| Literature DB >> 34869076 |
Antonio J Martín-Galiano1, Ernesto García2,3.
Abstract
Bacteriophages (phages) are viruses that infect bacteria. They are the most abundant biological entity on Earth (current estimates suggest there to be perhaps 1031 particles) and are found nearly everywhere. Temperate phages can integrate into the chromosome of their host, and prophages have been found in abundance in sequenced bacterial genomes. Prophages may modulate the virulence of their host in different ways, e.g., by the secretion of phage-encoded toxins or by mediating bacterial infectivity. Some 70% of Streptococcus pneumoniae (the pneumococcus)-a frequent cause of otitis media, pneumonia, bacteremia and meningitis-isolates harbor one or more prophages. In the present study, over 4000 S. pneumoniae genomes were examined for the presence of prophages, and nearly 90% were found to contain at least one prophage, either defective (47%) or present in full (43%). More than 7000 complete putative integrases, either of the tyrosine (6243) or serine (957) families, and 1210 full-sized endolysins (among them 1180 enzymes corresponding to 318 amino acid-long N-acetylmuramoyl-L-alanine amidases [LytAPPH]) were found. Based on their integration site, 26 different pneumococcal prophage groups were documented. Prophages coding for tRNAs, putative virulence factors and different methyltransferases were also detected. The members of one group of diverse prophages (PPH090) were found to integrate into the 3' end of the host lytASpn gene encoding the major S. pneumoniae autolysin without disrupting it. The great similarity of the lytASpn and lytA PPH genes (85-92% identity) allowed them to recombine, via an apparent integrase-independent mechanism, to produce different DNA rearrangements within the pneumococcal chromosome. This study provides a complete dataset that can be used to further analyze pneumococcal prophages, their evolutionary relationships, and their role in the pathogenesis of pneumococcal disease.Entities:
Keywords: Streptococcus pneumoniae; endolysin; genomic rearrangements; integrase; lytic enzymes; prophage; tRNAs; virulence factors
Mesh:
Substances:
Year: 2021 PMID: 34869076 PMCID: PMC8637289 DOI: 10.3389/fcimb.2021.775402
Source DB: PubMed Journal: Front Cell Infect Microbiol ISSN: 2235-2988 Impact factor: 5.293
Number and distribution of integrases and endolysins in the pneumococcal prophages (PPHs) analyzed.
| PPH group | Integrases | Endolysins | |||||||
|---|---|---|---|---|---|---|---|---|---|
| No. | Alleles (No.) | Size (aa) | Identity (%) | Incomplete | No. | Alleles (No.) | Size (aa) | Incomplete | |
| 005 | 1090 (21) | 34 | 388 | >86.5 | 196 | ||||
| 010 | 938 (35) | 35 | 382 | >95.8 | 21 | 286 | 86 | 318 | 102 |
| 015 | 486 (25) | 30 | 380 | >96.8 | 265 | 60 | 32 | 318 | 457 |
| 020 | 40 (4) | 3 | 388 | >58.6 | 0 | ||||
| 025 | 1 (1) | 1 | 388 | – | 0 | ||||
| 030 | 1151 (25) | 17 | 388 | >95.8 | 52 | ||||
| 035 | 1 (1) | 1 | 382 | – | 0 | 1 | 1 | 318 | 0 |
| 040 | 1 (1) | 1 | 375 | – | 0 | 1 | 1 | 318 | 0 |
| 045 | 674 (10) | 16 | 406 | >70.0 | 1 | ||||
| 050 | 1 (1) | 1 | 375 | – | 0 | 1 | 1 | 318 | 0 |
| 055 | 121 (3) | 6 | 388 | >98.9 | 4 | ||||
| 060 | 5 (2) | 2 | 405 | >99.5 | 0 | ||||
| 065 | 20 (3) | 3 | 380 | >99.4 | 0 | 22 | 1 | 314 | 0 |
| 070 | 170 (11) | 5 | 387 | >98.7 | 0 | ||||
| 075 | 1 (1) | 1 | 375 | – | 0 | 1 | 1 | 318 | 0 |
| 080 | 1376 (22) | 61 | 375 | >96.7 | 7 | 586 | 165 | 318 | 180 |
| 1 | 1 | 288 | 0 | ||||||
| 085 | 70 (3) | 8 | 475 | >99.1 | 0 | 10 | 9 | 318 | 13 |
| 090 | 34 (5) | 18 | 375−481 | >17.3 | 2 | 6 | 5 | 318 | 4 |
| 095 | 4 (1) | 1 | 388 | – | 0 | ||||
| 100 | 885 (5) | 56 | 481 | >94.3 | 1 | 220 | 71 | 318 | 131 |
| 105 | 6 (1) | 4 | 381 | >95.7 | 0 | 6 | 4 | 334 | 0 |
| 110 | 47 (1) | 3 | 388 | >99.4 | 0 | ||||
| 115 | 109 (4) | 7 | 388 | >98.1 | 1 | ||||
| 120 | 1 (1) | 1 | 479 | – | 0 | 1 | 1 | 328 | 0 |
| 125 | 1 (1) | 1 | 475 | – | 0 | 7 | 5 | 318 | 0 |
| 130 | 1 (1) | 1 | 382 | – | 0 | 1 | 1 | 318 | 0 |
| (316) | (385) | ||||||||
| Total | 7234 (189) | 293 | 548 | 1210 | 362 | 887 | |||
Figures in parentheses correspond to the number of integrases found in 100 complete genomes (176) and 13 contigs of different isolates (13).
Alleles WP_001866856 and WP_033705527 are 99.7% identical.
Amino acid identity reached >89.1% when allele WP_050271463 was excluded from alignments.
Lysozyme (= muramidase; EC 3.2.1.17) of the Glyco_hydro_25 (PF01183) family instead of NAM-amidase.
Putative NAM-amidase, but with a cysteine, histidine-dependent amidohydrolase/peptidase (CHAP; PF05257) domain.
Putative NAM-amidase but with a divergent Amidase_2 domain.
Due to allele redundancy between different PPH groups, the actual number of Int alleles is 293 rather than 315.
Corresponds to different prophage-encoded endolysins (357 NAM-amidases plus 5 muramidases).
Active site residues of PPH tyrosine and serine recombinases .
| Name (amino acid residues) | Amino acid residue and position | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Tyrosine integrases | ||||||||||||||||
| λ Int (356) | R212 | D215 | K235 | H308 | R311 | H333 |
| |||||||||
| PPH005 (388) | R220 | E223 | K255 | H315 | R318 | H353 |
| |||||||||
| PPH010/PPH130 (382) | R212 | D215 | K252 | H327 | R330 | H353 |
| |||||||||
| PPH015 (380) | R218 | E221 | K255 | H324 | R327 | H350 |
| |||||||||
| PPH020 (388) | R223 | E226 | K258 | H330 | R333 | H356 |
| |||||||||
| PPH025 (388) | R220 | E223 | K255 | H327 | R330 | H353 |
| |||||||||
| PPH030 (388) | R223 | E226 | K258 | H330 | R333 | H356 |
| |||||||||
| PPH035 (382) | R220 | D223 | K252 | H327 | R330 | H353 |
| |||||||||
| PPH040/PPH075/PPH080 (375) | R211 | E214 | K247 | H320 | R323 | H346 |
| |||||||||
| PPH045 (406) | R234 | E237 | K269 | H349 | R352 | H375 |
| |||||||||
| PPH050 (375) | R211 | E214 | K247 | H320 | R323 | H346 |
| |||||||||
| PPH055/PPH095/PPH110 (388) | R220 | E223 | K255 | H327 | R330 | H353 |
| |||||||||
| PPH060 (405) | R234 | E237 | K269 | H349 | R352 | H375 |
| |||||||||
| PPH065 (380) | R217 | E219 | K249 | H326 | R329 | H352 |
| |||||||||
| PPH070 (387) | R222 | E235 | K257 | H329 | R332 | H355 |
| |||||||||
| PPH105 (381) | R208 | E211 | K246 | H323 | R326 | H349 |
| |||||||||
| PPH115 (388) | R220 | E223 | K255 | H327 | R330 | H353 |
| |||||||||
| Serine integrases | ||||||||||||||||
| TP901-1 Int (485) | Y8 | R10 |
| Q26 | V41 | D47 | R57 | P58 | D73 | V77 | D81 | R82 | L83 | R85 | G119 | E133 |
| PPH085 (475) | Y10 | R12 |
| Q28 | I43 | D49 | R59 | P60 | D75 | V79 | D83 | R84 | L85 | R87 | G121 | E135 |
| PPH100 (481) | Y10 | R12 |
| Q28 | V43 | D49 | R59 | P60 | D75 | V79 | D83 | R84 | L85 | R87 | G121 | E135 |
| PPH120 (479) | Y7 | R9 |
| Q25 | I40 | D46 | R56 | P57 | N72 | V76 | K80 | R81 | L82 | R84 | G118 | D132 |
| PPH125 (475) | Y10 | R12 |
| Q28 | I43 | D49 | R59 | P60 | D75 | V79 | D83 | R84 | L85 | R87 | G121 | E135 |
PPH090 integrases were not included.
The active site residues of the phage λ integrase (λ Int; Acc. No. P03700) have been previously described (Gibb et al., 2010). The catalytic nucleophile, Tyr342, is boldface. The accession numbers for the other tyrosine integrases studied here are: PPH005, WP_000704676; PPH010/PPH130, WP_000876735; PPH015, WP_000266841; PPH020, WP_033705527; PPH025, WP_000704686; PPH030, WP_000704664; PPH035, WP_000876736; PPH040/PPH075/PPH080, WP_000266847; PPH045, WP_000219075; PPH050, WP_061816163; PPH055/PPH095/PPH110, WP_000704678; PPH060, WP_001863308; PPH065, WP_000266851; PPH070, WP_001021836; PPH105, WP_054368747; and PPH115, WP_001866671.
The active site residues of the Lactococcus lactis phage TP901-1 integrase (TP901-1 Int; Acc. No. CAA59475) have been previously described (Yuan et al., 2008). The catalytic nucleophile, Ser12, is boldface. The accession numbers for the other serine integrases studied are: PPH085, WP_050199652; PPH100, WP_024478469; PPH120, WP_130892475; and PPH125, WP_023396450.
Sequence similarities among tyrosine and serine integrases of PPHs .
| Integrases | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PPH group | Tyrosine integrases | ||||||||||||||||
| 005 | (1) WP_000704676 | −7 | −26 | −145 | ≤−180 | −143 | −7 | −21 | −11 | −21 | ≤−180 | −7 | −14 | −122 | −55 | ≤−180 | |
| 010/130 | (2) WP_000876735 | −6 | −5 | −4 | −3 | ≤−180 | −3 | −6 | −3 | −4 | −10 | −4 | −2 | −12 | −5 | ||
| 015 | (3) WP_000266841 | −30 | −25 | −27 | −5 | −112 | −9 | −110 | −25 | −8 | −65 | −17 | −26 | −25 | |||
| 020 | (4) WP_033705527 | −146 | ≤−180 | −4 | −21 | −16 | −20 | −146 | −13 | −18 | −154 | −56 | −148 | ||||
| 025 | (5) WP_000704686 | −144 | −4 | −21 | −11 | −21 | ≤−180 | −6 | −14 | −123 | −57 | ≤−180 | |||||
| 030 | (6) WP_000704664 | −3 | −25 | −13 | −24 | −144 | −12 | −18 | −151 | −54 | −146 | ||||||
| 035 | (7) WP_000876736 | −2 | −6 | −2 | −4 | −10 | −4 | NS | −12 | −5 | |||||||
| 040/075/080 | (8) WP_000266847 | −12 | ≤−180 | −21 | −12 | −63 | −60 | −31 | −22 | ||||||||
| 045 | (9) WP_000219075 | −11 | −11 | ≤−180 | −9 | −20 | −24 | −10 | |||||||||
| 050 | (10) WP_061816163 | −21 | −12 | −61 | −19 | −31 | −22 | ||||||||||
| 055/095/110 | (11) WP_000704678 | −6 | −14 | −123 | −57 | ≤−180 | |||||||||||
| 060 | (12) WP_001863308 | −9 | −16 | −24 | −6 | ||||||||||||
| 065 | (13) WP_000266851 | −18 | −17 | −21 | |||||||||||||
| 070 | (14) WP_001021836 | −50 | −120 | ||||||||||||||
| 105 | (15) WP_054368747 | −56 | |||||||||||||||
| 115 | (16) WP_001866671 | ||||||||||||||||
| Serine integrases | |||||||||||||||||
| 085 | (1) WP_050199652 | ≤−170 | −146 | ≤−180 | |||||||||||||
| 100 | (2) WP_024478469 | −179 | −171 | ||||||||||||||
| 120 | (3) WP_130892475 | −148 | |||||||||||||||
| 125 | (4) WP_023396450 | ||||||||||||||||
Figures correspond to Log10 E values calculated by pairwise alignments. NS, not significant.
Localization of attB sites for S. pneumoniae temperate prophage integration.
| Prophage |
| Flanking locus tags (SPD_RS) (Product) |
|---|---|---|
| PPH005 | 2935 TTAGCACTTTATCCCTTTTTGTGTTA 2960 | 00015 (DUF951 family protein)/00020 (redox-regulated ATPase YchF) |
| PPH010 | 24016 CTTTTTCATAATAATCTCCCT 24036 | 00115 (adenylosuccinate synthase/00120 (nucleoside deaminase) |
| PPH015 | 24694 TTGTGTGCTCTTTTTTTCGTGC 24715 | 00125 (signal recognition particle sRNA small type) |
| PPH020 | 86374 TACAACAAAATGTTG | 00445 (30S ribosomal protein S4) |
| PPH025 | 163831 ATTCCTTTACAA 163842 | 00880 (response regulator transcription factor)/00885 (hypothetical protein) |
| PPH030 | 179128 ATTATACTACAAAATCGGCCTTTT 179151 | 00970 (magnesium transporter CorA family protein)/00975 (excinuclease ABC subunit UvrA) |
| PPH035 | 231378 | 01305 (GNAT family N-acetyltransferase)/01310 (type I toxin-antitoxin system Fst family toxin) |
| PPH040 | 267293 GGTCTTTTTACTTGCCG 267309 | 01460 (CPBP family intramembrane metalloprotease) |
| PPH045 | 273279 GTAAAGCATCACAATTTAGTAAACGT | 01495 (30S ribosomal protein S9) |
| PPH050 | 358211 AGTCAAGAACTATTT 358225 | 01935 (choline-binding protein CbpG; frameshifted) |
| PPH055 | 619559 CATATTATTTTGAAAT 619574 | 03210 (DUF3165 family protein)/03215 (lactococcin 972 family bacteriocin) |
| PPH060 | 693388 AACCAGATCTTAAGAAAGCTCGTAAAG 693414 | 03620 (hypothetical protein)/03630 (hypothetical protein) |
| PPH065 | 1006452 CTCTTAAAGACGCTGTTAAA | 05350 (HU family DNA-binding protein) |
| PPH070 | 1027141 TACAACCTTAAAAAA | 05425 (phosphopyruvate hydratase) |
| PPH075 | ATGCCGATGAATTATAA | Prophage located 3’ of SPD_RS06250 (cyclically-permuted mutarotase family protein) |
| PPH080 | 1415148 | 07415 (DNA-binding protein WhiA) |
| PPH085 | 1712415 TTCCTCCTACTTATCTATTCGTAG 1712438 | 09110 (single-stranded DNA-binding protein)/09115 (SDR family NAD(P)-dependent oxidoreductase) |
| PPH090 | 1729602 | 09250 ( |
| PPH095 | 1826920 CATTACGAAATATATT 1826935 | 09795 (transcription anti-terminator) |
| PPH100 | 1841058 ACCAACATCTCCACCAA 1841074 | 09885 ( |
| PPH105 | 1849319 TATGGTATAA 1849328 | 09920 (tRNA guanosine(34) transglycosylase Tgt)/09925 (DUF975 family protein) |
| PPH110 | 1901612 ATAA 1901615 | 10215 (methyltransferase domain-containing protein)/10225 (membrane protein) |
| PPH115 | 1911323 ACTTGAAATAAAGCGCATTTCTCTATA 1911349 | 10255 (sugar ABC transporter permease)/10265 (DUF1189 domain-containing protein) |
| PPH120 | 1933870 ATTCGTTTAAGTAATACCATAAACCTTTGTCTTTAACCCAACCAGTAGCCA 1933920 | 10405 (Choline-binding protein PcpA) |
| PPH125 | ATGTTATTTCTCTCGTTACAAATTACAACCTTAAAAAA | Prophage located 3’ of SPD_RS10665 (tRNA dihydrouridine synthase DusB). The predicted |
| PPH130 | Not known | Prophage located 5’ of SPD_RS10885 encoding a transposase. |
The coordinates correspond to those in the S. pneumoniae D39 genome (NC_008533.2). This strain was recently renamed ‘D39W’ (Sinha et al., 2019) and showed some differences to another cultivar of the same strain (D39V) (Slager et al., 2018). Termination codons (TAA) are bold and underlined.
This attB is located inside the ccnC gene (23,967−24,065) encoding a small non-coding csRNA (cia-dependent small RNA) named csRNA3 (Sinha et al., 2019). This gene is not annotated for the pneumococcal D39 genome. Two additional potential attB sequences are present in the S. pneumoniae D39 genome, i.e., between SPD_RS01305 and SPD_RS01310 (231,378–231,398) (see shadowed sequence in PPH035), and between SPD_RS01320 and SPD_RS01325 (233,750–233,770).
The shadowed sequence is identical to that of attB. The part of the sequence overlapping the 3’ end of the ccnB gene (231,331–231,427) coding for csRNA1 (Sinha et al., 2019), is underlined. This gene is not annotated for the pneumococcal D39 genome.
Another potential attB sequence (273,258-AACCAGgTCTTAAGAAAGCTCGTAAAG-273,284) is present in the S. pneumoniae D39 genome, i.e., inside the SPD_RS01495 gene, encoding the 30S ribosomal protein S9.
Identical sequences are present at many other positions.
Seven additional potential attB sequences are present in this gene.
Figure 1Sequence similarities between PPHs genomes. (A) Venn diagrams showing equivalent or very similar pneumococcal prophages. Two PPH genomes were considered ‘equivalent’ when they overlapped for ≥90% of their length and showed ≥90% sequence identity (shown on a white background). When two genomes overlapped between 80 and 89% of their length, and nucleotide identities were ≥90%, the corresponding PPHs were considered as ‘very similar’. They are shown on a gray background. (B). wGRR similarity heatmap depicting the amino acid identity shared between pairs of prophage sequences (either full-length or defective prophages). Different colors were applied to clusters showing distance thresholds > 4. For agglomerative hierarchical clustering, distances are shown in the X axis. The dendrogram and heatmap python tools of the scipy.cluster.hierarchy library were used to depict final agglomerative hierarchical clustering and heatmap plots, respectively. Green and pink arrows point to new clusters or singletons respectively. The correspondence between PPHs and the cluster organization of pneumococcal prophages previously reported (Brueggemann et al., 2017; Rezaei Javan et al., 2019) is indicated at the upper part of this panel. See for a proposed correlation between previously described pneumococcal prophages and PPH groups.
Figure 2A proposal for phage integration into the S. pneumoniae genome after the recombination of lytA and lytA PPH. (A) The circular phage genome (red) and the pneumococcal chromosome (dotted line) are shown. Genes are drawn as arrows indicating the direction of transcription. An ‘X’ indicates the recombination event. The pneumococcal genes plyA and dinF that flank the lytA gene are shown for reference (Morales et al., 2015). The asterisk (*) indicates that the phage and bacterial lytA genes were probably chimeric because they contain sequences of both phage and bacterial origin. (B) Novel genomic arrangement of this plyA—lytA island in the pneumococcal strain SMRU257. The location of a gene (AD529_RS01375) encoding a large protein (3628 aa residues; WP_142367134) is shown. For comparison, the corresponding DNA region of the control D39 strain is shown at the bottom.
Figure 3Organization of the DNA region located between the 3’ ends of the int and lytA* genes. Genes are not drawn to scale. Four prophages of the PPH090 family were examined. The intergenic region is longer in PPH090_4 (belonging to the serine Int family) than in the other PPHs with tyrosine Ints. The percentage nucleotide identities are indicated. The approximate positions of the attP core sequences are shown. Two of the prophages belong to the PPH015 group and the corresponding whole regions are 97.4% identical. Orange rectangles represent the 51 bp-long perfectly conserved sequence located immediately 3’ from lytA PPH and lytA*.
Figure 4Sequence signatures of lytA* and lytA PPH_090* alleles. (A) Bacterial and prophage lytA genes of strains harboring PPH090 group phages were aligned and the positions where the bacterial (on one side) and phage (on the other) genes diverged were marked. For simplicity, the highly polymorphic region characteristic of the lytA gene (positions 421–480) (Morales et al., 2010) was not included in the alignment. The nucleotide positions (taking 1 as the first nucleotide of the ATG initiation codon) should be read vertically. (B) Distribution of polymorphic sites in bacterial and prophage alleles according to the alignment shown in panel (A) The vertical arrow points to the data at the polymorphic position 951. The total length of the lytA gene is 957 bp.
Figure 5Schematic representation of several DNA rearrangements in the 3’ region of lytA*. Genes are represented as arrows indicating the direction of transcription and are numbered as those of the S. pneumoniae D39 strain (SPD_). Narrow open arrows indicate frameshifted open reading frames. The lytA gene (SPD_RS09250) is represented by a striped arrow. Panels (A–E) respectively show the rearrangements of genes located in the vicinity of SPD_RS00120 (coding for a nucleoside deaminase), SPD_RS00125 (ffs encoding the signal recognition particle sRNA), SPD_RS07415 (whiA), SPD_RS09110 (coding for a single-stranded DNA-binding protein), or within SPD_RS09885 (encoding ComGC, the major subunit of the competence pilus). Green and red arrows respectively indicate genes translocated or inverted with respect to their position in S. pneumoniae D39. In arrangement D2, an additional recombination event caused the inversion of several genes (indicated by hatched arrows). A gray square indicates the region located 3’ of lytA shown in detail in .
Figure 6Diagram of the region located immediately downstream of the termination codon of lytA* in 14 pneumococcal strains with differently rearranged genomes. The region corresponds to that indicated with a gray square in . DNA regions sharing ≥95% nucleotide identity are shown with the same color and shadowing. The type of arrangement (A to E) is indicated in parentheses to the right of the name of each strain. The different core attachment sites are shown as diamonds. The deep blue rectangles represent the conserved 51 bp-long sequence mentioned in the text. The red rectangles correspond to the reverse complement of positions 24037–24121 of the S. pneumoniae D39 genome (between SPD_RS00120 encoding a nucleoside deaminase and SPD_RS00115 coding for an adenylosuccinate synthase). The purple rectangle corresponds to positions 1,712,485–1,712,386 (between SPD_RS09110 and SPD_RS09115 in the D39 chromosome). For additional information see and . At the bottom, the nucleotide sequence surrounding the initiation codon of SPD_RS09110 in strains D39 and SMRU1319 (arrangement D2) is shown. The correct initiation codon is shown in red, bold font, and underlined. Another in-frame initiation codon is not underlined and apparently lacks a potential ribosome-binding site (RBS) (Acc. No. CRIC01000015). The predicted RBS of SPD_RS09110 is shown in pink lettering. The 14 bp-long repeat potentially responsible for a chromosomal inversion in strain SMRU1319 is inserted in a gray box. The att core sequence of PPH085 is underlined.