (122361 000, Abcam), anti-MEK1 (1:1 000, Abcam), anti-MEK2 (1:1 000, Abcam), and anti-ERK1 (1: 1 000, Abcam). The specimens were washed with PBS 3 times, 5 min each time. Secondary antibodies (HRP Goat Anti-Rabbit IgG, 1:1 000, ABclonal) were incubated at room temperature for 1.5 h. The specimens were washed with PBS 3 times, 5 min each time. After DAB development and hematoxylin re-staining, the staining was observed under a microscope.
In vitro culture and treatment of human gastric mucosal cells GES1
GES1 cells were purchased from ATCC and cultured in a complete culture medium containing 10% FBS and 1% penicillin-streptomycin double antibody (37°C, 5% CO2). The cell density was adjusted to 2 × 105/mL and cells were transferred to a 6-well plate for culture. After the cells adhered to the wall, different concentrations of Dendrobium officinale were added to culture for 24 h according to grouping and switched to DMEM culture medium with a final concentration of 1% ethanol for continuous culture for 24 h. Follow-up testing was performed to collect samples for subsequent testing.Cell groups: control group (DMEM culture medium), model group (final concentration of 1% ethanol DMEM culture medium), Dendrobium officinale polysaccharide high-dose group (model group +400 ng/L), Dendrobium officinale polysaccharide medium-dose group (model Group +200 ng/L), and Dendrobium officinale polysaccharide low-dose group (model group +100 ng/L).
Cell viability detected by CCK8
In light of the procedures of cell modeling, the cells were digested using selected trypsin, resuspended, adjusted at a cell density of 5 × 104 mL, and planted in 96-well plates with 100 μL per well, respectively, with 3 complex holes in each group. The cells were subsequently transferred into an incubator (37°C, 5% CO2) for culture, After adherence, the cell model was established, cultured for 24 h and supplemented with 10 μL CCK-8 solution (Beyotime, China) to each well. Following 2 h incubation in the incubator, absorbance at 450 nm was determined using an enzyme labeling instrument. Simultaneously, blank wells (culture medium, CCK) and control wells (untreated cells, medium, CCK) were prepared. The calculation formula applied was as follows:Cell viability (%) = [A (Experimental group) – A (Blank group)]/[A (Control group) – A (Blank group)] × 100%.Cell inhibition rate = [A (Control group) – A (Experimental group)]/A (Control group) = 1 – Cell viability.A (Experimental group): Absorbance of treated cells and CCK solutionA (Blank group): Absorbance of wells with treated cells and CCK solution but without cellsA (Control group): Absorbance of untreated cells and CCK solution
Statistical analysis
Graphpad 8.0 software (GraphPad Software Inc., San Diego, CA, USA) was used, and experimental data were expressed as mean ± SEM. A one-way ANOVA test was employed for statistical analysis between groups. P < 0.05 was considered statistically significant.
Results
This study is to prove that Dendrobium officinale polysaccharide can reduce the damage of absolute ethanol to gastric ulcers by regulating the MAPK signaling pathway. In gastric ulcer rat models and GES1 cells, the injury was induced by adding absolute ethanol, and the protective effect was tested after adding different doses of Dendrobium officinale polysaccharides, and the expression of MAPK signaling pathway genes and inflammatory factors were detected to clarify the molecular regulatory mechanisms of Dendrobium officinale polysaccharides.
Dendrobium officinale polysaccharides reduce the area of gastric ulcer caused by absolute ethanol
In order to study the protective effect of Dendrobium officinale polysaccharides on gastric mucosa, the gastric tissue of rats in each group was cut open to observe the morphology of gastric mucosa. The normal control group displayed a smooth surface in light pink. The model group presented a swollen surface in crimson, and cord-like hemorrhage signs were visible along the longitudinal folds, indicating that anhydrous ethanol caused the gastric mucosal damage of the rats. The Omeprazole group (Positive control group) exhibited a swollen surface with scattered dot-like hemorrhage, which produced a certain protective effect on the gastric mucosal layer. Compared with the model group, the degree of gastric mucosal hemorrhage and injury in the Dendrobium officinale polysaccharide groups were alleviated, indicating that Dendrobium officinale polysaccharide could effectively protect gastric mucosa and minimize the damage of anhydrous ethanol to the gastric mucosa (Figure 1a).
Figure 1.
Dendrobium officinale effectively protects the gastric mucosa. a, Morphological observation of gastric mucosa. b, Determination of gastric ulcer area. c, Determination of inhibition rate of gastric ulcer area. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.
Dendrobium officinale effectively protects the gastric mucosa. a, Morphological observation of gastric mucosa. b, Determination of gastric ulcer area. c, Determination of inhibition rate of gastric ulcer area. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.The gastric tissue was initially fixed and spread along the great curvature, to measure the area of gastric ulcer and calculate its inhibition rate. The results revealed that anhydrous ethanol markedly increased the area of gastric ulcer, which was decreased dramatically following the addition of Dendrobium officinale polysaccharides. The inhibition rates of gastric ulcer were 48.12 ± 2.98, 42.95 ± 1.52, and 27.96 ± 2.05% in the high, medium, and low concentration Dendrobium officinale polysaccharide groups, respectively (Figures 1b-c).
Pathological changes of gastric mucosa in rats by HE staining observation
In comparison to other gastropathy, mucosal lesions are characterized by typical histological changes, predominantly reduced mucosal thickness, superficial epithelial cell erosion, and gastric mucosal loss. HE staining results of rat gastric mucosa were illustrated in Figure 2a. Compared with the model group, the pretreated Dendrobium officinale polysaccharide group and the positive Omeprazole group could markedly improve the gastric epithelial defect, inflammatory cell infiltration, redness, and swelling caused by the gastric mucosal injury. It could also normalize the arrangement of glands in the lamina propria and it also confirmed the protective effect of Dendrobium officinale polysaccharides on gastric mucosa in pathological changes.
Figure 2.
Pathological changes of gastric mucosa and detection of the contents of IL-6, EGFR, and TFF1 in the serum of rats. a, Detection of the pathological characteristics of gastric mucosa in rats detected by HE staining. b, Content of IL-6 in serum detected by ELISA. c, Content of EGFR in serum detected by ELISA. d, Content of TFF1 in serum detected by ELISA. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.
Pathological changes of gastric mucosa and detection of the contents of IL-6, EGFR, and TFF1 in the serum of rats. a, Detection of the pathological characteristics of gastric mucosa in rats detected by HE staining. b, Content of IL-6 in serum detected by ELISA. c, Content of EGFR in serum detected by ELISA. d, Content of TFF1 in serum detected by ELISA. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.
Dendrobium officinale polysaccharides decrease the content of IL-6 and increase the contents of EGFR, and TFF-1 in serum
To clarify the regulatory effects of Dendrobium officinale polysaccharide on gastric ulcers and inflammatory factors, we assayed inflammatory and gastric ulcer-related factors. The contents of IL-6, EGFR, and TFF-1 in the serum of each group were detected. The contents of IL-6 in the model group, high, medium, and low concentration Dendrobium officinale polysaccharide groups were 1059.00 ± 109.60, 196.30 ± 13.58, 337.20 ± 3.33, and 767.80 ± 46.47 pg/mL respectively. And those for EGFR were 2.63 ± 0.30, 7.80 ± 0.11, 4.78 ± 0.03, and 3.99 ± 0.27 pg/mL respectively. The contents of TFF-1 were 5.65 ± 0.32, 16.83 ± 0.33, 8.75 ± 0.18, and 7.12 ± 0.58 pg/mL respectively (Figures 2b-d). The above-described results suggested that Dendrobium officinale polysaccharides could reduce the content of IL-6, and increase the contents of EGFR, and TFF-1 in the serum of rats with gastric ulcers.
Regulation of Dendrobium officinale polysaccharides on the expression of inflammatory cytokines and MAPK pathway-related factors of gastric tissues
Western blot, qPCR, and immunohistochemistry assays were used to detect the expression of inflammatory cytokines and MAPK pathway-related factors of gastric tissues. The results of the Western blot revealed that the expressions of EGFR and TFF-1 in the model group were lower than that in the normal group, whereas the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1 were increased in the model group (Figures 3a-b). Conversely, following the addition of Dendrobium officinale polysaccharides, the expressions of EGFR and TFF-1 elevated whereas the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1 declined compared with the model group. The expressions of Raf-2, MEK1, MEK2, and ERK1 were detected by qPCR and immunohistochemistry, and the results were consistent with that of Western blot (Figures 3c-d). Generally, Dendrobium officinale polysaccharides could reduce the level of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.
Figure 3.
Regulation of Dendrobium officinale polysaccharides on the expressions of inflammatory cytokines and MAPK pathway-related factors of gastric tissues. a, Expressions of EGFR, TFF-1, IL-6, Raf-2, MEK1, MEK2, and ERK1 in the gastric tissue detected by Western blot. b, Grayscale analysis of Western blot. c, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by qPCR. d, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by immunohistochemistry. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.
Regulation of Dendrobium officinale polysaccharides on the expressions of inflammatory cytokines and MAPK pathway-related factors of gastric tissues. a, Expressions of EGFR, TFF-1, IL-6, Raf-2, MEK1, MEK2, and ERK1 in the gastric tissue detected by Western blot. b, Grayscale analysis of Western blot. c, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by qPCR. d, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by immunohistochemistry. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. OME, Omeprazole. DO, Dendrobium officinale polysaccharides.
Dendrobium officinale polysaccharides can effectively reduce the damage of GES1 cells induced by ethanol
The inhibition rate of cell viability was detected using CCK8, and the inhibition rates of cell viability were 37.68 ± 1.22, 3.68 ± 0.12, 6.45 ± 0.36, and 27.18 ± 1.05% in the model group, high, medium, and low concentration Dendrobium officinale polysaccharide groups, respectively (Figure 4a). The results demonstrated that Dendrobium officinale polysaccharides could effectively minimize the damage of GES1 cells induced by ethanol and protect gastric mucosal cells.
Figure 4.
Dendrobium officinale polysaccharides can effectively reduce the damage of GES1 cells induced by ethanol. a, Cell viability detected by CCK8. b, Expressions of Raf-2, MEK1, MEK2, and ERK1 in the GES1 detected by Western blot. c, Grayscale analysis. d, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by qPCR. e, Expressions of EGFR, TFF-1, and IL-6 detected by ELISA. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. DO, Dendrobium officinale polysaccharides.
Dendrobium officinale polysaccharides can effectively reduce the damage of GES1 cells induced by ethanol. a, Cell viability detected by CCK8. b, Expressions of Raf-2, MEK1, MEK2, and ERK1 in the GES1 detected by Western blot. c, Grayscale analysis. d, Expressions of Raf-2, MEK1, MEK2, and ERK1 detected by qPCR. e, Expressions of EGFR, TFF-1, and IL-6 detected by ELISA. #, p < 0.05; ##, p < 0.01, compared with gastric ulcer models. DO, Dendrobium officinale polysaccharides.Similarly, Dendrobium officinale polysaccharides could increase the expressions of EGFR and TFF-1, and decrease the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1 detected by ELISA, Western blot, and qPCR assays (Figures 4b-e). The results were in agreement with those of animal tissue detection, indicating that Dendrobium officinale polysaccharides could reduce the levels of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.
Discussion
This study investigated the protective effects of Dendrobium officinale polysaccharides on gastric mucosa in a rat model of gastric ulcer and the GES1 cells cultured in vitro, and the expressions of MAPK signaling pathway genes and inflammatory factors were also explored. The results demonstrated that Dendrobium officinale polysaccharide could markedly improve gastric epithelial defect, inflammatory cell infiltration, redness, and swelling caused by gastric mucosal injury, and the area of gastric ulcer was decreased substantially. Meanwhile, Dendrobium officinale polysaccharides could also increase the expressions of EGFR and TFF-1 and decrease the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1. Furthermore, it also reduced the levels of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.As a valuable Chinese medicinal material with multiple pharmacological activities, Dendrobium officinale plays role in immunity enhancement, anti-tumor, antioxidation, anti-hepatic injury, and antidiabetics [21-23]. The principal chemical components of Dendrobium officinale consist of polysaccharides, alkaloids, amino acids, and trace elements, among which Dendrobium officinale polysaccharides represent the major component of Dendrobium officinale exerting a medicinal effect. Some investigations have demonstrated that Dendrobium decoction can fortify the barrier of gastric mucosa, improve the digestive functions of the stomach by proliferating normal master cells and parietal cells facilitating gastric mucosa repair, and it can reduce the infiltration of inflammatory cells [4]. The findings indicated the characteristics of Dendrobium officinale in repairing gastric mucosa. The present study verified the protective effect of Dendrobium officinale polysaccharides on gastric mucosa in the model of gastric mucosal injury in vivo and in vitro, which was consistent with the results of previous studies.Some investigators have reported that transgenic mice with overexpression of human TFF1 in the jejunum had a low incidence of ulcers in the gastrointestinal tract, suggesting that TFF1 plays an important role in gastrointestinal repair and protection. Mucin is a generic term of a group of heavily glycosylated different glycoproteins, essential in the defense and repair of the gastric mucosa [24,25]. Normally, TFF1 exerts physiological functions by binding to MUC5AC mucin, its corresponding receptors, or transporters. The promotion of cell migration is an important procedure in the process of gastric mucosal repair and reconstruction [26]. TFF1 plays an important role in promoting cell migration. The initiation, migration, or induction largely depends on the activation of functional Ras and ERK1/2 which is intimately correlated to the EGFR tyrosine kinase signaling pathway. This study revealed that the expressions of TFF1 and EGFR decreased in the model of gastric mucosal injury. Following the addition of Dendrobium officinale polysaccharides, the expression levels of TFF1 and EGFR were markedly increased, the gastric epithelial defect, inflammatory cell infiltration, redness, and swelling caused by gastric mucosal injury were markedly improved whereas the area of gastric ulcer was decreased greatly.The MAPK pathway is a usual pathway of the cell stress response and injury response. It regulates cell proliferation, differentiation, and apoptosis by interfering with gene transcription and regulation [27]. p38MAPK represents a group of intracellular signal transduction molecules, which can be activated by pro-inflammatory factors (TNF-α and IL-1) and stress stimuli (heat shock and hyperosmotic). Activated P-P38MAPK can further activate downstream protein kinases and transcription factors, which are closely related to the initiation of apoptosis and cell cycle arrest [28]. Some evidence has demonstrated that gastric mucosal epithelium undergoes cytoskeleton recombination and tyrosine phosphorylation allowing to activate MAPK and induce the generation of inflammatory factors namely IL-6 [29,30]. The present study detected the expressions of MEK1, MEK2, ERK1, and inflammatory factor IL-6 in the MAPK pathway, and the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1 in the model group were higher than those in the normal group. Conversely, following the addition of Dendrobium officinale polysaccharides, the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1 decreased compared with the model group. It is suggested that Dendrobium officinale polysaccharides could reduce the level of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins. Through this research, the protective and repair effects of Dendrobium officinale polysaccharides on gastric mucosa can be determined. It is of great significance in enhancing the application of Dendrobium officinale polysaccharides in China and providing new ideas for the treatment of gastric mucosal injuries with clinical application value and economic benefits.
Conclusions
Dendrobium officinale polysaccharides improved the gastric epithelial defect, inflammatory cell infiltration, redness, and swelling caused by gastric mucosal injuries and greatly reduced the gastric ulcer area. Dendrobium officinale polysaccharides increased the expressions of EGFR and TFF1 and decreased the expressions of IL-6, Raf-2, MEK1, MEK2, and ERK1. Dendrobium officinale polysaccharides could reduce the level of inflammatory factors and protect gastric mucosa by inhibiting the expression of MAPK pathway genes and proteins.