| Literature DB >> 34888355 |
Luca Miglietta1,2, Ahmad Moniri2, Ivana Pennisi1, Kenny Malpartida-Cardenas2, Hala Abbas3, Kerri Hill-Cawthorne1, Frances Bolt1, Elita Jauneikaite1,4, Frances Davies1,3, Alison Holmes1,3, Pantelis Georgiou2, Jesus Rodriguez-Manzano1.
Abstract
Rapid and accurate identification of patients colonised with carbapenemase-producing organisms (CPOs) is essential to adopt prompt prevention measures to reduce the risk of transmission. Recent studies have demonstrated the ability to combine machine learning (ML) algorithms with real-time digital PCR (dPCR) instruments to increase classification accuracy of multiplex PCR assays when using synthetic DNA templates. We sought to determine if this novel methodology could be applied to improve identification of the five major carbapenem-resistant genes in clinical CPO-isolates, which would represent a leap forward in the use of PCR-based data-driven diagnostics for clinical applications. We collected 253 clinical isolates (including 221 CPO-positive samples) and developed a novel 5-plex PCR assay for detection of blaIMP, blaKPC, blaNDM, blaOXA-48, and blaVIM. Combining the recently reported ML method "Amplification and Melting Curve Analysis" (AMCA) with the abovementioned multiplex assay, we assessed the performance of the AMCA methodology in detecting these genes. The improved classification accuracy of AMCA relies on the usage of real-time data from a single-fluorescent channel and benefits from the kinetic/thermodynamic information encoded in the thousands of amplification events produced by high throughput real-time dPCR. The 5-plex showed a lower limit of detection of 10 DNA copies per reaction for each primer set and no cross-reactivity with other carbapenemase genes. The AMCA classifier demonstrated excellent predictive performance with 99.6% (CI 97.8-99.9%) accuracy (only one misclassified sample out of the 253, with a total of 160,041 positive amplification events), which represents a 7.9% increase (p-value <0.05) compared to conventional melting curve analysis. This work demonstrates the use of the AMCA method to increase the throughput and performance of state-of-the-art molecular diagnostic platforms, without hardware modifications and additional costs, thus potentially providing substantial clinical utility on screening patients for CPO carriage.Entities:
Keywords: data driven (DD); digital PCR (dPCR); infectious disease; moleuclar diagnostics; real-time PCR
Year: 2021 PMID: 34888355 PMCID: PMC8650054 DOI: 10.3389/fmolb.2021.775299
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
FIGURE 1Integration of data-driven approaches to standard diagnostic workflows. The blue arrow indicates the conventional diagnosis pipeline from patient to result, where patient sample is collected from different sources (e.g., eye swab, nasopharyngeal swab, throat swab, urine, or rectal swab). Subsequently, samples are cultured, and nucleic acids are extracted in a microbiology lab. Following this, the most suitable genetic test is developed in-silico, comprising of specialised assays capable of multi target detection in a single reaction (first grey arrow). The test is performed in the dPCR instrument, outputting large amounts of data, which are analysed by a machine learning supported algorithm to ensure reliable and accurate results (second grey arrow). This is where the AMCA methodology is applied.
Primer sets developed in this study for the 5-plex PCR assay.
| CPE target | Forward primer sequence (5′—3′) | Reverse primer sequence (5′—3′) | Amplicon size (bp) | Amplicon Tm (oC) |
|---|---|---|---|---|
| blaIMP | CAGCAGAGYCTTTGCCAGATT | GCCACGYTCCACAAACCAA | 203 | 86.5 |
| blaKPC | GGCTCAGGCGCAACTGTAA | GCCCAACTCCTTCAGCAACAA | 273 | 95.5 |
| blaNDM | CGCGTGCTGKTGGTCGATA | GGCGAAAGTCAGGCTGTGTTG | 240 | 96 |
| blaOXA-48 | CGATTTGGGCGTGGTTAAGGAT | GTCGAGCCARAAACTGTCTAC | 235 | 88.5 |
| blaVIM | CGAGGYAGAGGGGARCGAGATT | CTSTGCTTCCGGGTAGTGTT | 275 | 94 |
FIGURE 2Standard Curve in real-time digital PCR. (A) Digital patterns for each microfluidic panel at increasing concentrations (770 reaction chambers per panel; 0.85 nL volume per chamber). (B) Standard curves correlating the Cq values with the concentration of each target; shaded blue area indicates the single-molecule region; shaded orange shows the bulk region; and the middle area displays the theoretical transition between the single-molecule and bulk.
Standard curve parameter in real-time digital PCR.
| Target | Slope | Constant | Rsqra | Eff. (%)b | Single-molecule region | Transition region | Bulk region | ||
|---|---|---|---|---|---|---|---|---|---|
| 101 cp/pnl (occ.) | 102 cp/pnl (occ.) | 103 cp/pnl (occ.) | 104 cp/pnl (occ.) | 105 cp/pnl (occ.) | |||||
| blaIMP | −2.953 | 37.875 | 0.978 | 118.111 | 7 (0.9%) | 51 (6.6%) | 519 (67.4%) | 770 (100.0%) | 768 (99.7%) |
| blaKPC | −3.354 | 38.275 | 0.993 | 98.661 | 5 (0.6%) | 56 (7.3%) | 398 (51.7%) | 769 (99.9%) | 770 (100.0%) |
| blaNDM | −3.705 | 40.62 | 0.996 | 86.174 | 4 (0.5%) | 21 (2.7%) | 190 (24.7%) | 767 (99.6%) | 769 (99.9%) |
| blaOXA-48 | −3.304 | 38.01 | 0.998 | 100.77 | 3 (0.4%) | 25 (3.2%) | 321 (41.7%) | 769 (99.9%) | 768 (99.7%) |
| blaVIM | −3.582 | 39.96 | 0.994 | 90.169 | 6 (0.8%) | 59 (7.7%) | 659 (85.6%) | 770 (100.0%) | 770 (100.0%) |
R-squared.
Efficiency (%).
Copies/panel (% occupancy in digital PCR). The occupancy is calculated by counting the number of amplification reaction occurring per each panel and diving it by the total number of wells (N = 770).
FIGURE 3Real-time amplification and melting curves obtained from the dPCR instrument. (A) Raw amplification curves at different concentrations from synthetic DNA templates; the black line represents the average trend of the kinetic information based on each specific target-primer interaction. (B) Melting curves across the five different CPO; the black line represents the average trend of the thermodynamic information based on each specific target-primer interaction. (C) Melting peak (Tm) distribution from the dPCR instrument, showing the probability density function (PDF) for each target.
Clinical Enterobacteriaceae isolates used in this study.
| Species (MALDI-TOF MS) | Carbapenemase gene | Number of isolates |
|---|---|---|
| Citrobacter spp. | blaIMP | 1 |
| blaKPC | 2 | |
| blaNDM | 1 | |
| blaOXA-48 | 10 | |
| blaVIM | 1 | |
| Enterobacter spp. | blaIMP | 20 |
| blaNDM | 7 | |
| blaOXA-48 | 2 | |
| blaVIM | 2 | |
| Escherichia spp. | blaIMP | 7 |
| blaNDM | 14 | |
| blaNDM and blaOXA-48 | 1 | |
| blaOXA-48 | 26 | |
|
| blaIMP | 15 |
| blaKPC | 6 | |
| blaNDM | 51 | |
| blaOXA-48 | 45 | |
| blaVIM | 3 | |
|
| blaNDM | 1 |
|
| blaIMP | 2 |
| blaVIM | 2 | |
|
| blaKPC | 1 |
| blaOXA-48 | 1 | |
| Multiple species* | negative | 32 |
*CPO-negative species: Acinetobacter baumannii, Citrobacter freundii, Enterobacter spp., Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa.
Classification of clinical isolates when using the ML-based MCA method.
| Target | N | TP | TN | FP | FN | SEN (%) | SPE (%) | Accuracy (CI) |
|---|---|---|---|---|---|---|---|---|
| blaIMP | 45 | 45 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (95.32–100.00%) |
| blaKPC | 9 | 8 | 32 | 1 | 0 | 100.0 | 96.97 | 97.56% (87.14–99.94%) |
| blaNDM | 74 | 54 | 32 | 20 | 0 | 100.0 | 61.54 | 81.13% (72.38–88.08%) |
| blaOXA-48 | 84 | 84 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (96.87–100.00%) |
| blaVIM | 8 | 8 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (91.19–100.00%) |
| blaOXA-48 and blaNDM | 1 | 1 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (97.24–100.00) |
| Total | 221 | 200 | 32 | 21 | 0 | 100.0 | 60.38 | 91.70% (87.59 to 94.79%) |
Abbreviations-N, number of samples; TP, true Positive; TN, true negative; FP, false positive; FN, false negative; SEN, sensitivity; SPE, specificity; CI, confidence interval.
A total 32 negatives samples are considered across all the groups for sensitivity, specificity and accuracy calculation.
This isolate was misclassified as blaNDM and blaKPC double infection.
These isolates were misclassified as blaNDM and blaKPC double infections.
Classification of clinical isolates based on ML-based AMCA method.
| Target | N | TP | TN | FP | FN | SEN (%) | SPE (%) | Accuracy (CI) |
|---|---|---|---|---|---|---|---|---|
| blaIMP | 45 | 45 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (95.32–100.00%) |
| blaKPC | 9 | 9 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (91.40–100.00%) |
| blaNDM | 74 | 73 | 32 | 1 | 0 | 100.0 | 96.97 | 99.06% (94.86–99.98%) |
| blaOXA-48 | 84 | 84 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (96.87–100.00%) |
| blaVIM | 8 | 8 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (91.19–100.00%) |
| blaOXA-48 and blaNDM | 1 | 1 | 32 | 0 | 0 | 100.0 | 100.0 | 100.0% (97.24–100.00) |
| Total | 221 | 220 | 32 | 1 | 0 | 100.0 | 96.97 | 99.60% (97.82 to 99.99%) |
Abbreviations-N, Number of samples; TP, True Positive; TN, True Negative; FP, False Positive; FN, False Negative; SEN, Sensitivity; SPE, Specificity; CI, Confidence Interval.
A total 32 negatives samples are considered across all the groups for sensitivity, specificity and accuracy calculation.
This isolate was misclassified as blaNDM, and blaKPC, double infection.