Ventilagolin Suppresses Migration, Invasion and Epithelial-Mesenchymal Transition of Hepatocellular Carcinoma Cells by Downregulating Pim-1.

OBJECTIVE: Inhibition of tumor metastasis is a useful strategy to improve the efficacy of cancer therapy. Ventilagolin, a natural 1, 4-naphthoquinone derivative extracted from Ventilago leiocarpa Benth, has shown promising antitumor effects in previous studies. However, the effects and underlying mechanisms of Ventilagolin against migration, invasion and epithelial-mesenchymal transition (EMT) of hepatocellular carcinoma (HCC) remain unclear. The present study has examined these effects and determined whether the proto-oncogene Pim-1 is involved.
METHODS: The effects of Ventilagolin on migration, invasion, Pim-1 and EMT-related proteins (eg, E-cadherin, N-cadherin, Vimentin) expression were assessed by scratch wound healing, Transwell, qRT-PCR and Western blot assays, respectively. Pim-1 stably overexpressed HepG2 and SMMC-7721 cells were generated to explore whether Ventilagolin inhibited migration, invasion and EMT of HCC cells via regulating Pim-1. Subcutaneous xenograft tumor model in nude mice was established. Histopathological changes of tumor tissues were examined by H&E staining and expressions of Pim-1 and EMT-related proteins were detected by immunohistochemistry.
RESULTS: Ventilagolin significantly (P < 0.01) reduced the expression of Pim-1 levels in HepG2 and SMMC-7721 cells. Compared with the control group, the migration and invasion abilities of Pim-1-overexpressing HepG2 and SMMC-7721 cells were significantly (P < 0.05, P < 0.01) enhanced, the expression of E-cadherin was decreased (P < 0.01), and the levels of N-cadherin and Vimentin were upregulated (P < 0.05, P < 0.01). Ventilagolin treatment effectively reversed these effects of Pim-1 overexpression. In vivo experiments showed that Ventilagolin could effectively suppress HCC tumor growth, downregulate Pim-1, N-cadherin and Vimentin expression, and upregulate E-cadherin expression.
CONCLUSION: Ventilagolin suppresses HCC cell proliferation, migration and invasion and reverses EMT process by downregulating Pim-1, suggesting Ventilagolin is a potential therapeutic agent for treatment of HCC.

Introduction

Hepatocellular carcinoma (HCC) is the most common malignancy of primary liver cancers, and is the third leading cause of cancer-related deaths worldwide.1 Currently, HCC treatment uses surgery-dominated combined modality therapy. However, due to high malignancy, aggression and metastasis of HCC cells, tumor recurrence and metastasis rates in patients within 5 years following surgery can still be as high as 70%, and the cure rate is extremely low.2 The invasion and metastasis are considered as the main causes for rapid progression and poor therapeutic outcomes in HCC patients.

Epithelial-mesenchymal transition (EMT) is an important mechanism of tumor invasion and metastasis in various cancers, such as breast, lung, gastrointestinal, hepatobiliary, head-and-neck, and urinary cancers.3 EMT refers to the phenomenon of epithelial cells transforming into mesenchymal cells under particular physiological and pathological conditions.4 During this process, polarity of the epithelial cells gradually decreases, and the cells finally transformed into mesenchymal cells with migratory capability and infiltration potential,5 mainly characterized by abnormal expression of specific biomarkers (eg, cadherins). For example, when cells undergo EMT progression, the expression of E-cadherin, an adhesion molecule primarily expressed by epithelial cells, is decreased, while the expression of mesenchymal markers Vimentin and N-cadherin is increased.6 Once the tumor cells undergo mesenchymal transformation, the ability of migration and invasion is also increased.7,8 Furthermore, mesenchymal-like cells generated by EMT acquire the properties of cancer stem cell (CSC), which may also contribute to the resistance of cancer cells to therapy. In this regard, attenuation of EMT is considered as a promising pathway for discovering new anticancer drugs.5

Ventilagolin is a 1,4-naphthoquinone derivative (Figure 1A) which is isolated from Ventilago leiocarpa Benth (family Rhamnaceae), a traditional Yao medicine in Guangxi Zhuang Autonomous Region.9 We previously showed that Ventilagolin exhibited good antitumor activities in terms of inhibiting HCC cell proliferation and promoting cell apoptosis.10,11 Furthermore, when human HCC HepG2 cells were exposed to Ventilagolin, the mRNA expression of E-cadherin was significantly increased, and the mRNA expression of N-cadherin was significantly decreased. These results indicate that Ventilagolin not only has good anticancer activity, but also exerts potential inhibitory effect on the process of EMT in human HCC cells. However, these effects need to be further investigated and explained.

Figure 1

Ventilagolin inhibits growth, migration and invasion of HCC cells. (A) Chemical structure of Ventilagolin. (B) HepG2 and SMMC-7721 cells were treated with different concentrations of Ventilagolin, and the cell inhibition rates were detected by CCK-8 method. (C and D) Scratch wound healing (10 fields of view) and Transwell chamber (20×) assays were performed when HepG2 and SMMC-7721 cells were treated with 30 μmol/L and 60 μmol/L Ventilagolin. Data are presented as mean ± SEM of three independent experiments. * and ** respectively indicate significant difference at P < 0.05 and P < 0.01 as compared to the control group.

The serine/threonine kinases encoded by the Pim family of proto-oncogenes act on a wide range of cellular substrates and participate in the occurrence and development of multiple tumor development processes, including tumor cell proliferation, cycle arrest, apoptosis, migration, invasion, drug resistance, and so on.12–14 Pim-1 is the most extensively studied member of the Pim family. It has been reported that Pim-1 can induce the development of EMT by activating downstream transcription factors, ZEB1, Snail1 and Twist-1, thereby enhancing the invasion of clear-cell renal-cell carcinoma.15 Also, Pim-1 enhanced the expression activity of its cofactor c-Myc, which promoted EMT progression in breast cancer cells, resulting in enhanced invasion and metastasis of breast cancer.16 Besides, inhibiting the expression of Pim-1 by miRNA successfully reverted the M-type to E-type in osteosarcoma or melanoma cell, achieving a significant reduction in terms of tumor invasion and metastasis.17,18

Previously, we studied gene expression profile of HepG2 cells using RNA-sequencing (RNA-seq) analysis and found that the proto-oncogene Pim-1 was one of the down-regulated differential expression gene after treatment of HepG2 cells with Ventilagolin. Therefore, we focused on revealing whether inhibiting Pim-1 expression could reverse the EMT in HCC cells in this study.

Based on these findings, in the present study, we applied human HCC cells HepG2 and SMMC-7721, through lentiviral infection technology and establishment of subcutaneous xenograft tumor models in nude mice, to explore the effects of Ventilagolin on the invasion, metastasis and EMT of HCC in vivo and in vitro. We also determined whether these activities are associated with the regulation of Pim-1 expression. This study may provide new ideas and scientific evidence for the further development of Ventilagolin in HCC treatment.

Materials and Methods

Materials

Cell Lines

Human HCC cells HepG2 and SMMC-7721 were purchased from Guangzhou Suyan Biotechnology Co., Ltd. (Guangzhou, China), and were identified by the short tandem repeat (STR) profiling method.

Animals

Five-week-old SPF female BALB/c-nu nude mice (15.5–17.5g) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (Nanjing, China), and the animal license number was SCXK (Jiangsu) 2018–0008.

Drugs and Reagents

Ventilagolin was provided by the Department of Chemistry, Guangxi Institute of Chinese Medicine & Pharmaceutical Science (Nanning, China). For in vitro studies, the purplish-red needle-like crystal product was dissolved in dimethyl sulfoxide (DMSO) to obtain a 100 mmol/L stock solution. The solution was filter sterilized through a 0.22μm membrane filter and diluted with culture medium to appropriate concentration just prior to use in the subsequent cell studies. The final concentration of DMSO in the cultures did not exceed 0.2% and had no effect on cell viability. During animal experiments, Ventilagolin was dissolved in normal saline (pH 8.8 adjusted with NaOH) to produce specific concentrations. After filtration through 0.22μm membrane filter, the solution of Ventilagolin was used for intraperitoneal injection.

Other reagents are listed as follows: DMEM high glucose medium (batch No. 8119431; Gibco, USA); 0.25% Trypsin (batch No. 2120734; Gibco, USA); Cell Proliferation Assay Kit (Cell Counting Kit-8, CCK-8, batch No. KN658; Dojindo, Japan); Transwell chamber (batch No. 08620032; Corning, USA); TRIzol (batch No. 262312, Life, USA); Primers used for quantitative real-time polymerase chain reaction (qPCR) were synthesized by Shanghai Sangon Biological Engineering Co. Ltd. (Shanghai, China); Hiscript III RT SuperMix for qPCR (batch No. 7E402G0; Vazyme, Nanjing, China); ChamQ Universal SYBR qPCR Master Mix (batch No. 7E362L9; Vazyme, Nanjing, China); Pim-1 overexpressing lentivirus (Lentiviral vector containing the coding sequence of Pim-1, batch No. H17971), control lentiviral vector (empty), and Polybrene (1mg/mL) were purchased from Shanghai Heyuan Biotechnology Co. Ltd. (Shanghai, China); Puromycin (batch No. 107R0432; Solarbio, Beijing, China); 12.5%/7.5% Omni-Easy PAGE Gel Rapid Preparation Kit (batch No. 02511100, 024B1030; Epizyme, Shanghai, China); Rabbit anti-human Pim-1 monoclonal antibody (batch No. HM0826; Novus, USA); Mouse anti-human E-cadherin monoclonal antibody (batch No. GR3315795-1; Abcam, USA); Rabbit anti-human N-cadherin monoclonal antibody (batch No. GR73907-13; Abcam, USA); Mouse anti-human Vimentin monoclonal antibody (batch No. GR3361308-1; Abcam, USA); Mouse anti-human GAPDH monoclonal antibody (batch No. GR3235553; Abcam, USA); Horseradish peroxidase (HRP)-labeled goat anti-rabbit and anti-mouse IgG (batch No. GR3307268-2, GR3257574-1; Abcam, USA); Goat serum (batch No. 20110601; Zhongshan Jinqiao, Beijing, China); Mouse/rabbit enhanced polymer detection system (batch No. 2021D1111; Zhongshan Jinqiao, Beijing, China); DAB chromogen kit (batch No. 2010A1118; Zhongshan Jinqiao, Beijing, China).

Instruments

Biosafety cabinet (ESCO AC2-4S1, Singapore); CO2 cell culture incubator (MCO-18AIC, Panasonic, Japan); Multi-mode microplate reader (Synergy H1, BioTek, USA); Ultramicro nucleic acid protein analyzer (Nanodrop One, Thermo Fisher, USA); Real-time fluorescence quantitative PCR apparatus (LightCycler 480 II, Roche, Switzerland); Inverted fluorescence microscope (DMi8, Leica, Germany);

Vertical electrophoresis and transblot system (Mini-PROTEAN Tetra/Mini Trans-Blot Module, Bio-Rad, USA); Multifunctional imaging analysis system (ProteinSimple FluorChem R, Protein simple, USA).

Methods

Cell Culture

Human HCC cells HepG2 and SMMC-7721 were cultured in DMEM high glucose medium containing 10% FBS at 37°C under 5% CO2. Once the culture reached 80–90% confluence, cells were digested and passaged with 0.25% Trypsin.

Cell Proliferation by Kit-8 (CCK-8) Assay

Cells were seeded in 96-well plates at 5×104 cells/well and cultured for 24h. Various concentrations of Ventilagolin (200, 100, 50, 25, 12.5 and 6.25 μmol/L) were added. Four replicate wells were used for each concentration, and culture medium without Ventilagolin served as the blank control. Then, 10μL of CCK-8 was added per well after 24h and incubated further for 2h. Absorbance of wells at an optical density (OD) of 450 nm was measured by the microplate reader. Inhibition of cell viability was calculated, and the growth curve was plotted. Inhibition of cell viability (%) = (1 – ODtreated/ODcontrol) × 100%.

Cell Migration by Wound Healing Assay

Cells were digested, counted, seeded in 6-well plates, and cultured for 24h. When the cells reached 95% confluence, a straight line was scratched across the cell surface by a sterile 10μL pipette tip. The floating cells were removed by washing with phosphate-buffered saline (PBS), and culture medium was added. The scratch gap was photographed and recorded under a microscope. Different concentrations of Ventilagolin (30, 60 μmol/L) were added in experimental groups, while an equal volume of culture medium was added in control groups. After 24h incubation, the scratches were photographed at the identical location. Scratch wound distance was measured using ImageJ software. The migration rate was calculated by the following formula: (1 - final distance/initial distance) × 100%.

Cell Invasion by Transwell Chamber Assay

After digestion and counting, the cells were re-suspended in serum-free DMEM medium, and the cell concentration was adjusted to 5×105/mL. Cells were seeded in the upper compartments of Matrigel-coated Transwell chambers at 0.2 mL/well. In the experimental groups, different concentrations of Ventilagolin (30, 60 μmol/L) were added to cells, and DMEM containing 20% FBS was added into the lower chamber. Following 24h incubation, the chambers were removed, and washed 2–3 times with PBS. The cells in the upper layer of the filter membrane were wiped off with cotton swabs, and the cells in the lower membrane were fixed with 4% paraformaldehyde for 15min and then stained with 0.1% crystal violet for 30min. The stain was then washed with running water, dried, and photographed under a light microscope. Finally, the cells were decolorized with 3% acetic acid, and the OD value of the decolorized solution was measured under 570 nm by the microplate reader.

Quantification of Pim-1 mRNA Expression by Real-Time PCR

The cells were seeded in 6-well plates with 1×106 cells/well and incubated for 24h. This was followed by adding varying Ventilagolin concentrations (30, 60 μmol/L) for 24h in experimental groups. Total RNA of the cells was extracted by the TRIZOL method, and the purity and concentration of RNA were determined by the ultramicro nucleic acid protein analyzer. Reverse transcription of RNA into cDNA was performed by the routine method. With GAPDH as an internal reference, SYBR qPCR amplification was performed using primers specific for the Pim-1 gene. The relative gene expression was calculated by 2−ΔΔCT method. The primers for amplification are listed in Table 1.

Table 1

PCR Primer Sequences

Gene	Accession Number/Reference	Upstream Primer (5ʹ-3ʹ)	Downstream Primer (5ʹ-3ʹ)	Product Size/bp
Pim-1	NM_002648	GAGAAGGACCGGATTTCCGAC	CAGTCCAGGAGCCTAATGACG	119
GAPDH	NM_001256799	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG	197

Protein Expressions of Pim-1 and EMT Markers by Western Blot

Cells were seeded in 6-well plates at 1×106 cells/well for 24h of adherent growth. Ventilagolin were added to the cells in the experimental groups at a final concentration of 30 μmol/L and 60 μmol/L for 24h. Total protein of the cells was extracted by RIPA lysate, and the protein concentration was determined by BCA protein assay kit. Then, 20 μg of total protein per sample was taken for SDS-PAGE electrophoresis on 12% separating gel and 5% stacking gel, and blotted onto PVDF membranes. After blocking with PBST containing 5% skim milk for 1h, the membranes were incubated overnight at 4°C with rabbit anti-human Pim-1 (1:2000 dilution), mouse anti-human E-cadherin (1:1000 dilution), rabbit anti-human N-cadherin (1:1000 dilution), mouse anti-human Vimentin (1:2000 dilution) and mouse anti-human GAPDH (1:5000 dilution) primary antibodies, respectively, followed by washing 3 times with PBST. Then, the blots were incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG (1:2000 dilution) for 2h at room temperature. After three washes with PBST, the membranes were immersed in ECL luminescent substrate for 1min, and the images were captured by the ProteinSimple multifunctional imaging analysis system. Band density from Western blot was quantified with ImageJ software.

Construction of Stable Pim-1 Overexpression HCC Cells Using Lentiviral Infection

HepG2 and SMMC-7721 cells were seeded in 60 cm dishes at 5×104 cells per dish with 3mL of complete medium. After 24h, the cells were classified into three groups: blank control group (control), negative control group (NC), and Pim-1 overexpressing group (Pim-1 OE). Empty lentiviral vector (pSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3FLAG) and 15μL Polybrene (1mg/mL) were added to cells in NC group. In the Pim-1 OE group, recombinant lentivirus vector (pSLenti-EF1-EGFP-P2A-Puro-CMV-Pim-1-3xFLAG-WPRE) and 15μL Polybrene (1mg/mL) were added. The volume of lentivirus required was calculated according to the multiplicity of infection (MOI) value obtained from a pre-experiment. After 2–3 days of lentiviral infection, the culture medium was replaced with the medium containing 2μg/mL puromycin to select virus-infected positive cells, and cultures were maintained for 3–4 days. Cell status and levels of GFP expression were monitored. To validate infection efficiency, total cellular RNA and protein were extracted, and mRNA and protein expression levels of Pim-1 were measured by quantitative PCR and Western blot methods. The cells in good condition were passaged, cryopreserved, and used for subsequent experiments (follow steps 2.2 to 2.6 in Subheadings).

Establishment of Xenograft Tumor Model in Nude Mice

SPF female BALB/c-nu nude mice were housed in a barrier facility within the laboratory animal center of Guangxi Institute of Chinese Medicine & Pharmaceutical Science, and were fed with autoclaved feed and water. All procedures of animal experiments were performed in accordance with the Laboratory Animal Management Regulations of China (1988, revised 2017) and Laboratory animal—Guideline for ethical review of animal welfare (GB/T 35892–2018), and were approved by the Ethics Committee of Guangxi Institute of Chinese Medicine & Pharmaceutical Science (approval number: 2020111601).

The cultured SMMC-7721 cells in logarithmic growth phase were collected and adjusted with serum-free medium to 1×107 cells/mL. Fifteen female nude mice were taken and 0.2 mL of cell suspension was subcutaneously inoculated into the right back of each mouse. When the maximum diameter of the tumors reached to (6±0.5) mm at day 7 post-inoculation, the tumor-bearing mice were randomly assigned into 3 groups (5 mice each group): blank control group (control), Ventilagolin high-dose group (12 mg/Kg) and Ventilagolin low-dose group (6 mg/Kg). Dose selection (6, 12 mg/Kg) for Ventilagolin was based on its median lethal dose (LD50) value (61.279 mg/kg) determined in an acute toxicity test (1/10, 1/5 of LD50, respectively). Mice were injected intraperitoneally with 0.1mL/10g of Ventilagolin solution once daily for 2 consecutive weeks. Control mice received the corresponding volume of saline. General health status and tumor growth in nude mice were observed every day. Tumor sizes were measured using a vernier caliper every two days and tumor volume was calculated using the formula [0.5×Length × Width2].19

Histology and Immunohistochemistry Analysis

After 2 weeks of continuous Ventilagolin or vehicle injection, the tumor-bearing mice were killed by cervical dislocation. Subcutaneous tumor tissues were harvested from each group, and tumor weight and volume were measured. Tumors were fixed in 10% paraformaldehyde, and routinely embedded in paraffin. The sections were dewaxed and rehydrated, and the pathological changes of the tissues were observed under light microscope after routine H&E staining. For immunohistochemistry, paraffin sections were dewaxed and rehydrated, followed by antigen retrieval in citrate buffer using microwave treatment. Endogenous peroxidase activity was blocked with 3% H2O2. Then, slices were blocked in goat serum for 1h and then incubated at 37°C for 1 h with rabbit anti-human Pim-1 (1:100 dilution), mouse anti-human E-cadherin (1:100 dilution), rabbit anti-human N-cadherin (1:100 dilution), mouse anti-human Vimentin (1:500 dilution) and mouse anti-human GAPDH (1:500 dilution) primary antibodies, respectively. After labeling with the second antibody, the sections were stained with DAB chromogen, counterstained with hematoxylin to stain nuclei, and sealed with neutral resins. The sections were observed and photographed under a light microscope.

After that, the expression of Pim-1, E-cadherin, N-cadherin, and Vimentin were scored semiquantitatively. Yellow to brown granular deposits which were presented in the nucleus and/or cytoplasm were considered to be positive for target proteins.20 The staining intensity and percentage of positive cells in each section were scored as follows: 0, basically no coloring; 1, pale yellow color; 2, yellow color; 3, brownish-yellow or brown color; 0, 0~5% stained cells; 1, 6~25% stained cells; 2, 26~50% stained cells; 3, >50% stained cells. The final score of each tissue section was obtained by multiplying the score of staining intensity by the score of percentage of positive cells. Final scores ≤3 were regarded as low expression, while >3 were defined as high expression.21

Statistical Analysis

All data were expressed as means ± standard error of the mean (SEM) from at least three independent experiments except those specifically indicated. Student’s unpaired t test was used for comparison between two groups and one-way analysis of variance (ANOVA) was applied to multiple group comparison. The post-hoc method chosen depends on the results of homogeneity of variance test. Data were transformed appropriately when the normality condition was not met. Data were analyzed using GraphPad Prism 7 software and SPSS 22.0 software. Comparisons of immunohistochemical scores between the groups were performed using a chi-square test. A p-value <0.05 was considered as statistically significant.

Results

Ventilagolin Inhibits Proliferation, Migration and Invasion of HCC Cells

We evaluated the anti-HCC activity of Ventilagolin by detecting the effect on proliferation capacity of HCC cells. Ventilagolin inhibited the proliferation of human HCC cells HepG2 and SMMC-7721 in a dose-dependent manner, and the 50% inhibitory concentration (IC50) values of Ventilagolin on HepG2 and SMMC-7721 cells were 112.38 μmol/L and 59.41 μmol/L, respectively (Figure 1B). To further evaluate the anti-HCC effects, we examined the influences of Ventilagolin on migration and invasion capabilities of HepG2 and SMMC-7721 cells. Results of scratch wound healing and Transwell chamber assay showed that Ventilagolin significantly suppressed migration and invasion abilities of HepG2 and SMMC-7721 cells (Figure 1C and D). These results indicate that Ventilagolin can effectively inhibit growth, migration and invasion of HCC cells, and has potential anti-HCC effects.

Ventilagolin Inhibits EMT of HCC Cells

Epithelial-mesenchymal transition (EMT) plays an important role in tumorigenesis and tumor progression. To investigate whether Ventilagolin affects EMT progression of HCC cells, we examined the expressions of EMT-associated proteins in HCC cells. Results of Western blot showed that Ventilagolin significantly reduced N-cadherin and Vimentin expression, and increased E-cadherin expression in HepG2 and SMMC-7721 cells (Figure 2A and B), suggesting Ventilagolin can inhibit EMT of HCC cells.

Figure 2

Ventilagolin inhibits EMT of HCC cells. (A and B) HepG2 and SMMC-7721 cells were treated with 30 μmol/L and 60 μmol/L Ventilagolin, and the protein levels of E-cadherin (E-Ca), N-cadherin (N-Ca), Vimentin were determined by Western blot using GAPDH as an internal reference. Data are expressed as mean ± SEM from three independent experiments. The relative expression levels were quantified by ProteinSimple analysis software. * and ** respectively indicate significant difference at P < 0.05 and P < 0.01 as compared to the control group.

Ventilagolin Reduces Pim-1 Expression in HCC Cells

To verify whether Pim-1 is regulated by Ventilagolin, we treated HepG2 and SMMC-7721 cells with different concentrations of Ventilagolin for 24 h. The results showed Ventilagolin downregulated the mRNA and protein expression levels of Pim-1 in a dose-dependent manner (Figure 3A and B), indicating Pim-1 is regulated by Ventilagolin.

Figure 3

Ventilagolin reduces Pim-1 expression in HCC cells. (A and B) HepG2 and SMMC-7721 cells were treated with 30 μmol/L and 60 μmol/L Ventilagolin, and the mRNA and protein levels of Pim-1 were determined by qRT-PCR and Western blot using GAPDH as an internal reference. The relative expression levels were quantified by ProteinSimple analysis software. Data are expressed as mean ± SEM from three independent experiments. ** indicates significant difference at P < 0.01 as compared to the control group.

Continue.

Ventilagolin reverses the facilitative effects of Pim-1 overexpression on migration, invasion, and EMT in HCC cells. (A and B) Pim-1 mRNA and protein expression levels in blank control group (control), negative control group (NC), and Pim-1-overexpressing group (Pim-1 OE) were examined by qRT-PCR and Western blot. Data are expressed as mean ± SEM from three independent experiments. (C and D) Scratch wound healing (10 fields of view) and Transwell chamber (20×) assays were performed when HepG2 and SMMC-7721 cells were grouped by treatment. Data are expressed as mean ± SEM from four independent experiments. (E and F) Protein levels of Pim-1, E-cadherin (E-Ca), N-cadherin (N-Ca), Vimentin in different groups were determined by Western blot using GAPDH as an internal reference. Data are expressed as mean ± SEM from four independent experiments. The relative expression levels were quantified by ProteinSimple analysis software. * and ** respectively indicate significant difference at P < 0.05 and P < 0.01 as compared to the control group; # and ## respectively indicate significant difference at P < 0.05 and P < 0.01 as compared to the Pim-1 OE group.

Ventilagolin Suppresses Migration, Invasion and EMT of HCC Cells via Regulating Pim-1 Expression

To explore whether Ventilagolin inhibits migration, invasion and EMT of HCC cells via regulating Pim-1, we constructed lentiviral vectors to overexpress Pim-1 in HepG2 and SMMC-7721 cells (Figure 4A and B). We found that Ventilagolin (60 μmol/L) reversed the facilitative effects of Pim-1 overexpression on cell migration and invasion (Figure 4C and D). Results of Western blot showed that Ventilagolin could reverse the promotion effects of Pim-1 overexpression on N-cadherin and Vimentin, as well as the inhibition effects on E-cadherin (Figure 4E and F). These results suggest that Ventilagolin inhibits the malignant progression (eg, migration, invasion and EMT) of HCC by negatively regulating Pim-1.

Ventilagolin Suppresses the Growth of HCC Xenograft Tumors in Nude Mice

To further study the role of Ventilagolin in growth and EMT of HCC, we established subcutaneous HCC cell xenograft tumor model in nude mice. We then monitored tumor growth after the start of treatment with high (12 mg/Kg) and low dose (6 mg/Kg) of Ventilagolin. Compared with the control group, tumor sizes in Ventilagolin-treated groups were significantly reduced from day 6 and the tumors grew significantly slower (Figure 5A). After 14 days of continuous administration, the nude mice were killed and the tumor masses were excised (Figure 5B). Tumor weights in Ventilagolin-treated groups were significantly decreased compared with the control group (Figure 5C), consistent with the reduction of tumor sizes observed in these mice. Varying degrees of cell degeneration and necrosis, accompanied by striking lymphocytic infiltration were observed in tumor tissues after Ventilagolin intervention (Figure 5D). In addition, compared with the control group, the expression levels of Pim-1, N-cadherin and Vimentin were significantly decreased while E-cadherin was significantly increased in tumor tissues of Ventilagolin-treated groups (Figure 5E). The results of quantitative analysis in immunohistochemical staining are generally consistent with the images observed under the microscope (Table 2). These results indicated that Ventilagolin inhibits HCC tumor growth in vivo.

Figure 5

Ventilagolin suppresses tumor growth in vivo. (A) The length and width of the tumors were measured using a vernier caliper. The tumor volume was calculated and the tumor growth curves were plotted. (B) After 2 weeks of administration, the nude mice were killed and the tumor tissues were harvested. (C) The tumors were weighed. Data are expressed as mean ± SEM from three independent experiments. (D) Histopathological changes were examined by H&E staining. (E) Expression of Pim-1, E-cadherin, N-cadherin, and Vimentin in tumor tissues were detected by immunohistochemistry (bar=50 μm). The presence of yellow to brown granules in the nucleus or cytoplasm was considered positive staining for target proteins. A chi-square test was used to compare the immunohistochemical scores between the groups. * and ** respectively indicate significant difference at P < 0.05 and P < 0.01 as compared to the control group.

Table 2

The Expression of Pim-1, E-Cadherin, N-Cadherin, Vimentin in Tumor Tissues in Different Groups

Protein	Expression	No. of cases	Control(a)	Ventilagolin 6 mg/Kg(b)	Ventilagolin 12 mg/Kg(c)	P-value (a vs b)	P-value (a vs c)
Pim-1	High	5	5 (100%)	2 (40%)	1 (20%)	0.038434	0.009823
	Low		0 (0%)	3 (60%)	4 (80%)
E-cadherin	High	5	1(20%)	4 (80%)	5 (100%)	0.05778	0.009823
	Low		4 (80%)	1 (20%)	0 (0%)
N-cadherin	High	5	5 (100%)	2 (40%)	1 (20%)	0.038434	0.009823
	Low		0 (0%)	3 (60%)	4 (80%)
Vimentin	High	5	4 (80%)	3 (60%)	0 (0%)	0.490153	0.009823
	Low		1 (20%)	2 (40%)	5 (100%)

Notes: (a) control group; (b) low-dose Ventilagolin (6 mg/Kg) group; (c) high-dose Ventilagolin (12 mg/Kg) group.

Discussion

Given the pivotal role of EMT in malignant progression, invasion, metastasis, and resistance to treatment, a number of compounds targeting molecules and signaling pathways associated with EMT are investigated and have entered clinical trials.5 Natural products are important sources of new anticancer drugs.22,23 Over the last few years, due to lower toxicity as compared to conventional drugs, phytochemicals, including phenylpropanoids, isoprenoids, alkaloids, and other natural components (eg, quinones, carotenoids, and indole derivatives), have drawn increasing attention due to their role in regulation of EMT-related gene expression.24,25 In the family of quinones, 1.4-naphthoquinones are the most important, as their derivatives exhibit a wide variety of biological properties,26 and some of them (eg, shikonin, plumbagin) have been found to act against invasion and metastasis in a variety of cancers, such as leukemia, breast, colon and lung cancers.27

In this study, we demonstrated the effects of a natural 1.4-naphthoquinone derivative Ventilagolin on migration, invasion and EMT of human HCC and determined the possible underlying mechanism. We showed that Ventilagolin inhibited the proliferation of HepG2 and SMMC-7721 cells and suppressed HCC tumor growth of nude mice in a dose-dependent manner. Furthermore, Ventilagolin inhibited the migration and invasion activities of HCC cell lines. High levels of mesenchymal markers and downregulation of epithelial markers have been shown to primarily reflect EMT formation.5 In the present study, we found Ventilagolin reduced the levels of mesenchymal markers Vimentin and N-cadherin, and increased the expression of epithelial marker E-cadherin in vitro and in vivo. These results revealed that Ventilagolin inhibits cell proliferation, migration and invasion of HCC.

Recently, several studies have reported that Pim-1 is aberrantly expressed and has diverse biological functions in various different malignant tumors depending on the tumor type and underlying signaling pathways. In HCC, breast cancer, mesothelioma and glioblastoma, increased Pim-1 expression is found to be positively correlated with tumor progression, malignant transformation and poor prognosis.15,28 In other cancers, however, such as prostate, pancreatic and non-small-cell lung cancers, elevated Pim-1 levels tend to be associated with a good prognosis.14 As far as the tumor-promoting effect is concerned, several mechanisms are considered to be involved in Pim-1-induced EMT. Zhao et al15 demonstrated that Pim-1 exerts EMT-promoting effect through phosphorylation of Smad and c-Myc proteins and thereby activating transcription factors (ZEB1, ZEB2, Snail1, Snail2 and Twist) expression. Pim-1 may also facilitate tumor growth and invasion by reprogramming HCC metabolism and facilitating tumor cell glycolysis.29 Thus, Pim-1 is expected to become a potential therapeutic target for certain types of cancer. In our experiment, we showed that stable induction of Pim-1 effectively activated EMT through the downregulation of E-cadherin expression and upregulation of N-cadherin and Vimentin expression, suggesting Pim-1 promoted HCC cell migration and invasion in vitro. We further showed that Ventilagolin treatment downregulated the expression of Pim-1 and consequently attenuated the malignant behaviors (eg, migration, invasion and EMT) of HCC cells.

In this study, by using lentiviral transfection, we validated that Pim-1 overexpression promotes the proliferation, migration and invasion capacity of human HCC cells and EMT. Ventilagolin treatment significantly reduced the expression of Pim-1 and effectively reversed the malignant behavior of HCC cells. These results are consistent with previous studies suggesting that Pim-1 is a potential target for the treatment of HCC by Ventilagolin. There are evidences in the literature that several signal transduction pathways have been implicated in regulating the expression and activation of Pim-1. One such example is the epidermal growth factor receptor (EGFR) signaling pathway. Stimulation of EGFR with its ligands EGF or transforming growth factor α in squamocellular cancer (SCC) cells not only increased Pim-1 expression, but also promoted its nuclear translocation. These effects could be prevented by EGFR inhibitors.30 There is also a reciprocal regulation between Pim-1 and Janus kinase-signal transducer and activator of transcription (JAK-STAT). Pim-1 is one of the target genes of JAK-STAT signaling pathway, and STAT phosphorylation plays an important role in Pim-1 expression. A previous study showed that the stimulatory effect of interleukin-5 (IL-5) on the expression of Pim-1 was strongly suppressed by the inhibition of STAT-5 phosphorylation by JAK inhibitors. On the other hand, Pim-1 could also regulate JAK-STAT pathway through the suppressor of cytokine signaling (SOCS) proteins.31 Based on these previous studies, we preliminarily evaluated the changes of relevant genes expression in HCC cells upon Ventilagolin treatment; however, the underlying signaling pathways involved have not been fully clarified and need to be further explored and verified.

We constructed subcutaneous tumor model in nude mice and found that Ventilagolin effectively inhibited the growth of tumor mass. The results of immunohistochemistry showed that Ventilagolin significantly downregulated the expression of EMT markers N-cadherin and Vimentin, and upregulated E-cadherin expression. A number of literatures have shown that inhibition of EMT phenotype effectively represses tumor metastasis. Our current experimental results support this contention and suggest that Ventilagolin has anti-metastatic potential in HCC. Because the final observation time of our experiment was relatively short (2 weeks), we did not observe the phenomenon of tumor metastasis. Therefore, it remains to be concluded whether Ventilagolin affects the metastasis of HCC xenograft tumor in nude mice. In the follow-up work, we will consider using orthotopic HCC transplantation or intravenous injection of tumor cells for modeling to make an in-depth study on the issue of Ventilagolin against HCC metastasis.

This study has certain limitations that need to be addressed. First, the induction of EMT by Pim-1 may employ a variety of essential downstream transcription factors (Snail, Twist, Slug and Zeb).5 However, in this study, we did not address how these molecular markers were affected. Second, although our results suggest the importance of targeting Pim-1 in Ventilagolin-mediated metastasis inhibition, we cannot exclude the possibility of other signaling pathways that we have not yet analyzed. For example, NF-κB, WNT/β-catenin, JAK/STAT3, HIF-1α, FAK/Src and TGF-β1 pathways have been proposed in regulating EMT-associated gene expression in many phytochemicals.24 Also, long non-coding RNAs may also play an important role in EMT.32 Additional experiments are required to elucidate these issues.

In summary, our results clearly indicate that Ventilagolin inhibits HCC cell growth, migration and invasion, possibly through modulating of Pim-1 expression and EMT markers (E-cadherin, vimentin, N-cadherin), which are linked to the induction and progression of HCC.