Mario Mauthe1, Nilima Dinesh Kumar1,2, Pauline Verlhac1, Nicole van de Beek1, Fulvio Reggiori1. 1. Department of Biomedical Sciences of Cells & Systems, Molecular Cell Biology Section, University Medical Center Groningen, University of Groningen, Groningen, Netherlands. 2. Department of Medical Microbiology and Infection Prevention, University Medical Center Groningen, University of Groningen, Groningen, Netherlands.
Abstract
ATG13 and FIP200 are two subunits of the ULK kinase complex, a key regulatory component of the autophagy machinery. We have previously found that the FIP200-ATG13 subcomplex controls picornavirus replication outside its role in the ULK kinase complex and autophagy. Here, we characterized HSBP1, a very small cytoplasmic coiled-coil protein, as a novel interactor of FIP200 and ATG13 that binds these two proteins via FIP200. HSBP1 is a novel pro-picornaviral host factor since its knockdown or knockout, inhibits the replication of various picornaviruses. The anti-picornaviral function of the FIP200-ATG13 subcomplex was abolished when HSBP1 was depleted, inferring that this subcomplex negatively regulates HSBP1's pro-picornaviral function during infections. HSBP1depletion also reduces the stability of ULK kinase complex subunits, resulting in an impairment in autophagy induction. Altogether, our data show that HSBP1 interaction with FIP200-ATG13-containing complexes is involved in the regulation of different cellular pathways.
ATG13 and FIP200 are two subunits of the ULK kinase complex, a key regulatory component of the autophagy machinery. We have previously found that the FIP200-ATG13 subcomplex controls picornavirus replication outside its role in the ULK kinase complex and autophagy. Here, we characterized HSBP1, a very small cytoplasmic coiled-coil protein, as a novel interactor of FIP200 and ATG13 that binds these two proteins via FIP200. HSBP1 is a novel pro-picornaviral host factor since its knockdown or knockout, inhibits the replication of various picornaviruses. The anti-picornaviral function of the FIP200-ATG13 subcomplex was abolished when HSBP1 was depleted, inferring that this subcomplex negatively regulates HSBP1's pro-picornaviral function during infections. HSBP1depletion also reduces the stability of ULK kinase complex subunits, resulting in an impairment in autophagy induction. Altogether, our data show that HSBP1 interaction with FIP200-ATG13-containing complexes is involved in the regulation of different cellular pathways.
Macroautophagy (hereafter referred to as autophagy) is a cellular degradation pathway that is evolutionary conserved (Lahiri et al., 2019). This process is characterized by the selective or non-selective sequestration of cytoplasmic cargoes within double-membrane autophagosomes, which subsequently fuse with lysosomes to deliver their cargo into the hydrolytic interior of these organelles (Dikic and Elazar, 2018; Nakatogawa, 2020). Autophagy is active at basal levels in every eukaryotic cell and can be enhanced by stresses such as nutrient starvation and pathogen infection (Galluzzi et al., 2014; Deretic, 2021). Autophagosome biogenesis is orchestrated by the autophagy-related (ATG) proteins (Nakatogawa, 2020). Four of them, the kinase unc-51 like autophagy activating kinase (ULK) 1 (or ULK2), ATG13, RB1 inducible coiled-coil 1 (FIP200/RB1CC1) and ATG101, form the ULK kinase complex, which is a key regulator of autophagy induction (Licheva et al., 2021). Activation of the ULK kinase complex initiates a signaling cascade that leads to the formation of autophagosomes (Licheva et al., 2021).Numerous ATG proteins have other functions than the ones in autophagy (Bestebroer et al., 2013; Mauthe and Reggiori, 2016; Galluzzi and Green, 2019). In a previous study, we performed a siRNA-based screen to identify in an unbiased fashion the extent of the non-autophagic roles of the ATG proteins. In particular, we examined the impact of the depletion of each component of the ATG proteome on the replication of 6 viruses from 6 different virus families. With this approach, we also identified an anti-viral role of the subcomplex formed by ATG13 and FIP200, outside the context of the ULK kinase complex (Mauthe et al., 2016). This anti-viral role is specific for picornaviruses, a large virus family of non-enveloped, small (~30 nm in diameter) viruses with a positive-stranded RNA genome, which cause diseases in humans and animals (Mauthe et al., 2016). Picornaviruses are classified into different genera based on a complex set of rules (ICTV taxonomy) (Zell et al., 2017). Examples of genera are enteroviruses, which include coxsackievirus B3 (CVB3) and enterovirus 71 (EV71), and cardioviruses, a member of which is the encephalomyocarditis virus (EMCV) (Zell et al., 2017).In this study, we have investigated heat shock factor binding protein 1 (HSBP1), a protein that we found binding to FIP200 and ATG13 (Mauthe et al., 2016), to gain additional insights into the anti-picornaviral function of the FIP200-ATG13 complex. HSBP1 is a small coiled-coil protein of 12 kDa that forms trimers (Liu et al., 2009). HSBP1 has been identified as a negative regulator of heat shock factor 1 (HSF1) (Satyal et al., 1998), the primary mediator of transcriptional responses to proteotoxic stresses (Vihervaara and Sistonen, 2014). Recently, it has also been shown that HSBP1 is crucial for the assembly of the Wiskott–Aldrich syndrome protein and SCAR homolog (WASH) complex (Visweshwaran et al., 2018), an actin-regulating complex that is recruited to endosomes by interaction with the retromer complex, that plays a role in endosomal protein sorting (Seaman et al., 2013). Here, we identified two new functions of HSBP1. First, we found that HSBP1 is important for the stability of ULK kinase complex subunits and therefore for autophagy initiation as well. Second, HSBP1 is a pro-picornaviral host factor that dissociates from the cytoplasmic FIP200-ATG13 subcomplex and translocates into the nucleus after picornavirus infection. We also provide evidence that the pro-picornaviral role of HSBP1 could be negatively controlled by the FIP200-ATG13 subcomplex, which thereby acts as an anti-picornaviral factor.
Material and Methods
Antibodies and Reagents
The following primary antibodies were used: rabbit anti-LC3 (Novus Biologicals, Littleton, CO), mouse anti-LC3 (Nanotools, Teningen, Germany), mouse anti-p62 (Abcam, Cambridge, UK), mouse anti-tubulin (Sigma-Aldrich, St. Louis, MO), rabbit anti-ATG13 (Sigma-Aldrich), mouse anti-HSBP1 (Sigma-Aldrich, clone 2C3), rabbit anti-ATG16L1 (MBL, Woburn, MA), mouse anti-actin (Merck, Darmstadt, Germany), mouse anti-GFP (Clontech, Shiga, Japan), rabbit anti-ULK1 (Santa Cruz, Dallas, TX), rabbit anti-FIP200 (Bethyl Laboratories, Montgomery, TX), mouse anti-enterovirus (DAKO, Glostrup, Denmark), mouse anti-dsRNA (English & Scientific Consulting Bt., Budapest, Hungary), rabbit anti-capsid (EMCV, a kind gift from Ann Palmenberg, University of Wisconsin, Madison, WI), mouse anti-VP1 (EMCV, a kind gift from Hanchun Yang, China Agricultural University, Beijing, China), mouse anti-4G2 (Dengue virus (DENV) and Zika virus (ZIKV), Merk Millipore, Billerica, MA) and rabbit anti-E1 (Chikungunya virus (CHIKV), from Jolanda Smit, University Medical Center Groningen, The Netherlands), mouse anti-NP (influenza A virus (IAV), BioRad, Hercules, CA). The secondary antibodies were from Thermo Fisher Scientific (Waltham, MA) and were AlexaFluor488-conjugated goat anti-mouse or chicken anti-rabbit; AlexaFluor568-conjugated goat anti-mouse or donkey anti-rabbit; AlexaFluor680-conjugated goat anti-mouse or goat anti-rabbit; and AlexaFluor800-conjugated goat anti-mouse secondary antibodies were used for the visualization of the primary antibodies, and they were all from Thermo Fisher Scientific (Waltham, MA). Hoechst33342 was from Sigma Aldrich while bafilomycin A1 (BafA1) was from BioAustralis (Smithfield NSW, Australia).To induce autophagy, cells were washed two times with Earle’s balanced salt solution (EBSS, Sigma-Aldrich) and then incubated in the same medium for 2 h.
Virus Stocks and Infection
Virus stocks of EMCV, EMCV-Zn, Rluc-EMCV, CVB3, RLuc-CVB3, EV71 (kind gifts from Frank van Kuppeveld, University of Utrecht, Netherlands), A/Puerto Rico/8/1934 (H1N1) IAV (kind gift from Anke Huckriede, University Medical Center Groningen, The Netherlands), DENV-2 strain 16681, ZIKV (clinical isolate from Surinam) and CHIKV (La Reunion OPY1) (all a kind gift from Jolanda Smit, University Medical Center Groningen, The Netherlands) were generated and propagated as described previously (Mauthe et al., 2016; Bhide et al., 2019; Diosa-Toro et al., 2019; Troost et al., 2020).Virus infections for EMCV, EMCV-Zn wt, Rluc-EMCV, CVB3, RLuc-CVB3 were performed at a multiplicity of infection (moi) of 0.25 (or 1 for the co-immunoprecipitation experiments) and virus inoculums were left onto the cells for 6 h. For DENV, CHIKV, ZIKV and IAV, cells were infected at a moi of 0.8 for 26 h, at a moi of 10 for 10 h, at a moi of 0.8 for 26 h and at a moi of 0.5 for 6 h, respectively.
Cloning
GFP-HSBP1 was generated by cloning HSBP1 cDNA (Source BioScience, Nottingham, UK, cat# IRQMp5018C039D) into the pEGFP-C1 vector as EcoRI/SacII fragment. Construct correctness was confirmed by DNA sequencing and protein expression by western blot (WB).
Cell Lines and Cell Culture
U2OS (a kind gift from Ger Strous), HeLa (a kind gift from Peter van der Sluijs), U2OS cells stably expressing either GFP (GFP U2OS) or GFP-HSBP1 (GFP-HSBP1 U2OS), hsbp1 U2OS (HSBP1KO), atg7 U2OS (ATG7KO) (Janssen et al., 2018), atg13 U2OS (ATG13KO) cells and HeLa RFP-GFP-LC3 cells (a kind gift of Tamotsu Yoshimori) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Life Technology, Carlsbad, CA) supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin and 10% fetal calf serum (FCS), at 37°C in 5% CO2 humidified atmosphere. The culture medium of HeLa RFP-GFP-LC3, GFP U2OS and GFP-HSBP1 U2OS was supplemented with 0.6 µg/ml G418 (Thermo Fisher Scientific). The HSBP1KO and ATG13KO cells were generated as previously described (Janssen et al., 2018). In brief, for the generation of HSBP1KO and ATG13KO cells using the CRISPR/Cas9 system, guides targeting exon 1 (CGTCCCTTACCACCGAGGTGAGG) and exon 2 (GGATATTTCTCCCAATGATCTGG) of HSBP1 and exon 3 (TTTGCTTCATGTGTAACCTCTGG and AGTCGGGAGGTCCATGTGTGTGG) of ATG13, respectively, were designed using optimized CRISPR design (http://crispr.mit.edu/). Guides were cloned into pX458 plasmid (Addgene #48138) allowing expression of guide RNAs and Cas9 along with GFP. U2OS cells were transfected for 48 h and subsequently clonally sorted based on GFP expression using a SH800S Cell Sorter (Sony biotechnology, San Jose, CA). Clones were then sequenced and protein expression was assessed by WB to verify the deletion of HSBP1 and ATG13. Characterization of the ATG13KO cells can be found in
.To generate stable GFP or GFP-HSBP1 U2OS cells, U2OS cells were transfected with the pEGFP or the pEGFP-HSBP1 plasmid, respectively and then selected in a medium containing 0.6 µg/ml G418 for 10 days, resulting in a stable GFP U2OS or GFP-HSBP1 U2OS bulk population.
Co-Immunoprecipitations
U2OS cells either stably or transiently expressing EGFP and EGFP-HSBP1 and grown in a 10 cm dish, were treated with EBSS for 2 h, EMCV infected for 6 h or left untreated before being subjected to lysis on ice in the following buffer: 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 5 mM DTT, 0.5% Tween, Complete protease inhibitor (Roche, Basel, Switzerland), 1 mM PMSF. Co-immunoprecipitations were performed using the GFP‐trap beads (Chromotek, Planegg, Germany). Beads were incubated with the lysates for 2 h at 4°C and washed with the washing buffer (20 mM Tris-HCl, pH 7.4, 250 mM NaCl, 2 mM MgCl2, 5 mM DTT, 0.5% Tween-20). Proteins were eluted by boiling the beats in Laemmli loading buffer (65.8 mM Tris-HCl, pH 6.8, 26.3% glycerol, 2.1% SDS, 0.01% bromophenol blue) (Laemmli, 1970) and then examined by WB.
Western-Blot Analyses
Cells grown in 6-well or 24-well plates were washed with PBS and harvested in 100 µl of lysis buffer (20 mM Tris-HCl, pH 7.6, 130 mM NaCl, 1% Triton-X100, Complete protease inhibitor). The lysates were incubated on ice for 30 min, vortexed and centrifuged at 14,000 g for 10 min at 4°C. Supernatants were finally collected and mixed with the Laemmli loading buffer. Alternatively, cells were directly lysed in the Laemmli loading buffer and sonicated for 1 min. Equal protein amounts were separated by SDS-PAGE and after WB, proteins were detected on PDVF membranes (Merck) using specific antibodies and the Odyssey Imaging System (LI-COR Biosciences, Lincoln, NE). Densitometric values of the bands were quantified on WB images at non-saturating exposures using the ImageJ software (Schneider et al., 2012), and normalized against the loading control. For the detection of the small HSBP1 protein, we followed an optimized protocol previously described (Visweshwaran et al., 2018). In brief, after running, the gels were put into a renaturation buffer (20% glycerol, 50 mM Tris–HCl, pH 7.4) for 30 min at room temperature and after transfer, PVDF membranes were incubated in PBS containing 0.4% paraformaldehyde for 30 min to cross-link the proteins before proceeding with the detection.
Immunofluorescence Microscopy
Cells were fixed with 3.7% paraformaldehyde or 100% methanol, washed and blocked with blocking buffer (PBS, 1% bovine serum albumin, 0.1% saponin). Primary and secondary antibodies were diluted in the blocking buffer and incubated for 1 h at room temperature. Nuclei were stained with Hoechst33342 during the incubation with the secondary antibody for automated image acquisition. Alternatively, nuclei were stained with DAPI (Thermo Fisher Scientific) for confocal microscopy. Fluorescent microscopy images were collected with a DeltaVision RT fluorescence microscope (Applied Precision, Issaquah, WA) equipped with a CoolSNAP HQ camera (Photometrix, Kew, Australia). Images were generated by collecting a stack of 6 to 16 images with focal planes 0.30 μm apart, and subsequently deconvolved using the SoftWoRx software (Applied Precision). Quantification of puncta number was performed using the Icy software (http://icy.bioimageanalysis.org) using spot detector plugin or the ImageJ software. For automatic acquisition, fluorescence images were automatically acquired using a TissueFAXS (TissueGnostics, Vienna, Austria), which is based on a high-end fully motorized Zeiss AxioObserver Z1 microscope with a Zeiss- LD “Plan-Neofluar” 20x/0,4 Corr Dry objective (Zeiss, Oberkochen, Germany). The following filters were used: DAPI for the imaging of the nuclei, GFP for the acquisition of the GFP-HSBP1 and LC3 signals, and TexasRed for the imaging of the p62, EMCV and CVB3 capsid signal. The GFP and TexasRed filter were used for the GFP-RFP-LC3 tandem analysis. The acquired images were analyzed using the TissueQuest fluorescence analysis software (TissueGnostics GmbH, Vienna, Austria) to determine the cell count (based on the nuclei staining), the percentage of infected cells (based on the signal intensity in the cells), the mean signal intensity of infected cells and the translocation of GFP-HSBP1 into the nucleus (based on the signal intensities of GFP in the cytosol versus the nucleus). LC3 and p62 puncta were automatically quantified using the icy bioimage analysis software (De Chaumont et al., 2012).
siRNA and DNA Transfections
U2OS cells were transfected for 48 h with 20 nM of either control siRNA or siRNA targeting HSBP1 (SMARTpool from Dharmacon, Lafayette, CO) using 0.1 µl, 0.5 µl or 2 µl of Lipofectamine RNAiMAX (Thermo Fisher Scientific) for 96-, 24- or 6-wells plate cultures, respectively, according to the manufacturer’s protocol. For the GFP and GFP-HSBP1 transfection, U2OS cells were seeded in 10 cm dishes (for co-immunoprecipitation, Co-IP) or in 6-well plates (for making stable cell lines), followed by a transfection procedure with Fugene (Promega, Madison, WI), according to the manufacturer’s protocol.
Luciferase Assays
Cells grown in 96-well plates were washed with PBS and incubated with 50 µl of Lysis buffer (Thermo Fisher Scientific) at room temperature for 15 min, before storing the cell lysates at -20°C. 25 µl aliquots of thawed cell lysates were then used to measure renilla luciferase expression using the Renilla luciferase flash assay kit (Thermo Fisher Scientific). Alternatively, renilla luciferase activity was measured in the following reaction buffer: 45 mM EDTA, 30 mM sodium pyrophosphate, 1.425 M NaCl, 10 µM coelenterazine h (Promega) (Baker and Boyce, 2014).Enzymatic activities were measured using a GloMax®-Multi Detection System (Promega) and the following program: 25 µl substrate; 2 s delay; 10 s measuring. Background luminescence was subtracted from each value and the results were normalized towards cells transfected with control siRNA.
RNA Isolation and RT-qPCR and RNA Sequencing
The Power SYBR® Green Cells-to-CT™” kit (Thermo Fisher Scientific) was used according to manufacturer’s protocol to isolate RNA, reverse transcribe it and synthesize cDNA. Quantitative PCR was performed in a CFX connect Thermocycler (Bio-Rad, Hercules, CA) using the following specific primers (Mauthe et al., 2016): HSBP1 (TATCGCGGACCTCATGACAC and TAGCAACCTTCAACTCTTTTGCG), ULK1 (TGGGCAAGTTCGAGTTCTCC and CTCCAAATCGTGCTTCTCGC), ULK2 (TGGAGACCTCGCAGATTATTTGC and ACACTCTGATCGTGTCTTCACT), ATG101 (TCCTCCAGCTTCCGAGTCCA and CCACGTAACCAGGGAGGAAC), FIP200 (CTCAAACCAGGTGAGGGTGCTTCA and TGTTTTGTGCCTTTTTGGCTTGACA), ATG13 (TCCAGACAGTTCGTGTTGGG and CTCAAATTGCCTGGTAGACATGA), GAPDH (GGGAACGCATTGACTGTTTT and CTCGGGCTTCTCAAAGTCAC).The mRNA expression levels were first normalized against the expression of GAPDH, before comparing gene expression levels in HSPB1-depleted cells with those in the control cells.
Statistical Analyses
Statistical significance was evaluated using two-tailed heteroscedastic t-testing before calculating the p-values. Individual data points from each independent experiment (the number of the independent experiments is indicated in each figure legend) were used to determine significances.
Results
HSBP1 Interacts With the ULK Kinase Complex Through FIP200
We have found previously that FIP200 and ATG13 restrict picornavirus replication independently of their roles as components of the ULK kinase complex (Mauthe et al., 2016). We furthermore identified two potential binding partners that were shared by ATG13 and FIP200, i.e., HSBP1 and cell cycle progression 1 (CCPG1) (Mauthe et al., 2016). Since CCPG1 has recently been characterized as an ER-phagy receptor (Smith et al., 2018), we focused our attention to HSBP1 because no connection to autophagy or virus replication has been previously reported. To verify that HSBP1 is indeed interacting with FIP200 and ATG13, we performed Co-IP experiments in U2OS cells ectopically expressing GFP-HSBP1 (GFP-HSBP1 U2OS cells) using the GFP-Trap® resin (
and
). We could confirm that GFP-HSBP1 specifically interacts with all the subunits of the tested ULK kinase complex, i.e. FIP200, ATG13 and ULK1 (
). Next, we explored how HSBP1 binds to the ULK kinase complex also with Co-IP experiments. When ATG13 was knocked down in GFP-HSBP1 U2OS cells, the interaction between HSBP1 and ULK1, but not with FIP200 was abolished (
). ULK1 knockdown did not influence the interaction of both FIP200 and ATG13 with HSBP1. In contrast, FIP200 depletion eliminated the binding between HSBP1 and ULK1 or ATG13 (
). Altogether, these Co-IP experiments revealed that HSBP1 binds to the ULK kinase complex via FIP200.
Figure 1
HSBP1 interacts with the ULK kinase complex. (A) GFP-HSBP1 U2OS cells were transfected with control siRNA (siCtr) or siRNAs against ATG13 (siATG13), ULK1 (siULK1) or FIP200 (siFIP200), lysed and subjected to co-immunoprecipitation using GFP‐trap beads 48 h after siRNA transfection. Input lysates and Co-IP were examined by WB using antibodies against ATG13, ULK1, FIP200 and tubulin. Tubulin served as the loading control. One representative blot is shown (n = 3). (B, C) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h and then maintained in the control medium (CM) or transferred into EBSS to induce autophagy, in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were then lysed and proteins examined by WB using anti-LC3 (B), anti-p62 (C) and anti-tubulin antibodies. Tubulin served as the loading control. LC3-II and p62 signals were normalized to tubulin (a.u., arbitrary units) and LC3-II/LC3-I ratios determined, and values are presented in the depicted graphs. Error bars represent the standard deviations (SDs) of 3 independent experiments. (D) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h and then transferred into EBSS medium for 2 h, before being processed for IF using anti-ATG13 antibodies. Representative images are shown and the number of ATG13-positive puncta per cells was quantified. Error bars represent SDs of 3 independent experiments. Scale bars: 10 µm. The statistical significances were calculated to the controls. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively and ns indicate not significant.
HSBP1 interacts with the ULK kinase complex. (A) GFP-HSBP1 U2OS cells were transfected with control siRNA (siCtr) or siRNAs against ATG13 (siATG13), ULK1 (siULK1) or FIP200 (siFIP200), lysed and subjected to co-immunoprecipitation using GFP‐trap beads 48 h after siRNA transfection. Input lysates and Co-IP were examined by WB using antibodies against ATG13, ULK1, FIP200 and tubulin. Tubulin served as the loading control. One representative blot is shown (n = 3). (B, C) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h and then maintained in the control medium (CM) or transferred into EBSS to induce autophagy, in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were then lysed and proteins examined by WB using anti-LC3 (B), anti-p62 (C) and anti-tubulin antibodies. Tubulin served as the loading control. LC3-II and p62 signals were normalized to tubulin (a.u., arbitrary units) and LC3-II/LC3-I ratios determined, and values are presented in the depicted graphs. Error bars represent the standard deviations (SDs) of 3 independent experiments. (D) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h and then transferred into EBSS medium for 2 h, before being processed for IF using anti-ATG13 antibodies. Representative images are shown and the number of ATG13-positive puncta per cells was quantified. Error bars represent SDs of 3 independent experiments. Scale bars: 10 µm. The statistical significances were calculated to the controls. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively and ns indicate not significant.
HSBP1 Is Required for Full Autophagy Induction
The ULK kinase complex is essential for autophagy initiation (Licheva et al., 2021). Therefore we tested whether HSBP1 depletion alters the autophagic response to nutrient deprivation (
,
and
,
). First, we performed a classical autophagic flux assay (Klionsky et al., 2021) in which we treated control and HSBP1-depleted cells (
,
) with EBSS for 2 h, to induce autophagy in the presence or absence of BafA1, a lysosomal inhibitor (
). As a readout, we measured the conversion of non-lipidated microtubule associated protein 1 light chain 3 (LC3/MAP1LC3)-I into lipidated, autophagosomal membrane-associated LC3-II (
) and the levels of sequestosome 1 (p62/SQSTM1) (
) by WB, and examined the RFP-GFP-LC3 fluorescent reporter by fluorescence microscopy (
), which are all assays that allow to assess autophagy induction and progression (Klionsky et al., 2021). The WB analyses revealed that BafA1 treatment increased the LC3-II and p62 levels in control and HSBP1-depleted cells to a similar extend (
). Moreover, the number of formed autolysosmes was also equal in these cells (
). Together, these data clearly show that autophagic progression is not blocked in the absence of HSBP1. Nonetheless, we detected a reduced autophagosome formation rate under starvation conditions, i.e., lower ratio of LC3-II/LC3-I, in HSBP1-depleted cells in comparison to the control (
). To confirm the reduced autophagosome formation rate, we treated control and HSBP1-depleted cells with EBSS for 2 h and quantified endogenous ATG13 puncta by immunofluorescence microscopy (IF), which represent autophagosome formation sites (Karanasios et al., 2013). Knockdown of HSBP1 caused a significant reduction in the number of ATG13 puncta per cell (
). We also generated a HSBP1 knockout cell line in U2OS cells, HSBP1KO (
,
), and repeated the autophagic flux assay to corroborate the effects that HSBP1 depletion had on autophagy (
and
). Analogously to the result observed in HSBP1-depleted cells, we detected an impairment in autophagosome formation reflected by a lower LC3-II/LC3-I ratio (
). We furthermore observed a significantly reduced number of p62 puncta per cell in HSBP1KO under control and starvation conditions (
), whereas LC3 puncta were reduced under some conditions, but not significantly (
). p62 forms discrete puncta when autophagy is induced and therefore measuring the amount of those is widely used as a read-out for autophagy induction (Orhon and Reggiori, 2017). Altogether, these results show that depletion of HSBP1, a novel interactor of the ULK kinase complex, impairs nutrient starvation-induced early autophagy events.
Figure 2
HSBP1 is required for full autophagy induction. (A) U2OS and HSBP1KO cells were maintained in CM or transferred into EBSS medium in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were subsequently lysed and WB performed using anti-LC3 and anti-tubulin antibodies. Tubulin served as the loading control. LC3-II WB signals were normalized to tubulin (a.u.) and LC3-II/LC3-I ratios determined. Error bars represent SDs of 3 independent experiments. (B) U2OS and HSBP1KO cells were kept in CM or transferred into EBSS medium in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were processed for IF using anti-p62 antibodies. Representative images are shown and the number of p62-positive puncta per cells was quantified. Scale bars: 10 µm. Error bars represent SDs of 3 independent experiments. (C) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h before to be lysed and carrying WB analyses with antibodies against HSBP1, ATG13, FIP200, ULK1, ATG16L1 and tubulin. Tubulin was used as the loading control. Signal intensities were normalized to tubulin (a.u.). Error bars represent SDs of 3 independent experiments. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively and ns indicate not significant.
HSBP1 is required for full autophagy induction. (A) U2OS and HSBP1KO cells were maintained in CM or transferred into EBSS medium in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were subsequently lysed and WB performed using anti-LC3 and anti-tubulin antibodies. Tubulin served as the loading control. LC3-II WB signals were normalized to tubulin (a.u.) and LC3-II/LC3-I ratios determined. Error bars represent SDs of 3 independent experiments. (B) U2OS and HSBP1KO cells were kept in CM or transferred into EBSS medium in the presence (+) or the absence (-) of 200 nM BafA1 for 2 h. Cells were processed for IF using anti-p62 antibodies. Representative images are shown and the number of p62-positive puncta per cells was quantified. Scale bars: 10 µm. Error bars represent SDs of 3 independent experiments. (C) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h before to be lysed and carrying WB analyses with antibodies against HSBP1, ATG13, FIP200, ULK1, ATG16L1 and tubulin. Tubulin was used as the loading control. Signal intensities were normalized to tubulin (a.u.). Error bars represent SDs of 3 independent experiments. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively and ns indicate not significant.Two scenario could explain the negative impact that HSBP1 knockdown has on the nutrient-induced autophagic response. The first is that HSBP1 is a positive regulator for the ULK kinase complex. The second is that HSBP1 could be important to stabilize this complex, a possibility evoked by the fact that HSBP1 has been shown to be crucial in the assembly and stabilization of the WASH complex (Visweshwaran et al., 2018). This second scenario was tested by knocking down HSBP1 and examine the levels of the ULK kinase complex subunits by WB. Indeed, HSBP1 depletion led to a significant decrease of ATG13, FIP200 and ULK1 levels (
). This effect was specific to these proteins since the expression levels of other ATG proteins, i.e. ATG16L1, was not influenced by HSBP1 knockdown. Since the decrease in protein expression was not due to a reduced mRNA expression (
), this result shows that HSBP1 is important to stabilize the ULK kinase complex.
HSBP1 Is a Novel Host Factor That Promotes EMCV and CVB3 Replication
Since HSBP1 binds to FIP200, we next examined whether HSBP1 also functions together with the ATG13-FIP200 subcomplex in controlling picornavirus infection. We repeated the Co-IP experiments using GFP-HSPB1 as a bait and measured the binding to ATG13 after either autophagy induction or EMCV infection (
). EMCV is a member of the picornavirus family that we have previously employed to characterize the anti-picornaviral role of the FIP200-ATG13 subcomplex (Mauthe et al., 2016). The binding of HSBP1 to ATG13 remained unchanged upon autophagy induction (
) showing that nutrient starvation and subsequent activation of the ULK kinase complex activity is not regulated through dynamic HSBP1 binding. In contrast, when the cells were exposed to EMCV, HSBP1 association with ATG13 was significantly reduced (
). This result and the fact that HSBP1 binds the ULK complex via FIP200 (
), suggests that HSBP1 is also involved and possibly regulates the ATG13-FIP200 subcomplex function in controlling the replication of EMCV and by extension, of other picornaviruses. To test whether HSBP1 influences EMCV replication, we infected control and HSBP1-depleted U2OS cells with a wild-type EMCV strain and quantified both viral capsid expression and the percentage of virus infected cells. In parallel, the same cells were also infected with a luciferase-expressing EMCV strain to assess virus replication by measuring luciferase activity (Mauthe et al., 2016). We found that HSBP1 knockdown reduced EMCV replication to 40-60% in comparison to control cells (
). We also infected the HSBP1KO cells and observed that EMCV replication was significantly reduced, confirming the results obtained with the siRNA (
). Conversely, GFP-HSBP1 overexpression led to an increase in EMCV replication, revealing that HSBP1 is a novel host factor that positively regulates EMCV propagation (
). Finally, we also tested CVB3 replication in HSBP1-depleted cells to determine whether what we observed is EMCV specific or not. Measurement of luciferase expression and quantification of virus-positive cells in HeLa and U2OS cells upon HSBP1 knockdown (
) and in HSBP1KO cells (
) revealed HSBP1 depletion also reduced CVB3 replication. These data established HSBP1 as a novel host factor that is required for optimal EMCV and CVB3 replication.
Figure 3
HSBP1 promotes EMCV and CVB3 replication. (A) U2OS cells were transfected with a plasmid carrying GFP or GFP-HSBP1 for 24 h and then kept in CM or were infected with EMCV for 6 h. Cells were then lysed and immunoprecipitated using GFP‐trap beads. Input lysates and Co-IP were examined by WB using antibodies against ATG13, GFP and EMCV VP1. Signal intensities were quantified and the of ATG13/GFP-HSBP1 ratios in the Co-IP were determined before to be normalized to that of the CM samples. Error bars represent SDs of 4 independent experiments. (B) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h before being infected with EMCV or a luciferase-expressing EMCV strain (left panel) for 6 h. EMCV replication was quantified by luciferase expression (left panel), EMCV VP1-positive cells by IF (middle panel) and EMCV VP1 levels by WB (right panel). Error bars represent SDs of 3 (WB, right panel) or 4 independent experiments (luciferase and IF, left and middle panels). (C) U2OS and HSBP1KO cells were transfected with a plasmid expressing either GFP-HSBP1 or GFP for 24 h before being infected with EMCV for 6 h. Cells were then lysed and WB membranes probed with anti-EMCV VP1 and anti-tubulin antibodies. Tubulin was used as the loading control. Signal intensities were quantified and normalized to tubulin. EMCV VP1 levels in U2OS and HSBP1KO cells expressing GFP are compared in the left panel. EMCV VP1 levels in U2OS or HSBP1KO cells carrying GFP-HSBP1 were expressed relative to those in the same cells but carrying GFP (right panel). Error bars represent SDs of 4 independent experiments. (D) U2OS or HeLa cells were transfected with either siCtr or siHSBP1 for 48 h, before being infected with CVB3 (right panel) or a luciferase-expressing CVB3 strain (left and middle panels) for 6 h. CVB3 replication in HeLa cells was measured by luciferase expression (left panel) and in U2OS cells by either assessing luciferase expression (middle panel) or the percentage of CVB3 VP1-positive cells (right panel). Error bars represent SDs of 3 (HeLa cells) or 4 (U2OS cells) independent experiments. The statistical significances were calculated to the controls. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively.
HSBP1 promotes EMCV and CVB3 replication. (A) U2OS cells were transfected with a plasmid carrying GFP or GFP-HSBP1 for 24 h and then kept in CM or were infected with EMCV for 6 h. Cells were then lysed and immunoprecipitated using GFP‐trap beads. Input lysates and Co-IP were examined by WB using antibodies against ATG13, GFP and EMCV VP1. Signal intensities were quantified and the of ATG13/GFP-HSBP1 ratios in the Co-IP were determined before to be normalized to that of the CM samples. Error bars represent SDs of 4 independent experiments. (B) U2OS cells were transfected with either siCtr or siHSBP1 for 48 h before being infected with EMCV or a luciferase-expressing EMCV strain (left panel) for 6 h. EMCV replication was quantified by luciferase expression (left panel), EMCV VP1-positive cells by IF (middle panel) and EMCV VP1 levels by WB (right panel). Error bars represent SDs of 3 (WB, right panel) or 4 independent experiments (luciferase and IF, left and middle panels). (C) U2OS and HSBP1KO cells were transfected with a plasmid expressing either GFP-HSBP1 or GFP for 24 h before being infected with EMCV for 6 h. Cells were then lysed and WB membranes probed with anti-EMCV VP1 and anti-tubulin antibodies. Tubulin was used as the loading control. Signal intensities were quantified and normalized to tubulin. EMCV VP1 levels in U2OS and HSBP1KO cells expressing GFP are compared in the left panel. EMCV VP1 levels in U2OS or HSBP1KO cells carrying GFP-HSBP1 were expressed relative to those in the same cells but carrying GFP (right panel). Error bars represent SDs of 4 independent experiments. (D) U2OS or HeLa cells were transfected with either siCtr or siHSBP1 for 48 h, before being infected with CVB3 (right panel) or a luciferase-expressing CVB3 strain (left and middle panels) for 6 h. CVB3 replication in HeLa cells was measured by luciferase expression (left panel) and in U2OS cells by either assessing luciferase expression (middle panel) or the percentage of CVB3 VP1-positive cells (right panel). Error bars represent SDs of 3 (HeLa cells) or 4 (U2OS cells) independent experiments. The statistical significances were calculated to the controls. The symbols *, ** and *** indicate significant differences of p < 0.05, p < 0.01 and p < 0.001, respectively.
EMCV Infection Triggers GFP-HSBP1 Translocation From Cytoplasm Into the Nucleus
Picornaviruses cause a so-called nucleocytoplasmic traffic disorder by modulating the nuclear pore complexes and thereby disrupting the regulated transport of material, i.e., proteins and mRNA, in and out of the nucleus (Lidsky et al., 2006; Lizcano-Perret and Michiels, 2021). Interestingly, we also observed a relocalization of GFP-HSBP1 from the cytoplasm into the nucleus upon EMCV infection by fluorescence microscopy (
). This redistribution was already seen at 3 h post-infection, in agreement with the notion that the nucleocytoplasmic traffic disorder is an early event during EMCV infection (Lidsky et al., 2006), while the capsid protein expression was only detected at 4-6 h post-infection when more than 90% of the infected cells showed nuclear GFP-HSBP1 (
). GFP-HSBP1 relocalization was strongly reduced when we inhibited virus replication by either treating cells with cycloheximide 1 h after exposure to EMCV or inoculating cells with inactivated EMCV, showing that HSBP1 redistribution is induced by an active EMCV infection (data not shown). Previous studies have demonstrated that EMCV-induced nucleocytoplasmic traffic disorder is caused by the viral Leader (L) protein, which alters the phosphorylation status and thereby the function of the nuclear pore complexes (Lidsky et al., 2006). We also found that GFP-HSBP1 translocation into the nucleus depends on L since infection with EMCV-Zn, an EMCV strain lacking L (Hato et al., 2007), did not lead to the same change (
). The mechanism underlying nucleocytoplasmic traffic disorders differs between members of the cardioviruses (Picornaviridae) like EMCV and members of the enteroviruses (Picornaviridae) such as CVB3 and EV71 (Lizcano-Perret and Michiels, 2021). Thus, we tested whether the relocalization of HSBP1 is specific to EMCV or also occurs upon infection with CVB3 and EV71. To this aim, we infected GFP-HSBP1 U2OS cells with EV71 and CVB3 before imaging them. Cell infection with these viruses also caused a relocalization of HSBP1 from the cytoplasm into the nucleus, i.e. more than 90% of infected cells displayed nuclear GFP-HSBP1 (
,
), showing that HSBP1 redistribution is triggered by all the tested picornaviruses. Although it remains unclear whether the presence of HSBP1 in the nucleus is beneficial for the virus or simply a consequence of the nucleocytoplasmic traffic disorder, it is clearly specific for picornaviruses since viruses from other families (e.g., IAV, ZIKV, DENV or CHIKV) or treatments triggering autophagy via endoplasmic reticulum stress, did not cause HSBP1 translocation into the nucleus (
, and data not shown).
Figure 4
HSBP1 counteracts the anti-picornaviral function of ATG13 and translocates to the nucleus upon infection. (A) GFP-HSBP1 U2OS cells were infected with EMCV for the indicated times before being fixed and immunostained with anti-EMCV VP1 antibodies. IF images were automatically acquired and analyzed using the TissueFAXS microscope and software. EMCV VP1 positive cells (EMCV+) and cells positive for GFP-HSBP1 signal in the nucleus (GFP+ nuclei) were quantified. Error bars represent SDs of 3 independent experiments. White asterisks highlight GFP-HSBP1 U2OS cells with signal in the nucleus. (B) U2OS, ATG13KO and ATG7KO cells were transfected with either siCtr or siHSBP1 for 48 h, before being infected with EMCV (left panel) or CVB3 (right panel) for 6 h. Cells were immunostained using antibodies against EMCV and CVB3 VP1 to identify the infected cells and determine the degree of infection. The mean signal intensities were quantified and error bars represent SDs of 3 independent experiments. (C) Schematic model for the functions of HSBP1 in autophagy and picornavirus replication. The statistical significances were calculated to the controls. The symbols * and ** indicate significant differences of p < 0.05 and p < 0.01, respectively and ns indicate not significant. If not indicated otherwise, statistical differences were calculated to the control (U2OS cells).
HSBP1 counteracts the anti-picornaviral function of ATG13 and translocates to the nucleus upon infection. (A) GFP-HSBP1 U2OS cells were infected with EMCV for the indicated times before being fixed and immunostained with anti-EMCV VP1 antibodies. IF images were automatically acquired and analyzed using the TissueFAXS microscope and software. EMCV VP1 positive cells (EMCV+) and cells positive for GFP-HSBP1 signal in the nucleus (GFP+ nuclei) were quantified. Error bars represent SDs of 3 independent experiments. White asterisks highlight GFP-HSBP1 U2OS cells with signal in the nucleus. (B) U2OS, ATG13KO and ATG7KO cells were transfected with either siCtr or siHSBP1 for 48 h, before being infected with EMCV (left panel) or CVB3 (right panel) for 6 h. Cells were immunostained using antibodies against EMCV and CVB3 VP1 to identify the infected cells and determine the degree of infection. The mean signal intensities were quantified and error bars represent SDs of 3 independent experiments. (C) Schematic model for the functions of HSBP1 in autophagy and picornavirus replication. The statistical significances were calculated to the controls. The symbols * and ** indicate significant differences of p < 0.05 and p < 0.01, respectively and ns indicate not significant. If not indicated otherwise, statistical differences were calculated to the control (U2OS cells).
The Anti-Picornaviral Effect of the FIP200-ATG13 Subcomplex Involves HSBP1
Replication of EMCV and other picornaviruses is enhanced when ATG13 and FIP200 are depleted (Mauthe et al., 2016). Since HSBP1 depletion has an opposite effect, we examined the functional relationship between these three proteins. To this aim, we infected wild type, ATG7KO (Janssen et al., 2018) and ATG13KO (
) cells after knocking down or not HSBP1, and then measured EMCV infection by IF (
). In agreement with previous results (Mauthe et al., 2016), EMCV replication was more efficient in the ATG13KO than in wild type and ATG7KO cells. Interestingly, HSBP1 depletion reduced EMCV infection also in ATG13KO cells, when compared to control siRNA treated cells (
). To confirm that this observation is not specific for EMCV infection, we repeated the same experiment using CVB3, obtaining an identical result (
). Collectively, these data show that the effect of HSBP1 on picornavirus replication is not mediated through its function in autophagy since HSBP1 depletion decreased viral replication in ATG7KO cells. Moreover, these results indicate that the anti-picornaviral function of the FIP200-ATG13 subcomplex is connected to HSBP1, since after the depletion of HSBP1 in ATG13KO cells (
), the effect caused by the loss of ATG13 and FIP200 is lost.
Discussion
Autophagy is an important cellular survival mechanism that keeps cellular homeostasis under several stress conditions (Lahiri et al., 2019). The ULK kinase complex is crucial for autophagy initiation, and its function is modulated through the interaction of its subunits with various binding partners, including SMCR8-C9orf72 complex subunit (SMCR8) (Yang et al., 2016), autophagy and beclin 1 regulator 1 (AMBRA1) (Nazio et al., 2013) and acidic lipids (Karanasios et al., 2013). Here, we identified a novel ULK kinase complex binding partner, HSBP1, which interacts with this complex via FIP200 (
). We have found that HSBP1 knockdown decreases the formation rate of autophagosomes but does not influence the overall autophagic flux. Since the depletion of HSBP1 caused a reduction in the levels of ULK kinase complex components, we suggest that HSBP1 could be involved in the assembly and/or stability of this complex in a similar manner as it has been shown for the WASH complex (Visweshwaran et al., 2018). However, the autophagy defect caused by HSBP1 depletion is much less severe than when an ULK kinase complex component is ablated, e.g. ATG13, since this causes a severe autophagic flux impairment (
). Thus, HSBP1 has more a regulatory role and it might be required to fine tune the activity of this complex under specific conditions. Alternatively, HSBP1 may act as a chaperone promoting the assembly of the ULK kinase complex.We have also found that HSBP1 knockdown reduces picornavirus replication, establishing HSBP1 as a novel host cell regulator of picornavirus infection. It has been shown that autophagy induction promotes picornavirus replication under some circumstances (Klein and Jackson, 2011; Huang and Yue, 2020), which could explain why HSBP1 depletion has a negative impact on picornavirus propagation. However, we detected a negative effect of HSBP1 depletion on EMCV replication also in autophagy deficient cells (
). This result shows that the proviral function of HSBP1 is autophagy independent. In fact, we found that HSBP1 suppresses the anti-viral function of the FIP200-ATG13 subcomplex that we have previously discovered (
). Thus, our data favors a possible model in which through binding HSBP1, the FIP200-ATG13 subcomplex inhibits the pro-picornaviral function of HSBP1. Upon picornaviral infection, HSBP1 dissociates from this complex and is released from the inhibitory action of FIP200-ATG13 subcomplex, fulfilling its proviral function. This would mean that the FIP200-ATG13 subcomplex carries out its anti-picornaviral function by preventing the pro-picornaviral function of HSBP1. This notion is corroborated by the observation that both the anti-picornaviral role of FIP200-ATG13 subcomplex is abolished when HSBP1 is depleted (
) and picornavirus replication is reduced under the same situation (
). This notion is further supported by the finding that HSBP1 overproduction enhances EMCV replication (
), possibly because the levels of FIP200-ATG13 subcomplex are insufficient to inhibit excess HSBP1. In line with this consideration, FIP200 overexpression reduces picornavirus replication (Mauthe et al., 2016), probably because the higher FIP200 levels can more effectively inhibiting HSBP1. Although this model can explain our data, we cannot exclude that HSBP1 functions in a step of the picornaviral life cycle that is epistatic to the one controlled by the FIP200-ATG13 subcomplex. For example, the disruption of the WASH complex by HSBP1 depletion (Visweshwaran et al., 2018) could negatively affect picornaviral cell entry. Consequently, HSBP1 could have even a dual role in this scenario, i.e., promoting cell entry through the stabilization of the WASH complex (or other yet uncharacterized functions of HSBP1) and counteracting the virus by stabilizing the FIP200-ATG13 subcomplex.The nuclear relocalization of HSBP1 observed in picornavirus-infected cells is not associated with a defect in the general protein shuttling between the cytoplasm and the nucleus because viruses such as DENV and ZIKV, which are known to target nuclear pore complexes (Wubben et al., 2020), did not trigger HSBP1 redistribution into the nucleus (
). An early report identified HSBP1 as a negative regulator of HSF1 and showed that it inhibits HSF1 function in the nucleus (Satyal et al., 1998). However, we have no indications of a possible functional connection between enhanced HSF1 activity and HSBP1 relocalization, since HSBP1 did not move to the nucleus upon ER stress caused by tunicamycin (data not shown), which is known to induce HSF1 activity (Liu and Chang, 2008). Additionally, HSF1 knockdown does not interfere with HSBP1 subcellular distribution (data not shown). Since HSBP1 has no apparent nuclear localization signals, we cannot exclude that the translocation into the nucleus is facilitated by a yet unknown binding partner. It also still remains to be determined whether HSBP1 fulfills its pro-picornaviral function within the nucleus or not.In conclusion, we identified two new functions of HSBP1, both mediated via its binding to FIP200. On the one hand, HSBP1 regulates the early steps of autophagy by stabilizing the ULK kinase complex, and on the other hand, it functions as a positive regulator for picornavirus replication independently of its function in autophagy. Future studies will be required to unveil how HSBP1 is exactly promoting in the picornavirus life cycle.
Data Availability Statement
The original contributions presented in the study are included in the article/
. Further inquiries can be directed to the corresponding author.
Author Contributions
MM and FR designed the study. MM, NB, PV, and ND performed experiments. MM and FR wrote the manuscript. All authors contributed to the article and approved the submitted version.
Funding
FR is supported by ZonMW TOP (91217002), Open Competition ENW-KLEIN (OCENW.KLEIN.118), and Marie Skłodowska Curie ETN (765912) grants. FR and ND are also supported by a Marie Skłodowska-Curie Cofund grant under the European Union’s Horizon 2020 Research and Innovation Programme PRONKJEWAIL (Grant Agreement No 713660).
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Authors: Sai P Visweshwaran; Peter A Thomason; Raphael Guerois; Sophie Vacher; Evgeny V Denisov; Lubov A Tashireva; Maria E Lomakina; Christine Lazennec-Schurdevin; Goran Lakisic; Sergio Lilla; Nicolas Molinie; Veronique Henriot; Yves Mechulam; Antonina Y Alexandrova; Nadezhda V Cherdyntseva; Ivan Bièche; Emmanuelle Schmitt; Robert H Insall; Alexis Gautreau Journal: EMBO J Date: 2018-05-29 Impact factor: 11.598
Authors: Mayra Diosa-Toro; Berit Troost; Denise van de Pol; Alexander Martin Heberle; Silvio Urcuqui-Inchima; Kathrin Thedieck; Jolanda M Smit Journal: Antiviral Res Date: 2018-11-22 Impact factor: 5.970
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391