Literature DB >> 34841294

Preterm infant meconium microbiota transplant induces growth failure, inflammatory activation, and metabolic disturbances in germ-free mice.

Henni Hiltunen1,2, Hila Hanani3, Raakel Luoto1,2, Sondra Turjeman3, Oren Ziv3, Erika Isolauri1,2, Seppo Salminen4, Omry Koren3, Samuli Rautava1,2,5,6.   

Abstract

Preterm birth may result in adverse health outcomes. Very preterm infants typically exhibit postnatal growth restriction, metabolic disturbances, and exaggerated inflammatory responses. We investigated the differences in the meconium microbiota composition between very preterm (<32 weeks), moderately preterm (32-37 weeks), and term (>37 weeks) human neonates by 16S rRNA gene sequencing. Human meconium microbiota transplants to germ-free mice were conducted to investigate whether the meconium microbiota is causally related to the preterm infant phenotype in an experimental model. Our results indicate that very preterm birth is associated with a distinct meconium microbiota composition. Fecal microbiota transplant of very preterm infant meconium results in impaired growth, altered intestinal immune function, and metabolic parameters as compared to term infant meconium transplants in germ-free mice. This finding suggests that measures aiming to minimize the long-term adverse consequences of very preterm birth should be commenced during pregnancy or directly after birth.
© 2021 The Authors.

Entities:  

Keywords:  fecal microbiota transplant; germ-free mice; growth; gut microbiota; inflammation; metabolism; preterm infant

Mesh:

Substances:

Year:  2021        PMID: 34841294      PMCID: PMC8606908          DOI: 10.1016/j.xcrm.2021.100447

Source DB:  PubMed          Journal:  Cell Rep Med        ISSN: 2666-3791


Introduction

Preterm birth is a major global health problem affecting ∼10% of pregnancies, corresponding to roughly 15 million preterm neonates born every year. Globally, preterm birth is the leading cause of death in children younger than 5 years of age. In addition to increased mortality, preterm infants exhibit a high risk of both short- and long-term morbidity. Postnatal growth restriction is a common problem in very preterm (VPT) infants. While suboptimal nutritional management is an important cause of impaired postnatal growth, inflammation is also thought to contribute to the pathogenesis of growth failure in preterm neonates.7, 8, 9 Later in life, preterm birth is associated with significantly increased occurrence of the metabolic syndrome and other risk factors for metabolic and cardiovascular disease in adulthood. Preterm neonates exhibit aberrant gut colonization patterns. Reduced microbial diversity and delayed colonization with Bifidobacteria have been reported to be characteristic of the preterm gut microbiota. Interestingly, the meconium microbiota detected in preterm neonates differs not only from the gut microbiota in the same individuals later in the neonatal period and infancy, but also from the meconium microbiota of term neonates. The origin of meconium microbiota is a topic of debate, and maternal transmission has been suggested. It has previously been shown that defective gut microbiota maturation is concomitant with postnatal growth failure. According to recent reports, the gut microbiota composition at the age of 2 days may be associated with preterm infant growth during the first weeks of life, and specific meconium microbiota features have been linked with extrauterine growth in neonates born before 33 weeks of gestation. Whether the initial preterm gut microbiota causally affects early growth or the development of the inflammatory or metabolic adverse consequences of prematurity remains unknown. In this study, we characterized the differences in the meconium microbiota in a cohort of VPT, moderately preterm (PT), and term (FT) human neonates. The causal contribution of the meconium microbiota to the growth failure, inflammatory immune state, and metabolic disturbances often encountered in VPT neonates was investigated in an experimental mouse model by performing fecal microbiota transplantation (FMT). Our results revealed significant differences in the meconium microbiota composition among the three groups. A statistically significant growth restriction, as well as an altered inflammatory response and metabolic disturbances characteristic of VPT neonates were seen in germ-free (GF) mice receiving meconium FMT from VPT neonates.

Results

The clinical characteristics of the neonates in the study are presented in Table 1. The extremely preterm infants (born at <28 weeks of gestation) and VPT infants (born from 28 to 32 weeks of gestation) in the study were combined as one group (VPT) for the statistical analyses. None of the neonates in the study exhibited symptoms or signs of perinatal asphyxia, as reflected in their Apgar scores at 5 and 15 min of age. Only mothers with symptoms and signs suggesting a high risk of spontaneous preterm delivery were recruited, and, consequently, all of the neonates included in this study had been exposed to antenatal corticosteroid treatment. It is noteworthy that the FT infants were mainly vaginally born, whereas in the preterm groups, caesarean section deliveries occurred in approximately half of the cases. The mothers were recruited during pregnancy, and the mode of delivery could not be predicted.
Table 1

Clinical characteristics of the study population

GroupIntrapartum antibioticsGenderMode of deliveryGA, weeksBirth weight, gZ scoreApgar 5 minApgar 15 minMeconium analysisFMTSample collection date
Very preterm

VPT1yesfemaleCS30 + 4/71,7300.368yesyes2
VPT2yesmaleCS25 + 0/78500.68N/Ayesyes4
VPT3yesmalevaginal28 + 5/71,3900.68N/Ayesyes3
VPT4yesfemalevaginal26 + 6/71,000−0.127yesyes2
VPT5nofemalevaginal30 + 4/71,420−0.51010yesno1
Mean28 + 2/71,2780.2

Moderately preterm

PT1yesfemaleCS33 + 6/73,8405.489yesyes5
PT2yesfemalevaginal34 + 6/72,280−11010yesyes2
PT3yesmalevaginal34 + 2/71,645−2.799yesyes2
PT4yesmaleCS36 + 1/72,420−1.699yesyes5
PT5yesmaleCS34 + 2/72,295−0.799yesyes3
PT6yesfemalevaginal35 + 0/72,460−0.599yesyes1
PT7yesmalevaginal33 + 4/72,6401.388yesno3
Mean34 + 4/72,5110

Term

FT1nomalevaginal37 + 0/73,2300.199yesyes1
FT2yesmalevaginal38 + 2/72,840−1.499yesyes2
FT3nomalevaginal38 + 5/73,6400.299yesyes2
FT4yesfemalevaginal38 + 6/73,190−0.699yesyes2
FT5nofemalevaginal41 + 5/73,400−0.699yesyes2
FT6nofemalevaginal40 + 6/74,4401.799yesyesN/A
FT7nofemalevaginal38 + 4/73,5800.599yesyes1
FT8nofemalevaginal38 + 4/72,820−1.399noyes3
Mean39 + 03,3930.2

CS, caesarean section; FMT, fecal microbiota transplant; GA, gestational age.

Clinical characteristics of the study population CS, caesarean section; FMT, fecal microbiota transplant; GA, gestational age.

VPT infants harbor a unique meconium microbiota

Significant differences in the meconium microbiota composition were detected between VPT, PT, and FT neonates. The meconium microbiota was analyzed by sequencing the 16S rRNA gene, and bioinformatics analyses were performed using QIIME2. Both VPT and PT neonates exhibited significantly lower alpha (within-sample) diversity as compared to FT neonates when assessed by Faith’s phylogenetic diversity (Figure 1A; p < 0.05). Moreover, significant clustering of the meconium microbiota between VPT, PT, and FT neonates was observed when beta diversity was analyzed using unweighted UniFrac (Figure 1B; q = 0.003). At the phylum level, Firmicutes were the dominant phylum in 95% of all meconium samples (highest abundance observed in the VPT neonates as compared to PT and FT neonates); the second most dominant phylum was Bacteroidetes in 50% of all meconium samples. Figure 1C summarizes the 12 most abundant bacterial families in each sample. Linear discriminant analysis effect size (LEfSe) was performed to investigate differences in the community composition between the groups, and the features differentiating the groups are summarized in Figure 1D.
Figure 1

Meconium composition in the very preterm (VPT), moderately preterm (PT), and term (FT) neonates

(A) Alpha diversity among the VPT, PT, and FT neonates using Faith’s phylogenetic diversity index, compared using t tests (p < 0.05). Data are means ± standard errors of the mean (SEMs).

(B) Principal coordinate analysis (PCoA) of unweighted UniFrac distances between the microbiota of the 3 groups (PERMANOVA, q = 0.003).

(C) Relative abundance at the family level.

(D) The greatest differences in taxa between the 3 groups are presented according to the linear discriminant analysis (LDA) scores (log10), as determined using the LEfSe method.

∗p < 0.05; VPT, very preterm (n = 5); PT, moderately preterm (n = 7); FT, term (n = 7). X denotes extremely preterm neonates (gestational age <28 weeks) within the VPT group.

Meconium composition in the very preterm (VPT), moderately preterm (PT), and term (FT) neonates (A) Alpha diversity among the VPT, PT, and FT neonates using Faith’s phylogenetic diversity index, compared using t tests (p < 0.05). Data are means ± standard errors of the mean (SEMs). (B) Principal coordinate analysis (PCoA) of unweighted UniFrac distances between the microbiota of the 3 groups (PERMANOVA, q = 0.003). (C) Relative abundance at the family level. (D) The greatest differences in taxa between the 3 groups are presented according to the linear discriminant analysis (LDA) scores (log10), as determined using the LEfSe method. ∗p < 0.05; VPT, very preterm (n = 5); PT, moderately preterm (n = 7); FT, term (n = 7). X denotes extremely preterm neonates (gestational age <28 weeks) within the VPT group.

Differences in weight gain, inflammatory cytokine gene expression, and metabolic hormone levels in mice after FMT

FMT with meconium from VPT, PT, or FT neonates was performed to 18 eight-week-old GF mice to establish whether the altered meconium microbiota in VPT neonates may play a role in the development of the preterm infant phenotype. Mouse stool samples were collected at 7 and 35 days post-FMT. At 7 days, Akkermansia and Faecalibacterium were found to be overrepresented in mice receiving FMT from VPT infants (LEfSe; Figure S1). An unclassified Clostridiales was overexpressed in mice that received FMT from PT infants 35 days after the transplant (Figure S2). To assess the association between the meconium microbiota and growth, mouse weight was monitored, and weight fold change was calculated in the mice as a measure of growth after FMT. After 35 days, the mice that received the meconium microbiota of VPT neonates had gained significantly less weight compared to the mice that received the meconium microbiota of FT neonates (Figure 2A; p < 0.001), while the mice receiving FMT from PT neonates exhibited intermediate growth. These results suggest that the distinct microbiota in VPT infant meconium is associated with growth failure in mice.
Figure 2

The effect of FMT using meconium on growth, metabolic hormones, and inflammatory cytokines in germ-free mice

(A) Percent weight gain (M.VPT n = 4, M.PT n = 6, M.FT n = 8).

(B and C) Expression of inflammatory cytokines in mice terminal ileum, determined by quantitative PCR analysis.

(B) Expression of IL-1β (M.VPT n = 3, M.PT n = 5, M.FT n = 7).

(C) Expression of IL-6 (M.VPT n = 3, M.PT n = 5, M.FT n = 7).

(D and E) Concentration of metabolic hormones in mouse blood determined by multiplex assay; .

(D) Concentration of insulin (M.VPT n = 3, M.PT n = 6, M.FT n = 8).

(E) Concentration of leptin (M.VPT n = 3, M.PT n = 6, M.FT n = 8).

Data represent the means ± SEMs. Regarding mice microbiota results, see Figures S1 and S2. FMT, fecal microbiota transplantation; M.VPT, mouse very preterm; M.PT, mouse moderately preterm; M.FT, mouse term. ∗∗∗p < 0.001; ∗∗∗p < 0.01; ∗p < 0.05 (t test).

The effect of FMT using meconium on growth, metabolic hormones, and inflammatory cytokines in germ-free mice (A) Percent weight gain (M.VPT n = 4, M.PT n = 6, M.FT n = 8). (B and C) Expression of inflammatory cytokines in mice terminal ileum, determined by quantitative PCR analysis. (B) Expression of IL-1β (M.VPT n = 3, M.PT n = 5, M.FT n = 7). (C) Expression of IL-6 (M.VPT n = 3, M.PT n = 5, M.FT n = 7). (D and E) Concentration of metabolic hormones in mouse blood determined by multiplex assay; . (D) Concentration of insulin (M.VPT n = 3, M.PT n = 6, M.FT n = 8). (E) Concentration of leptin (M.VPT n = 3, M.PT n = 6, M.FT n = 8). Data represent the means ± SEMs. Regarding mice microbiota results, see Figures S1 and S2. FMT, fecal microbiota transplantation; M.VPT, mouse very preterm; M.PT, mouse moderately preterm; M.FT, mouse term. ∗∗∗p < 0.001; ∗∗∗p < 0.01; ∗p < 0.05 (t test). We next investigated the impact of FMT from VPT, PT, and FT neonates on intestinal immune activation. The expression of mRNA encoding the inflammatory cytokines interleukin-1β (IL-1β) and interleukin-6 (IL-6) was measured from the mouse terminal ileum samples collected after sacrificing the mice on day 35 of the experiment. The mice receiving the microbiota from FT neonates had significantly higher levels of IL-1β compared to mice transplanted from VPT (p < 0.01) and PT (p < 0.05) neonates (Figure 2B). The mice receiving meconium microbiota from VPT and PT neonates displayed significantly higher intestinal inflammatory activation, as measured by IL-6 mRNA (Figure 2C; p < 0.05) levels as compared to the mice receiving the meconium microbiota of FT neonates. These data indicate that mice receiving FMT with very premature meconium exhibit altered intestinal inflammatory activation. Finally, we assessed the impact of FMT from VPT, PT, and FT neonates on mouse metabolism. Plasma levels of the metabolic hormones insulin and leptin were measured from blood samples collected after sacrificing the mice on day 35 of the experiment. The mice receiving the meconium of VPT neonates exhibited statistically significant differences in the metabolic state as demonstrated by significantly lower plasma levels of both insulin and leptin, as compared to the mice that received meconium from FT neonates (Figures 2D and 2E; p < 0.05). The mice receiving FMT from PT neonates exhibited intermediate levels of metabolic hormones.

Discussion

Our results demonstrate that the common VPT infant phenotype, which includes growth restriction, altered immune responsiveness, and metabolism, can be transferred to GF mice by meconium microbiota transplant. The meconium microbiota composition of VPT neonates was significantly distinct from that of FT neonates and exhibited lower alpha diversity. It is well established that the gut microbiota in preterm infants during the first weeks of life is markedly different from that of term infants. This may be caused, at least in part, by exposures known to perturb normal gut colonization, including caesarean section delivery and antibiotic exposure,, as well as reduced breastfeeding and skin-to-skin contact, which often coexist in preterm neonates. However, we have previously reported that in addition to these exposures, prematurity per se affects early gut colonization patterns. According to a detailed study by Korpela and colleagues, the gut microbiota of VPT and PT neonates is initially dominated by only a few bacterial taxa, but the gut microbiota composition over the first postnatal weeks gradually evolves to be primarily composed of Bifidobacteria and thus resembles that of FT infants. Interestingly, while the overall microbiota composition appeared to be strongly correlated with postnatal age in the study, postmenstrual age was the strongest determinant of gut microbiota composition. In the present study, significant differences in gut microbiota composition between VPT, PT, and FT neonates were already detected in meconium. These results are consistent with a previous study indicating that the meconium microbiota in preterm neonates differs from the meconium microbiota in FT neonates, but also from the gut microbiota in the same individuals later in the neonatal period and infancy. Even though postnatal influences cannot completely be ruled out, these data may be interpreted to indicate that gestational age and prenatal exposures may influence the initial gut microbiota. It has been suggested that the altered meconium microbiota in preterm neonates may be pro-inflammatory and causally linked to the maternal and fetal inflammatory responses associated with preterm delivery. The present study endeavored to systematically assess the consequences of aberrant initial gut colonization. Postnatal growth restriction is a substantial clinical problem in very low birth weight preterm infants. Undoubtedly, suboptimal nutritional management often contributes to the growth failure. Interestingly, it has been reported that early gut microbiota composition assessed at 2 and 10 days of age is associated with weight gain in preterm neonates born between 28 and 33 weeks of gestation. According to a recent report, defective gut microbiota maturation was observed in extremely preterm infants with growth failure as compared to those exhibiting normal growth. It is of particular interest that lower intestinal microbiota diversity preceded the development of impaired growth and was detectable already during the first week of life. The results of the present study provide evidence for a possible causal relationship between aberrant initial gut microbiota composition and growth failure in preterm neonates. We demonstrate that mice receiving VPT meconium microbiota transplants exhibit statistically significantly restricted growth as compared to mice receiving FMT of meconium from FT neonates, despite uniform nutritional management of the experimental animals. The association between gut microbiota composition and growth is well established by clinical and experimental studies in the context of overweight and obesity in later life. A recent report shows an association between the first stool and obesity at the age of 3 years. Intestinal microbes are known to contribute to energy harvest from the diet and modulate host metabolism associated with growth and energy storage. Defective gut microbiota maturation has previously been reported to be associated with growth failure in undernourished children. The potential causal role of aberrant initial gut colonization in subsequent growth restriction observed in this study may be explained by the inflammatory activation observed in both the VPT neonates and the experimental animals receiving the FMT. Inflammatory activation is associated with preterm birth and many of its adverse consequences. According to a report by Schreurs and colleagues, the fetal gut harbors naive CD4+ T cells, which support mucosal development. Dysregulation of this process by preterm birth and premature exposure to antigens was suggested to contribute to intestinal inflammation in the study. In the present study, an intestinal inflammatory tone reflected by the modest but statistically significant increase in baseline IL-6 expression was seen in the mice receiving FMT from VPT infants but not in those receiving FMT of PT or FT meconium. We also observed a decrease in intestinal IL-1β in mice receiving VPT neonate meconium microbiota. Despite its proinflammatory roles, this cytokine has been reported to also play a role in intestinal repair. It is well established that a propensity to exaggerated intestinal inflammatory responses in preterm neonates plays a role in the pathogenesis of necrotizing enterocolitis (NEC), an inflammatory intestinal disease afflicting preterm neonates. Based on experiments using a gnotobiotic mouse model, Yu et al. have reported that FMT with early gut microbiota from preterm infants exhibiting poor growth resulted in defective intestinal maturation as compared to those receiving FMT from preterm infants with normal weight gain. These data suggest that aberrant initial gut microbiota composition may impair growth and increase NEC risk by inducing inflammation and perturbing gut maturation. In addition, inflammation has been linked to adverse neurological and growth outcomes in VPT infants.7, 8, 9 Interventions aiming to modulate gut colonization and intestinal immune responses, including early human milk feeding, and probiotics, have been shown to reduce both intestinal inflammation and adverse clinical outcomes,37, 38, 39 including NEC. Our present data may be interpreted to suggest that preventive approaches involving interventions aiming to influence early gut colonization could be initiated prenatally. Metabolic alterations are common in preterm infants in the neonatal period and beyond. According to epidemiological and cohort studies, preterm birth is associated with an increased incidence of the metabolic syndrome and a significantly increased occurrence of risk factors for later metabolic and cardiovascular disease, including lower lean body mass, higher body fat content, and impaired glucose metabolism., The cord blood concentration of leptin has been reported to be lower in preterm as compared to term neonates., Insulin and leptin both function as fetal growth factors,, and fetal and neonatal exposure to leptin has been suggested to protect from the development of adverse metabolic outcomes in later life. It has recently been suggested that the aberrant gut microbiota observed in extremely preterm infants suffering from growth retardation may contribute to a persistent metabolic state resembling fasting characterized by defective anabolic glucose metabolism. In the present study, mice receiving FMT from VPT infants exhibited significantly lower plasma concentrations of insulin and leptin, which may explain the growth restriction observed in the mice receiving FMT from VPT infants. This demonstrates a causal connection between initial gut colonization patterns and the adverse metabolic consequences of very preterm birth. Our results suggest that the prenatal events leading to very preterm birth and their impact on initial gut colonization may play an important role in the development of the adverse consequences of preterm birth. Experimental and clinical studies aiming to further elucidate the exposures and events modulating the meconium microbiota may provide a basis for means to improve the long-term health of individuals born preterm.

Limitations of the study

Our study has obvious limitations. We included a relatively small number of subjects and, consequently, neonates born as extremely preterm infants (before 28 weeks of gestation) and very preterm (born between 28 and 32 weeks of gestation) were analyzed as a single group. The meconium samples were collected from diapers and therefore potentially exposed to environmental microbes. However, uniform sample collection protocol and tools were used to avoid systemic bias. The meconium samples collection time had some variation, since they were collected 0–5 days after birth. Nonetheless, our results regarding meconium microbiota composition are significant and consistent with previously published larger studies. We therefore believe the samples to be representative. There was variation in the groups regarding the mode of birth. Due to the study design, the mode of birth could not be predicted. In future research, the caesarean section rate differences should be minimized. A further limitation of our study is the fact that the weight gain, inflammatory responsiveness, or metabolic outcomes of the infants participating in this study were not reported due to the small sample size and poor availability of data. Instead, we relied on previously published data, which indicate that postnatal growth failure is a frequently encountered problem in very preterm infants, and that adverse metabolic consequences are common. Despite these limitations, we believe that our data reliably demonstrates an association between the aberrant meconium microbiota and the characteristic preterm infant phenotype, including growth failure, inflammatory immune tone, and metabolic disturbances associated with impaired growth and metabolic disease. Furthermore, our results from the FMT experiments in GF mice suggest that a causal relationship may underlie these associations. Although assuming interspecies transfer of pathology is prone to criticism and the results should be interpreted with caution, FMT from individuals with and without pathology into GF rodents, followed by a comparative analysis of pathological phenotypes in the recipient animals, regardless of actual microbiota composition, remains the most commonly used model to make causal inferences regarding gut microbiota aberrancies and pathogenesis of disease.

STAR★Methods

Key resources table

Resource availability

Lead contact

Further information and requests should be directed to and will be fulfilled by the lead contact, Samuli Rautava (samulirautava@gmail.com).

Materials Availability

The study did not generate new unique reagents.

Experimental model and subject details

Ethics statement

The children were born at the Turku University Hospital, Turku, Finland. The study was approved by the Ethics Committee of the Hospital District of Southwest Finland. Oral and written informed consent was obtained from the caregivers. All mouse experimental protocols were approved by the Bar Ilan Ethics Committee.

Human cohort

The study was based on samples collected from 20 neonates participating in an observational study at the Turku University Hospital in Turku, Finland. Pregnant women with symptoms or signs suggesting high risk of spontaneous preterm delivery were included. No randomization was conducted. The recruited mothers and their infants were grouped by gestational age at delivery. Altogether, 5 neonates were born VPT (before 320/7 weeks of gestation), 7 neonates were born PT (320/7-366/7 weeks of gestation) and 8 neonates were born FT (after 370/7 weeks of gestation). It is of note that both neonates born before 28 weeks of gestation and those born between 28-32 weeks of gestation were included in the VPT group.

Mice

8-10 weeks old germ-free Swiss Webster female mice were used for this study. The mice were housed in isolated cages and maintained on a 12-h light/dark cycle. All mice were handled uniformly and fed the same diet (Maintenance Diet 1324, Altromin International, Germany). All mouse experimental protocols were approved by the Bar Ilan Ethics Committee.

Method details

Meconium microbiota

Meconium samples (the first stool passed by the neonate after birth) were collected from the study subjects. To minimize environmental contamination, standardized protocols were used in sample collection. Meconium samples were frozen immediately after collection and kept at −70°C until analysis. DNA was extracted from all meconium samples together with appropriate positive and negative controls using the PureLink Microbiome DNA Purification Kit (Invitrogen). The V4 region of the bacterial 16S rRNA gene was amplified by polymerase chain reaction (PCR) using the 515F (AATGATACGGCGACCACCGAGATCTACACGCT) barcoded and 806R (TATGGTAATTGTGTGYCAGCMGCCGCGGTAA) primers. PCR were carried out by 35 cycles of denaturation (95°C), annealing (55°C) and extension (72°C), with final elongation at 72°C. PCR products were purified using AMPure magnetic beads (Beckman Coulter) and quantified using Quant-iT PicoGreen dsDNA quantitation kit (Invitrogen). Samples (30 ng), were loaded on 2% agarose E-Gel (Thermo Fisher), purified and sequenced using the Illumina MiSeq platform (Genomics Center, Azrieli Faculty of Medicine, BIU, Israel). A meconium sample from one subject was excluded from the analyses because the isolated DNA was not PCR amplifiable. The analyses were therefore performed on samples from 5 very preterm, 7 moderately preterm, and 7 term neonates (n = 19). In addition to positive and negative controls included throughout the pipeline, in a subset of the samples, real-time PCR (qPCR) of the 16S rRNA region was performed to confirm ample bacterial load for further analysis.

Fecal microbiota transplant (FMT) experiments

Germ free status of mice was verified using 16S rRNA PCR on fecal samples as described above for meconium samples. FMT of meconium from neonates were introduced to GF Swiss Webster female mice (8-10 weeks old), defining day 0 of the experiment. Each meconium sample collected in the study was separately suspended in 800 μl sterile phosphate-buffered saline (PBS) and dissociated by vortex for 1 min 200 μl from each suspension was gavaged orally to each GF mouse. A total of 18 meconium specimens were transferred according to the three groups: VPT (n = 4), PT (n = 6) and FT (n = 8). Mouse stool samples were collected on day 7 and 35. Samples were also collected on days 14, 21, and 28; the results were generally in-line with those presented and are therefore not presented herein. DNA from stool samples was extracted using the Mobio Powersoil DNA extraction kit (Mobio). The rest of the analysis steps were similar to those for the meconium samples. Mice were weighed at day 35 of the experiment, and terminal ileum specimens were collected from the mice after sacrifice by CO2 inhalation. A 1-cm section of terminal ileum was immediately removed using sterile scissors. The section was immediately placed in a tube containing RNAlater and stored at −80°C. Total RNA was extracted from tissues using Total RNA Purification Kit (Norgen Biotek Corp). In brief, terminal ileum tissue samples were homogenized in 2 mL cold RL buffer (Norgen Biotek Corp) using the Bio-Gen PRO200 tissue homogenizer (PRO Scientific). Homogenates were centrifuged, and the supernatant was taken for purification according to the manufacturer’s protocol (Total RNA Purification Kit, Norgen Biotek Corp). RNA quantity was determined on a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific) and then reverse transcribed using 5x All-in-One RT MasterMix (Abm). In brief, 200 μg of total RNA were added into a 10 μl reaction volume, and then the mixture was incubated at 25°C for 10 min, followed by synthesis at 42°C for 15 min, and a termination reaction at 85°C for 5 min. Next, 190 μL nuclease-free water was added, and the cDNA stored at −80°C until needed for qPCR. Real-time PCR amplification was performed to determine expression of IL-1β and IL-6 (primers in Table S1) with cDNA in a reaction containing with a final concentration of 0.1 μM for each primer and 5 μL Fast SYBR Green Master mix (Applied Biosystems) with 80 ng cDNA in 10 μL total volume. Reactions were run in a ViiA 7 Real-Time PCR System (Applied Biosystems). Cycle condition were: 95°C for 20 min, 40 cycles at 95°C for 1 min, and 60°C for 20 min. The results were analyzed using the ViiA 7 software and exported into Microsoft Excel for further analysis. Every sample was processed in technical triplicates. In all, 15 samples were analyzed (M.VPT n = 3; M.PT n = 5; M.FT n = 7); one terminal ileum from each group was not included due to technical problems. Blood samples were taken from the heart by performing thoracotomy on day 35. Blood was separated by centrifugation and the plasma was stored at −80°C. Plasma samples were used for measuring metabolic hormones (insulin, leptin) using the MILLIPLEX MAGPIX system (Merck Millipore). We analyzed 17 samples (M.VPT n = 3, M.PT n = 6, M.FT n = 8); one blood sample was not included in the analyses due to due to technical problems. Independent sample t tests were used to identify the differences between fold change in mouse weight at day 35 and between study groups. T Ttests were performed in order to examine the differences between blood leptin and insulin levels, and between expression of the inflammatory cytokines IL-1β and IL-6 in the mouse terminal ileum.

Quantification and statistical analysis

Data analysis was performed using QIIME2. Sequence reads were demultiplexed by per-sample barcodes and Illumina-sequenced amplicon read errors were corrected by Divisive Amplicon Denoising Algorithm (DADA2). A phylogenetic tree was generated. Alpha and beta diversity analysis was performed based on a feature table (species) containing features observed in at least 40% samples of one or more groups and rarefied at 40,000 sequences. Alpha diversity (within sample diversity) parameters, were calculated using Faith’s Phylogenetic Diversity. Beta diversity (between sample diversity) was analyzed using UniFrac distances. Principal Coordinate Analysis (PCoA) was performed based on unweighted UniFrac distance matrices. Linear discriminant analysis Effect Size (LEfSe) was also performed, to identify the features that significantly differed between samples according to relative abundances. The statistical analyses regarding each test have been described in the figure legends. No assumptions were tested.
REAGENT or RESOURCESOURCEIDENTIFIER
Biological samples

Newborn fecal samplesTurku University Hospital, Turku, FinlandN/A

Critical commercial assays

PureLink Microbiome DNA Purification KitInvitrogen, ThermoFisher ScientificCAT# A29790
AMPure XP for PCR clean-up (magnetic beads)Beckman CoulterCAT# A63882
Quant-iT PicoGreen dsDNA quantitation kitInvitrogen, ThermoFisher ScientificCAT# P7589
MO BIO’s PowerSoil DNA Isolation Kit HandbookQIAGENCAT# 12855
5x All-in-One RT MasterMixabmCAT# G592
Fast SYBR Green Master mixApplied BiosystemsCAT# 43-856-12
Total RNA Purification KitNorgen Biotek CorpCAT# 17200

Deposited data

Sequence dataThis paperENA:PRJEB46240; DDBJ:ERP130461

Experimental models: organisms/strains

Mouse: Swiss WebsterAzrieli Medical Faculty Animal FacilityWT – established colony in the faculty

Software and algorithms

QIIME2Bolyen et al., 201946https://qiime2.org/
DADA2Callahan et al., 201647https://benjjneb.github.io/dada2/tutorial.html

Other

Mouse Chow: Maintenance DietAltromin InternationalDiet 1324
  49 in total

1.  Gut bacteria that prevent growth impairments transmitted by microbiota from malnourished children.

Authors:  Laura V Blanton; Mark R Charbonneau; Tarek Salih; Michael J Barratt; Siddarth Venkatesh; Olga Ilkaveya; Sathish Subramanian; Mark J Manary; Indi Trehan; Josh M Jorgensen; Yue-Mei Fan; Bernard Henrissat; Semen A Leyn; Dmitry A Rodionov; Andrei L Osterman; Kenneth M Maleta; Christopher B Newgard; Per Ashorn; Kathryn G Dewey; Jeffrey I Gordon
Journal:  Science       Date:  2016-02-19       Impact factor: 47.728

Review 2.  The "Golden Age" of Probiotics: A Systematic Review and Meta-Analysis of Randomized and Observational Studies in Preterm Infants.

Authors:  Elda Dermyshi; Yizhong Wang; Chongbin Yan; Wenchao Hong; Gang Qiu; Xiaohui Gong; Ting Zhang
Journal:  Neonatology       Date:  2017-02-15       Impact factor: 4.035

Review 3.  Neurodevelopmental Outcomes of Preterm Infants Fed Human Milk: A Systematic Review.

Authors:  Beatrice E Lechner; Betty R Vohr
Journal:  Clin Perinatol       Date:  2016-12-23       Impact factor: 3.430

4.  Dynamic changes in serum leptin concentrations during the fetal and neonatal periods.

Authors:  J Matsuda; I Yokota; M Iida; T Murakami; M Yamada; T Saijo; E Naito; M Ito; K Shima; Y Kuroda
Journal:  Pediatr Res       Date:  1999-01       Impact factor: 3.756

5.  Cesarean section changes neonatal gut colonization.

Authors:  Jakob Stokholm; Jonathan Thorsen; Bo L Chawes; Susanne Schjørring; Karen A Krogfelt; Klaus Bønnelykke; Hans Bisgaard
Journal:  J Allergy Clin Immunol       Date:  2016-04-01       Impact factor: 10.793

6.  The development of gut microbiota in critically ill extremely low birth weight infants assessed with 16S rRNA gene based sequencing.

Authors:  Tiina Drell; Irja Lutsar; Jelena Stšepetova; Ulle Parm; Tuuli Metsvaht; Mari-Liis Ilmoja; Jaak Simm; Epp Sepp
Journal:  Gut Microbes       Date:  2014 May-Jun

Review 7.  Functional interactions between the gut microbiota and host metabolism.

Authors:  Valentina Tremaroli; Fredrik Bäckhed
Journal:  Nature       Date:  2012-09-13       Impact factor: 49.962

Review 8.  Prenatal and postnatal administration of prebiotics and probiotics.

Authors:  Kristin Sohn; Mark A Underwood
Journal:  Semin Fetal Neonatal Med       Date:  2017-07-15       Impact factor: 3.926

Review 9.  The Microbiota of the Extremely Preterm Infant.

Authors:  Mark A Underwood; Kristin Sohn
Journal:  Clin Perinatol       Date:  2017-03-22       Impact factor: 3.430

Review 10.  Born too soon: the global epidemiology of 15 million preterm births.

Authors:  Hannah Blencowe; Simon Cousens; Doris Chou; Mikkel Oestergaard; Lale Say; Ann-Beth Moller; Mary Kinney; Joy Lawn
Journal:  Reprod Health       Date:  2013-11-15       Impact factor: 3.223

View more
  1 in total

Review 1.  First 1000 Days and Beyond After Birth: Gut Microbiota and Necrotizing Enterocolitis in Preterm Infants.

Authors:  Shuqin Zeng; Junjie Ying; Shiping Li; Yi Qu; Dezhi Mu; Shaopu Wang
Journal:  Front Microbiol       Date:  2022-06-21       Impact factor: 6.064

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.