Microglial-stimulation of glioma invasion involves the EGFR ligand amphiregulin.

High grade glioma is one of the deadliest human cancers with a median survival rate of only one year following diagnosis. The highly motile and invasive nature of high grade glioma makes it difficult to completely remove surgically. Therefore, increasing our knowledge of the mechanisms glioma cells use to invade normal brain is of critical importance in designing novel therapies. It was previously shown by our laboratory that tumor-associated microglia (TAMs) stimulate glioma cell invasion and this process is dependent on CSF-1R signaling. In this study, we seek to identify pro-invasive factors that are upregulated in microglia in a CSF-1R-dependent manner. We assayed cDNA and protein from microglia treated with conditioned media from the murine glioma cell line GL261, and discovered that several EGFR ligands including amphiregulin (AREG) are strongly upregulated. This upregulation is blocked by addition of a pharmacological CSF-1R inhibitor. Using RNA interference, we show that AREG-depleted microglia are less effective at promoting invasion of GL261 cells into Matrigel-coated invasion chambers. In addition, an AREG blocking antibody strongly attenuates the ability of THP-1 macrophages to activate human glioma cell line U87 invasion. Furthermore, we have identified a signaling pathway which involves CSF-1 signaling through ERK to upregulate AREG expression in microglia. Interfering with ERK using pharmacological inhibitors prevents AREG upregulation in microglia and microglia-stimulated GL261 invasion. These data highlight AREG as a key factor in produced by tumor associated microglia in promoting glioma invasion.

Introduction

High grade glioma is an aggressive human cancer for which there is almost no effective treatment. One of the major characteristics of gliomais that it is highly motile and invasive. Glioma tumors have diffuse borders and are almost impossible to completely resect by surgery [1-3]. Therefore, understanding the mechanism of glioma invasion is of critical importance to ultimately discover more targeted therapy. Our laboratory and others have shown that microglia (macrophages that reside in the brain) are able to significantly enhance glioma cell invasion [4-16]. We previously published that microglial-stimulation of glioma invasion was almost completely inhibited by pharmacological inhibition of the CSF-1 receptor (CSF-1R) [4]. That study showed that CSF-1 is expressed by GL261 glioma cells and the receptor CSF-1R is expressed by microglia, thus defining a paracrine interaction that takes place between glioma and microglia during invasion. It was found that by administering PLX-3397, a CSF-1R antagonist that can cross the blood brain barrier, the number of tumor-associated microglia was drastically reduced. In addition, tumors in animals treated with PLX-3397 exhibited substantially less invasion. For many sections of tumors in drug treated animals a clear border could be seen between the tumor and parenchyma.

EGFR is a receptor tyrosine kinase which is mutated or dysregulated in many cancers, especially glioma [17-21]. When active, EGFR transduces signals in the cell that stimulate proliferation, survival and motility [22-26]. The biology of EGFR is complex however, since in mammals, there are at least seven ligands that have been thus far identified which show the ability to bind and activate EGFR [27-30]. The situation is further complicated by the fact that the ligands themselves go through an extensive trafficking pattern in the cell which ultimately results in their release from the cell [31-34]. Ligands have been shown to function in an autocrine, paracrine and juxtacrine fashion [35-37]. Furthermore, evidence is accumulating that the ligands themselves can participate in “back” signaling [38-44]. Although each of the seven mammalian ligands use the EGFR, there is evidence for specific functions. For example Heparin Binding EGF (HB-EGF) is expressed in a subset of malignant gliomas and is required for tumor formation in a PTEN/INK4a-/- background mouse [45]. The ligand Betacellulin (BTC) was recently shown to drive glioma resistance to anti-STAT3 therapy [46].

The ligand amphiregulin (AREG) is one of seven ligands capable of binding and activating EGFR. AREG is synthesized as a 252 amino-acid precursor that is associated with the cell membrane. As with other EGFR ligands, AREG can be processed by proteases which results in release of the soluble “mature” ligand containing the EGF domain necessary for binding and triggering receptor dimerization. However, full length AREG associated with exosomes has been shown to promote invasion of breast carcinoma cells [47]. Interestingly, that study demonstrated that full length membrane-bound AREG deployed on exosomes stimulates breast carcinoma cell invasion to a greater extent than processed AREG or either form of other ligands. In addition to acting on EGFR expressed on tumor cells, AREG has recently been shown to promote differentiation of T cells into TREGs within the tumor microenvironment [48]. These observations suggest targeting AREG/EGFR in the tumor microenvironment may impact several compartments within the tumor microenvironment and could inhibit both tumor invasion and immunosuppression.

In the present study, we investigated the ability of glioma cell line conditioned media to stimulate expression of all known seven EGFR ligands in the mammalian genome. We focused our attention on the ligand Amphiregulin and its potential function in promoting glioma invasion.

Materials and methods

Cell culture and reagents

Murine microglia were derived from a spontaneously immortalized murine microglia cell cultures originally isolated from C57Bl/6J mice as previously described in Dobrenis et al. [49]. Briefly, primary microglia cultures were generated from high density mixed cell-type cultures of neonatal neocortex by differential adhesion methods producing highly purified (>99%) microglial populations as assessed by cell type specific markers including F4/80. To further maximize and ensure purity for experiments, the isolated cells were subcultured an additional 3 times with stringent selective adhesion on non-tissue culture-treated “suspension cell” plates (Sarstedt) to further limit non-microglial cells. All cultures were maintained in Macrophage Serum-Free Medium (M-SFM; Invitrogen Cat# 12065–074) with 10% fetal calf serum. Microglia were supplemented with 10 ng/ml recombinant mouse granulocyte macrophage-colony stimulating factor (GM-CSF; R&D systems Cat #415-ML-10). All cells were cultured in a humidified incubator containing 5% CO2 at 37 degrees. The cell lines used in this paper were GL261 murine glioma (obtained from NCI), U87 human glioma (ATCC), THP-1 human macrophage cell line (ATCC). Recombinant human CSF-1 was a gift from Chiron Corp. A CSF-1R receptor inhibitor, 4-Cyano-1H-pyrrole-2-carboxylic acid [4-(4-methyl-piperazin -1-yl)-2-(4-methyl-piperidin-1-yl)-phenyl]-amide provided by Johnson and Johnson Pharmaceutical Research and Development (referred to as JnJ [50, 51]) was used at 10 nM. Small interfering RNA (siRNA) si-GENOME duplexes targeting mouse amphiregulin were acquired from Dharmacon. Microglia were transfected using 2 ul of Dharmafect Reagent #1 with 20 nM siGENOME siRNA against murine amphiregulin (Dharmacon/Thermoscientific). Microglia were seeded 24 hours prior to transfection in a 6 well plate at 70% confluency. The siRNA and Dharmafect mixture was added to 1.6 mL of complete microglia growth media (MSFM with 10% FBS and 10ng/ml GMCSF) and added to the cells. Cells were incubated with transfection mix for 72 hours prior to experiment.

Intracranial injection of glioma cells and isolation of microglia

All procedures involving mice were conducted in accordance with the National Institutes of Health regulations concerning the use and care of experimental animals. The study of mice was approved by the Albert Einstein College of Medicine animal use committee. For intracranial injection, C57BL/6J mice (10–12 weeks old; Jackson) were anesthetized with isofluorane. A hole was made 1 mm lateral and 2 mm anterior from the intersection of the coronal and sagittal sutures (bregma). 2 X 10 ^4 GL261 cells were injected using a Hamilton syringe series 7000 at a depth of approximately 1 mm in a volume of 0.2 μl in the cortex. Typically two weeks intracranial growth of GL261 did not result in any overt stress or apparent discomfort to the mice. Two weeks following injection, animals were anesthetized with isoflourane and sacrificed by cervical dislocation followed bytumor associated microglia isolation using Miltenyi Micro MACS system with CD11b microbeads (Catalog# 130-049-601 Miltenyi Biotec).

Quantitative RT-PCR

Total RNA was isolated from cells in culture using according to manufacturer protocol of Mini RNeasy Kit (Qiagen). Total RNA was used as a template for cDNA synthesis prepared using Superscript II Reverse Transcriptase kit (Thermofisher). This material was subject to quantitative real time PCR using the following specific primer sets: EGF FWD: 5’-TTGTTAGCACCATCCCTCAT-3’, REV: 5’-CGGGAGAGTTCTTTGTCTCA-3’, AREG FWD:5’AACGGTGTGGAGAAAAATCC3’ AREG REV:5’TTGTCCTCAGCTAGGCAATG3’ EREG FWD:5’TTTCTTCGTCCTTTGTTTGC-3’ EREG REV:5’CATATGCCAGGAAAAAGGTG-3’

TGFA FWD: 5’CACTGGACTTCAGCCCTCTA-3’ TGFA REV:5’-TCCAGCAGACCAGAAAAGAC-3;BTC FWD: 5’-GTGTGGTAGCAGATGGGAAC-3’,BTC REV: 5’ATCTCCCATGGATGCAGTAA3’-3’ GAPDH FWD: 5’-CTGGAGAAACCTGCCAAGTA-3’, GAPDH REV: 5’TGTTGCTGTAGCCGTATTCA-3’. Primers for HBEGF and EPGN were obtained from Qiagen (Mouse HBEGF:#PPM05369D, Mouse EPGN: PPM32906F). Reactions were carried out using SYBR Green PCR Master Mix (Qiagen) and the ABI SuperArray PA-012 (SABiosciences, Frederick, MD, USA).

Invasion assays

Cell invasion assays were performed as previously described in [4, 52]. Briefly, GL261 and microglial (MG) cells were stained with cell tracker green (CMFDA) and with cell tracker red (CMTPX; Invitrogen) respectively and then cocultured on Matrigel-coated invasion chambers (Fisher Scientific #354480). For most assays, to maintain constant cell numbers, cells were plated at a density per invasion chamber of 100,000 labeled GL261 cells with an additional 100,000 unlabelled GL261 cells or with 50,000 unlabelled GL261 and 50,000 MG cells in M-SFM with 0.3% BSA (Sigma Aldrich #A9647). For measuring human glioma cell invasion, the human monocyte cell line THP-1 was differentiated with RPMI1 with 10% FBS and 100 nM phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich Cat# P8139) for 48 hours and cultured in media alone for another 48 hours. U87 glioma cells were stained with green Cell Tracker Dye CMFDA (Invitrogen; Cat# C2925) and cocultured on invasion chambers as described above using 75,000 cells with 25,000 differentiated THP1 cells in RPMI with 0.3% BSA. Invasion chambers were incubated for 48 hours, after which they were fixed in 3.7% paraformaldehyde in PBS. Imaging of the cells on the bottom of the filter was performed using a Leica SP5 Laser Confocal System. The extent of invasion was quantified by counting the number of fluorescent glioma cells that were on the underside of the filter in at least seven 20X fields.

Western blotting

Cell cultures of microglia starved overnight in M-SFM media (Invitrogen) 0.3% BSA and microglia stimulated with CSF-1 in the presence of various inhibitors were lysed directly into 1X sample buffer (2% SDS, 10% glycerol, 62.5 mM TRIS) containing beta mercaptoethanol (β-ME) and loaded onto 10% SDS PAGE gels. The proteins were resolved and transferred to a PVDF membrane and blotted using an anti-phospho CSF-1R Y723 (#3155; Cell Signaling Technology), or anti-phospho ERK antibody (#9101;Cell Signaling Technology), followed by secondary blot using anti-Rabbit conjugated to IR800 in Licor Blocking Buffer (Licor). For detecting EGF, blotting was carried out using anti-EGF (sc-1342; Santa Cruz) at a concentration of 1:100 followed by secondary anti-Goat conjugated to IR800 (Licor). For detecting CSF-1R, blotting was carried out using a rabbit antibody which recognizes the C-terminus of the CSF-1R (C-15;). Blots were scanned on the Odyssey system. Blots were stained with anti total ERK (#137F5; Cell Signaling Technology) and actin (A5441; Sigma-Aldrich) for loading control.

Results

Glioma induces AREG expression in microglia/macrophages

We have previously shown that microglia stimulate invasion of murine and human glioma cell lines and this is dependent on CSF-1R and EGFR signaling in a putative paracrine interaction [4]. We next wanted to measure the influence of glioma cells on the microglial expression of EGFR ligands. Our initial experimental approach was to treat microglia with conditioned media harvested from the murine glioma cell line, GL261 (referred to as GLCM). We then isolated RNA from microglia stimulated overnight and generated cDNA for quantitative PCR analysis. Primer sets specific for each of the seven EGFR ligands were used to measure the relative expression of EGF, HB-EGF, AREG (Amphiregulin), EREG (Epiregulin), TGF-A, BTC (Betacellulin) and EPN (Epigen). We detected a statistically significant induction in three of the seven EGFR ligands in microglia treated with GLCM: AREG, EREG and TGFA (Fig 1A). We measured the ability of glioma cells to stimulate AREG expression in microglia in coculture. Microglia were labelled with CMFDA green and cultured with GL261 cells for 24 hours followed by FACS sorting of microglia. When cocultured with GL261 cells, microglial expression of AREG is induced to a similar extent as what is observed with conditioned media (Fig 1B). We then assessed which of these ligands were induced in tumor associated microglia/macrophages (TAMs) in vivo. Two weeks after implantation, GL261 tumors were harvested from mice and the TAM population was isolated using magnetic sorting for CD11b positive cells. We harvested mRNA from CD11b positive (TAM) fraction and assessed the levels of AREG, EREG and TGFA as compared with freshly isolated naïve microglia from the brains of wild type C57 mice. Only AREG was induced in TAMs relative to wild type (naïve) microglia. In naïve microglia isolated from wild type C57BL/6 mice, AREG levels were undetectable by qPCR. However in CD11b+ cells isolated from GL261 tumors, we detected AREG with a mean dct value of 5.3 -/+ SEM of 3 in four independent experiments (four independent tumors). We were unable to detect EREG levels in naïve microglia and in TAMs. TGFa expression was not observed to increase in TAMs relative to naïve microglia. Having demonstrated that AREG expression is upregulated in TAMs in-vivo, we decided to focus our efforts on this EGFR ligand.

Fig 1

EGFR ligand gene expression induced in microglia by glioma cells.

(A) Conditioned media harvested from GL261 cells was used to treat microglia overnight. Quantitative RT PCR was performed using the primers indicated. Data shown are ^2 -delta delta ct relative to GDH control. *: P < .05. (B) GL261 cells were cocultured with microglia for 24 hours followed by cell sorting, RNA isolation and qRTPCR analysis using the AREG primers. Results are an average of 8 independent experiments *: P < 0.05.

AREG induction in microglia is dependent on CSF-1R

Since microglia stimulation of GL261 invasion is dependent on CSF-1R we reasoned that factors upregulated in microglia might be sensitive to CSF-1R inhibition. To test this, we treated microglia with GLCM in the presence of a CSF-1R inhibitor (JnJ). Blockade of CSF-1R strongly attenuated (but did not fully inhibit) the ability of GLCM to stimulate AREG mRNA expression in microglia (Fig 2A). Interestingly, we found that recombinant CSF-1 alone could not stimulate AREG mRNA in microglia to levels seen with GLCM (Fig 2B). These data demonstrate that CSF-1 is a necessary factor generated by GL261 to induce AREG expression in microglia, but it is insufficient on its own. The level of AREG protein was ascertained using SDS-PAGE of microglial protein extracts followed by western blotting with an anti-AREG antibody (Fig 2C). The pattern of AREG protein expression was consistent what was seen at the mRNA level. The species of AREG we detect by western blot in microglia is almost exclusively the full-length and presumably the membrane associated form.

Fig 2

Effect of CSF-1R inhibition on AREG induction in microglia.

(A) Conditioned media harvested from GL261 cells was used to treat microglia overnight in the absence or presence of 10 nM of CSF-1R inhibitor compound “JnJ” followed by RNA isolation, cDNA synthesis and qRTPCR analysis using the AREG primers. Results are an average of at least 3 independent experiments *: P < 0.05. (B) Microglia were treated with recombinant CSF-1 or GL261 conditioned media as described above followed by RNA isolation, cDNA synthesis and qRTPCR analysis using the AREG primers. Results are an average of at least 3 independent experiments *: P < 0.05. (C) SDS-PAGE analysis of AREG protein in microglia cell extracts treated with GL261 conditioned media in the absence or presence of 10 nM CSF-1R inhibitor (JnJ). Densitometry analysis carried out to evaluate level of AREG expression. Results are average of 3 independent experiments. *: P<0.05.

AREG is involved in microglia/macrophage stimulation of glioma invasion

Next, we wished to test the functional significance of AREG induction in microglia. Our first approach was to use RNA interference mediated depletion of AREG in microglia using both siRNA pools and individual oligos. The siRNA pool was able to knockdown AREG levels to under 50% that of control (Fig 3A). Microglia which were depleted of AREG were largely unable to stimulate GL261 invasion (Fig 3B). This was observed using individual oligos as well to similar effect (S1 Fig)

Fig 3

Effect of AREG depletion in microglia-stimulated GL261 invasion.

(A) Murine AREG siRNA pool used to deplete AREG from microglial cells shows at least 50% knockdown at the protein level as determined by western blotting. (B) Microglial cells treated with either control or AREG siRNA pool were cocultured with GL261 cells expressing mCherry on Matrigel-coated invasion chambers. After 48 hours, transwells were fixed in formaldehyde and imaged using confocal microscopy. Representative images are shown. Bottom left micrograph is magnified image of an invasive mCherry-expressing GL261 tumor cell. Arrows indicate fluorescently labeled glioma cells which have invaded to the other side of the filter. Scale bar = 200 um. Results shown are average of at least three experiments. *: P < 0.05.

We also examined the role of AREG in a human in vitro glioma model. Consistent with the mouse (GL261) model, the human macrophage cell line, THP-1 differentiated with phorbol myristate acetate (PMA) is able to stimulate the invasion of U87 human glioma line when cocultured on a Matrigel-coated transwell (Fig 4). As seen in the murine model, the CSF-1R inhibitor JnJ is able to strongly attenuate block THP1- stimulated U87 invasion (S2 Fig). We confirmed that THP-1 cells, but not U87 cells, express AREG (data not shown). In this model we used an alternative approach to interfere with AREG. An AREG function blocking antibody was included in the U87 + THP1 coculture and it was able to block THP1- stimulated U87 invasion to a very similar extent to that observed using RNAi against AREG in the murine GL261/microglial model. These data demonstrate that AREG is a key factor in microglia/macrophage promotion of glioma invasion in both mouse and human models.

Fig 4

Blockade of AREG from THP1 macrophages during U87 glioma invasion.

THP1 macrophages differentiated with PMA were cocultured with U87 cells stained with Cell Tracker Dye CMFDA (Green) on Matrigel-coated invasion with control IgG antibody or AREG blocking antibody. Representative images are shown. Arrows indicate fluorescently labeled glioma cells which have invaded to the other side of the filter. Scale bar = 200 um. Results shown are the average of at least three experiments. *: P < 0.05.

Glioma stimulation of AREG expression is dependent on the MAPK/ERK pathway

Thus far we have shown that the CSF-1/CSF-1R axis in microglia is required for AREG induction and stimulation of invasion. We next wanted to elucidate some of the signal transduction pathways that are involved in mediating CSF-1 activation of AREG transcription. Treatment of microglia with GLCM resulted in an increase in MAPK/ERK phosphorylation (Fig 5A). Interestingly, this was disrupted with addition of the CSF-1R inhibitor showing that CSF-1 is the predominant activator of ERK in microglia stimulated with GLCM (Fig 5A). We then wanted to assess the role of CSF-1/ERK signaling in GLCM stimulation of AREG transcription. Addition of U0126, an inhibitor of the MEK kinase which is upstream of ERK, was able to completely abolish GLCM induction of AREG mRNA (Fig 5B). We then tested the relevance of the ERK pathway in the coculture invasion assay. In the presence of the U0126 inhibitor, the ability of microglia to stimulate glioma invasion was strongly inhibited (Fig 5C). These data therefore show that CSF-1 via the ERK pathway induces AREG and the invasion promoting activity of microglial cells.

Fig 5

Role of MEK/ERK in CSF1R dependent AREG induction and invasion.

(A) Microglia cells were stimulated with GL261 conditioned media in the absence or presence of the CSF1R inhibitor JnJ and analyzed by SDS-PAGE for phospho-ERK levels. (B) AREG expression in GL261-stimulated microglia was analyzed by qRTPCR in the presence of the MEK inhibitor U0126. (C) GL261 cells expressing mCherry were cocultured with microglia on Matrigel-coated invasion chambers in the absence or presence of the MEK inhibitor U0126. *:P<0.05.

Discussion

Our laboratory has demonstrated that the ability of glioma cells to invade is strongly increased when they are cocultured with microglia [4]. Furthermore, the ability of microglia to stimulate glioma invasion in this context is heavily dependent on CSF-1R signaling. This study addresses the mechanism of the role of CSF-1 in this process. Here we show that conditioned media from GL261 cells strongly upregulates the EGFR ligand amphiregulin (AREG) in microglia in a CSF-1R dependent manner. This induction of AREG expression is important for cell invasion as interfering with AREG either by RNAi-mediated depletion or using function blocking antibodies, attenuates the ability of microglia and macrophages to stimulate glioma invasion.

This role of AREG in TAM-stimulated cell invasion is consistent with a previous study which assessed the ability of several EGFR ligands in promoting breast carcinoma cell invasion [47]. AREG has also been shown to function in a juxtacrine signaling [53]. Microglia apparently do not proteolytically process newly translated AREG as we could detect minimal AREG in the supernatant of stimulated microglia (data not shown). It is more likely that the precursor AREG we detect by western analysis remains associated with microglia by virtue of the fact that it contains a transmembrane domain. Consistent with this hypothesis, we could not stimulate glioma invasion to nearly the same extent using conditioned media from stimulated microglia (data not shown). This is also consistent what is observed in vivo where microglia are seen intimately connected to glioma cells at the invasive border.

The role of the CSF-1/CSF-1R axis in tumor progression is of great importance not just for glioma. Many other solid cancers have been shown to use the CSF-1 pathway to communicate with TAMs during metastasis [54-58]. The “paracrine loop” interaction between breast carcinoma and tumor associated macrophages is well-documented [59-61]. In these models, secreted EGF is induced in a CSF-1 dependent manner and is released by macrophages [62]. The importance of CSF-1 in glioma been shown in a separate glioma model; where inhibition of CSF-1 results in the complete destruction of the tumor presumably by inducing the repolarization of TAMs from a trophic (“M2”) state to a proinflammatory state (“M1”) and thus reversing immunosuppression [63]. This was in an in-situ generated glioma mouse model using virus expressing PDGF to drive tumor formation. It is worth noting that this model replicates the “pro-neural” subtype of glioma which may not reflect other subtypes of glioma (such as the mesenchymal) [64-66]. It will be of critical importance to dissect the differences between these and other glioma subtypes with respect to how TAMs influence invasion and immunosuppression.

Signaling governed by CSF-1R in TAMs has been shown to promote immunosuppressive as well as invasive/metastatic behavior in malignant tumors. Consistent with AREG being a CSF-1R regulated gene, AREG also has pleiotropic roles during tumor development [67]. In addition to its canonical function in promoting EGFR activation on cancer cells, it also has the ability to influence the composition of the tumor microenvironment [48, 68, 69].

Here we show that expression of AREG is induced in TAMs by glioma in a CSF-1R dependent manner. The potential for using CSF-1R targeting drugs in combination with other therapies may hold great promise for treating glioma as well as other metastatic cancers [55, 70, 71].

Effect of AREG depletion in microglia-stimulated GL261 invasion using individual AREG siRNA oligos.

Microglial cells depleted with either control or AREG siRNA individual oligos were cocultured with GL261 cells expressing mCherry on Matrigel-coated invasion chambers. Representative images are shown. Arrows indicate fluorescently labeled glioma cells which have invaded to the other side of the filter. Scale bar = 200 um. Results shown are average of at least five experiments. *: P < 0.05.

(TIF)

Click here for additional data file.

Effect of CSF-1R Iinhibition on THP-1 stimulation of U87 glioma THP1 macrophages differentiated with PMA were cocultured with U87 cells stained with cell tracker dye CMFDA (Green) on matrigel-coated invasion chambers in the absence or presence of 10 nM CSF1R inhibitor JnJ.

Results shown are average of at least three experiments. *: P < 0.05.

(TIF)

Click here for additional data file.

(PDF)

Click here for additional data file.

(PDF)

Click here for additional data file.

29 Jul 2021

PONE-D-21-18814

Microglial-stimulation of Glioblastoma Invasion Involves the EGFR ligand Amphiregulin

PLOS ONE

Dear Dr. Coniglio,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Arun Rishi, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, and (2) efforts to alleviate suffering.

3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the (1) Recombinant human CSF-1 and (2) CSF-1R receptor inhibitor, [4-Cyano-1H-pyrrole-2-carboxylic acid [4-(4-methyl-piperazin-1-yl)-2-(4-methyl-piperidin-1-yl)-phenyl]-amide].

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section."

5. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

6. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

7. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical.

8. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels

9 Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Overall opinion and general observations of the manuscript PONE-D-21-18814

Summary

This is a comprehensive study regarding the mechanisms glioblastoma (GBM) cells use to invade normal brain. It is known that microglia stimulate GBM cell invasion, and that this process is dependent on CSF-1R signaling. However, to have discovered more in-depth mechanism and pro-invasive factors upregulated in microglia, particularly amphiregulin (AREG), is interesting since targeting AREG/EGFR in the tumor could inhibit tumor invasion. Moreover, these extensive results are promising in terms of targeted therapies for GBM.

However, there are some concerns with regard to specific statements.

1. Term "multiforme" is no longer in use. According to the WHO 2016 classification of diffuse gliomas this term is omitted. Moreover, in Abstract you used this term with glioma, which is inappropriate.

2. You have cited plenty of references, however, only less than 20 is issued since 2015. For example, in Introduction you cited 8 references that showed that microglia are enhancers of glioma cell invasion, and none of them is issued since 2015.

3. The last paragraph in Introduction should be the aim of your research, not to conclude what you have found. Otherwise, it looks like Conclusion. This paragraph needs to be changed.

4. I wondered about the concentration of CSF-1R inhibitor (JnJ). Why did you use 10 nM?

5. Can you elaborate the place of inoculation of GBM cells? Why did you use those coordinates for induction of glioblastoma? Does it have impact on your model of glioblastoma?

6. Please, indicate magnification you used in Fig.3B and Fig.4. Also, if possible, add scale bar in both microphotographs. Explain what arrows indicate.

7. In Fig.4 the number of invaded cells in group treated with AREG blocking Ab is higher than in U87 alone, while in microphotographs it looks comparable between these two groups. Please, use consistent pictures.

Reviewer #2: This is an interesting article that builds on groups' prior published work from 2012, showing that CSF1-R inhibition in macrophage/microglia results in decreased glioma invasion. In the current manuscript, the authors show the mechanism by which CSF-1R signaling in microglia results in upregulation of AREG, leading to glioma cell invasion. They further show that interfering with AREG either by using RNAi or blocking antibodies attenuate macrophages/microglia's ability to promote glioma invasion. Overall, it is a well-controlled and concise in vitro study. There are a few issues that need to be fixed before considering it for publishing.

Figure 1B is missing the error bar for the microglia alone group, or if it is normalized per microglia alone group, in which case it should be fold change on Y-axis. This goes for Figure 2 as well.

Figure 2 in the text states four independent experiments – are those from four independent tumors? Need to be clarified.

In the text, it states, "Interestingly, we found that recombinant CSF-1 alone was insufficient to stimulate AREG mRNA in microglia to levels seen with GLCM (Fig 2B). Unfortunately, Figure 2B does not support the statement, and multiple comparison test should be used to see whether induction of AREG by CSF-1 stimulation and GLCM is in Figure 2B.

Images for invasion in all the figures are not very impressive, and some high-resolution inserts would be helpful.

Glioma Multiforme term is no longer used needs to be just glioblastoma.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Reviewer comments - PLOS ONE.docx

Click here for additional data file.

28 Oct 2021

Response to Reviewers

Editor Comments:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, and (2) efforts to alleviate suffering.

This description has been added to the materials and methods section

3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the (1) Recombinant human CSF-1 and (2) CSF-1R receptor inhibitor, [4-Cyano-1H-pyrrole-2-carboxylic acid [4-(4-methyl-piperazin-1-yl)-2-(4-methyl-piperidin-1-yl)-phenyl]-amide].

We have included the appropriate references for this compound in the revised manuscript.

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section."

This information is now identical

5. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

That is fine.

6. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

ORCID ID was added to “My Information” page on the Manager site.

7. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical.

The abstract in the online submission form and the manuscript are now identical

8. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels

The original blot images (uncropped) are included in the revised manuscript under supporting material in the file “S1_Raw-Images”.

9 Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

As per reviewer request, several additional references have been added to the revised manuscript. The additional references are listed below:

Roos A, Ding Z, Loftus JC, Tran NL. Molecular and microenvironmental determinants of glioma stem-like cell survival and invasion. Frontiers in Oncology. 2017;7: 1–8. doi:10.3389/fonc.2017.00120

Masui K, Kato Y, Sawada T, Mischel PS, Shibata N. Molecular and genetic determinants of glioma cell invasion. International Journal of Molecular Sciences. 2017;18. doi:10.3390/ijms18122609

Wallmann T, Zhang XM, Wallerius M, Bolin S, Joly AL, Sobocki C, et al. Microglia Induce PDGFRB Expression in Glioma Cells to Enhance Their Migratory Capacity. iScience. 2018;9: 71–83. doi:10.1016/j.isci.2018.10.011

Zhang X, Chen L, Dang W qi, Cao M fu, Xiao J fang, Lv S qing, et al. CCL8 secreted by tumor-associated macrophages promotes invasion and stemness of glioblastoma cells via ERK1/2 signaling. Laboratory Investigation. 2019;8. doi:10.1038/s41374-019-0345-3

Manini I, Caponnetto F, Bartolini A, Ius T, Mariuzzi L, Loreto C di, et al. Role of microenvironment in glioma invasion: What we learned from in vitro models. International Journal of Molecular Sciences. 2018;19. doi:10.3390/ijms19010147

Illig CR, Chen J, Wall MJ, Wilson KJ, Ballentine SK, Rudolph MJ, et al. Discovery of novel FMS kinase inhibitors as anti-inflammatory agents. Bioorganic & medicinal chemistry letters. 2008;18: 1642–8. doi:10.1016/j.bmcl.2008.01.059

Manthey CL, Johnson DL, Illig CR, Tuman RW, Zhou Z, Baker JF, et al. JNJ-28312141, a novel orally active colony-stimulating factor-1 receptor/FMS-related receptor tyrosine kinase-3 receptor tyrosine kinase inhibitor with potential utility in solid tumors, bone metastases, and acute myeloid leukemia. Molecular cancer therapeutics. 2009;8: 3151–3161. doi:10.1158/1535-7163.MCT-09-0255

Reviewer #1 Comments:

1. Term "multiforme" is no longer in use. According to the WHO 2016 classification of diffuse gliomas this term is omitted. Moreover, in Abstract you used this term with glioma, which is inappropriate.

We have eliminated the term “multiforme” in the manuscript. All mention of such has been replaced with “high grade glioma” or simply “glioma”.

2. You have cited plenty of references, however, only less than 20 is issued since 2015. For example, in Introduction you cited 8 references that showed that microglia are enhancers of glioma cell invasion, and none of them is issued since 2015.

We have updated our references and included more recent studies demonstrating a role for microglia and tumor associated macrophages playing a role in glioma invasion and progression.

3. The last paragraph in Introduction should be the aim of your research, not to conclude what you have found. Otherwise, it looks like Conclusion. This paragraph needs to be changed.

We have altered the last paragraph of the introduction in the revised manuscript.

4. I wondered about the concentration of CSF-1R inhibitor (JnJ). Why did you use 10 nM?

This CSF-1R antagonist is quite potent as we discovered it can fully block CSF-1 stimulation of CSF-1R tyrosine phosphorylation (detected using western blot) at concentrations as low as 10 nM. This was published in our 2012 paper (See figure 3, Coniglio et al 2012 Mol Med (2012) 18:519–27.

5. Can you elaborate the place of inoculation of GBM cells? Why did you use those coordinates for induction of glioblastoma? Does it have impact on your model of glioblastoma?

The location of tumor implantation was performed consistent with our previous publication. During our initial studies, we did not notice a significant dependence on tumor location with respect to macrophage infiltration and invasion.

6. Please, indicate magnification you used in Fig.3B and Fig.4. Also, if possible, add scale bar in both microphotographs. Explain what arrows indicate.

We have added scale bars to all of the images. The revised figure legend also now includes a statement that the arrows indicate invasive cells.

7. In Fig.4 the number of invaded cells in group treated with AREG blocking Ab is higher than in U87 alone, while in microphotographs it looks comparable between these two groups. Please, use consistent pictures.

We enhanced the image to show the invading cells in this condition. It now matches the quantitation well.

Reviewer #2 Comments:

1.Figure 1B is missing the error bar for the microglia alone group, or if it is normalized per microglia alone group, in which case it should be fold change on Y-axis. This goes for Figure 2 as well.

Yes, the qrtpcr results were normalized to unstimulated microglia. We therefore labelled the Y-axis label to indicate “Fold Change”

2.Figure 2 in the text states four independent experiments – are those from four independent tumors? Need to be clarified.

Yes this refers to four independent tumors. We have clarified this in the text.

3.In the text, it states, "Interestingly, we found that recombinant CSF-1 alone was insufficient to stimulate AREG mRNA in microglia to levels seen with GLCM (Fig 2B). Unfortunately, Figure 2B does not support the statement, and multiple comparison test should be used to see whether induction of AREG by CSF-1 stimulation and GLCM is in Figure 2B.

We realize the description of the data is confusing and we have changed the wording. Our assertion is that CSF-1 alone cannot achieve the level of AREG mRNA induction to levels observed using conditioned media (GLCM) The actual values are normalized to unstimulated microglia. Recombinant CSF-1 stimulation alone results in a 3.86 fold increase in AREG mRNA (standard error of 0.83) while using conditioned media from GL261 cells (GLCM) results in a 25.07 fold increase in AREG mRNA (standard error of 11.7). These data were obtained from an average of six independent experiments. Figure 2A shows that blockade of CSF-1R had a strong effect on GLCM stimulation of AREG mRNA. We conclude that CSF-1 is synergizing with an as of yet unindentified factor secreted by GL261 cells to promote full AREG mRNA induction in microglia.

4.Images for invasion in all the figures are not very impressive, and some high-resolution inserts would be helpful.

The images were all taken with a lower magnification to enable us count as many cells in as wide a field as possible. Included in the revised manuscript figures is a magnification of the area which shows the invasive cells in more detail.

5.Glioma Multiforme term is no longer used needs to be just glioblastoma.

We have removed the term “multiforme” throughout the text and generally use “glioma” or “high grade glioma”.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

8 Nov 2021

Microglial Stimulation of Glioma Invasion Involves the EGFR ligand Amphiregulin

PONE-D-21-18814R1

Dear Dr. Coniglio,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Arun Rishi, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

15 Nov 2021

PONE-D-21-18814R1

Microglial-stimulation of Glioma Invasion Involves the EGFR ligand Amphiregulin

Dear Dr. Coniglio:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof Arun Rishi

Academic Editor

PLOS ONE