| Literature DB >> 34837691 |
Yao Zhou1,2,3, Xiaohui Yang1,2,3, Zheng Liu4, Yu Zhang1,2,3, Huaye Chen1,2,3, Yongfang Zhang1,2,3, Yuxin Hu5, Yanlin Ma1,2,3, Qi Li1,2,3.
Abstract
Fraser syndrome is a rare autosomal recessive malformation disorder. It is characterized by cryptophthalmos, syndactyly, urinary tract abnormalities and ambiguous genitalia. This condition is due to homozygous or heterozygous mutations in the FRAS1, FREM1, FREM2, and GRIP1 genes. In the present study, we recruited a Chinese family with Fraser syndrome. Two novel mutations c.7542_7543insG and c.2689C>T in the FREM2 gene were detected in this Fraser syndrome family by PCR-based sequencing. The next-generation sequencing-based single nucleotide polymorphism haplotyping method was applied to exclude these two mutations in 9 blastocysts obtained from the patient. After obtaining consent and informing the risk, the patient received in vitro fertilization and embryo transfer treatment with an embryo carrying a heterozygous mutation. Finally, she delivered a healthy baby without any complications on March 17, 2019. In conclusion, we first reported two novel mutations in the FREM2 gene associated with the risk of Fraser syndrome. Moreover, we described a next-generation sequencing-based single nucleotide polymorphism haplotyping method to select the 'right' embryos from patients with Fraser syndrome for in vitro fertilization and embryo transfer treatment.Entities:
Keywords: FREM2 gene; Fraser syndrome; embryos selection; the next-generation sequencing-based single nucleotide polymorphism haplotyping
Mesh:
Substances:
Year: 2021 PMID: 34837691 PMCID: PMC8660615 DOI: 10.18632/aging.203715
Source DB: PubMed Journal: Aging (Albany NY) ISSN: 1945-4589 Impact factor: 5.682
Figure 1The pedigree of the family with Fraser syndrome. Roman numerals indicate generations, and individuals within a generation are numbered from left to right. The proband (III: 4) is denoted with an arrow.
Figure 2Identify the disease-causing mutation in the Fraser syndrome family. (A) Two mutations c.7542_7543insG and c.2689C>T were identified. (B) A schematic of the FREM2 protein and location of the mutations.
Figure 3Conservation analysis of affected amino acids among six primate species. Evolutionary conservation of the mutations within FREM2 across species is analyzed. The positions of 2 mutations p.Gln897Term (A) and p.V2516GfsX10 (B) are indicated in red boxes.
Sequencing results of the family members.
|
|
| |
| Female | Wild-type | Heterozygous mutation |
| Male | Heterozygous mutation | Wild-type |
| Female’ father | Wild-type | Wild-type |
| Female’ mother | Wild-type | Heterozygous mutation |
| Male’ father | Heterozygous mutation | Wild-type |
| Male’ mother | Wild-type | Wild-type |
| Fetus | Heterozygous mutation | Wild-type |
Twenty-two SNP markers were respectively selected for identifying disease-associated allele in the embryos.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| FREM2_8 | Chr13 | 38089800 | C | T | C/T | C/C | C/C | C/C | T/T | T/C | C/T | C/T | C/T | C/C | C/C | C/C | C/T | C/T | C/T |
| FREM2_9 | Chr13 | 38174781 | T | C | T/C | T/T | T/T | T/T | C/C | C/T | T/C | T//C | T/T | T/T | T/T | T/T | T/T | ?/? | T/C |
| FREM2_14 | Chr13 | 38361871 | A | G | G/G | G/G | G/G | G/A | G/A | G/A | G/G | G/G | G/G | G/A | G/A | G/A | G/G | G/A | G/G |
| FREM2_F_2 | Chr13 | 38382809 | A | G | A/A | G/G | A/G | G/A | A/A | A/A | G/G | G/G | G/A | G/A | A/A | G/A | G/A | G/A | A/A |
| FREM2_15 | Chr13 | 38382875 | C | T | C/C | T/T | C/T | T/C | C/C | C/C | C/C | C/C | T/C | T/C | C/C | T/C | T/C | T/C | C/C |
| FREM2_F_3 | Chr13 | 38382982 | G | C | G/G | C/C | G/C | C/G | G/G | G/G | G/G | G/G | C/G | C/G | G/G | C/G | C/G | C/G | G/G |
| FREM2_16 | Chr13 | 38406297 | G | A | G/G | A/A | G/A | A/G | G/G | G/G | G/G | G/G | A/G | A/G | G/G | A/G | A/G | A/G | G/G |
| FREM2_F_4 | Chr13 | 38406309 | C | A | C/C | A/A | C/A | A/C | C/C | C/C | C/C | C/C | A/C | A/C | C/C | A/C | A/C | A/C | C/C |
| FREM2_F_6 | Chr13 | 38501932 | G | T | G/G | T/T | G/T | G/G | G/G | G/G | G/G | G/G | T/G | T/G | G/G | T/G | T/G | T/G | G/G |
| FREM2_22 | Chr13 | 38552205 | G | A | G/G | A/A | G/A | G/G | G/G | G/G | G/G | G/G | A/G | A/G | G/G | A/G | A/G | A/G | G/G |
| FREM2_M_1 | Chr13 | 38625874 | G | A | G/G | G/G | G/G | G/A | G/G | G/A | G/G | G/G | G/G | G/A | G/A | G/A | G/G | ?/? | G/G |
| FREM2_F_14 | Chr13 | 39264690 | T | C | T/T | T/C | T/C | T/T | T/T | T/T | ?? | ?? | C/T | C/T | ?/? | ?/? | C/T | ?/? | ?/? |
| FREM2_M_7 | Chr13 | 39430443 | G | A | G/G | G/G | G/G | A/A | G/G | G/A | G/G | G/G | G/G | G/A | G/A | G/G | G/G | G/A | G/G |
| FREM2_M_8 | Chr13 | 39431945 | T | C | T/T | T/T | T/T | C/C | T/T | T/C | T/T | ?? | T/T | ?? | ?/? | T/T | T/T | ?/? | ?/? |
| FREM2_M_10 | Chr13 | 39446869 | G | A | G/G | G/G | G/G | A/A | G/G | G/A | G/G | ?? | G/G | G/A | G/A | G/G | G/G | G/A | ?/? |
| FREM2_M_11 | Chr13 | 39452934 | C | T | C/T | T/C | C/C | C/C | T/T | T/C | ?? | C/T | C/T | C/C | C/C | ?/? | C/T | C/C | C/T |
| FREM2_62 | Chr13 | 39477115 | G | C | C/G | C/C | C/C | C/C | G/G | G/C | C/G | C/G | C/G | C/C | C/C | C/G | C/G | C/C | C/G |
| FREM2_80 | Chr13 | 39792426 | C | T | C/C | T/C | C/C | T/T | C/C | C/T | C/C | C/C | C/C | T/C | C/T | C/C | C/C | C/T | C/C |
| FREM2_82 | Chr13 | 39821473 | G | A | G/G | A/G | G/G | G/A | G/G | G/A | G/G | G/G | G/G | A/G | G/A | G/G | G/G | G/A | G/G |
| FREM2_90 | Chr13 | 39949981 | T | C | T/T | C/C | T/C | T/T | T/T | T/T | T/T | T/T | C/T | T/C | T/T | C/T | C/T | C/T | T/T |
| FREM2_M_12 | Chr13 | 39991091 | T | A | T/T | A/T | T/T | T/T | A/T | A/T | T/A | T/A | T/A | T/T | T/T | T/A | T/A | T/T | T/A |
| FREM2_111 | Chr13 | 40464364 | G | A | G/A | A/A | G/A | A/A | A/A | A/A | G/A | G/A | A/A | A/A | G/A | A/A | A/A | A/A | G/A |
E5 and E15 were wild-type, E4, E7, E8 and E14 were heterozygous carriers, and E1, E2 and E17 were carried two pathogenic mutations. ID, reference SNP cluster ID; Chr, chromosome number; POS, genomic position; REF, reference allele of the SNPs; ALT, alternative allele of the SNPs; FF, female’s father; FM, female’s mother; MF, male’s father; MM, male’s mother; E, embryo. The red base indicates associated mutation, while the black base indicates that the SNP links with wild type. The green background indicates uncertain recombination. “?”means that the alleles are not covered.
Figure 4Genotyping results of STR D13S218, STR D13S894, and STR D13S1253 in this family. STR D13S218, D13S894 and D13S1253 showed that the fetus was a heterozygous carrier with one FREM2 gene mutation (c.2689C>T, p.Gln897Ter) inherited from the father, which is consistent with the PGD result. (A) Genotyping for STR D13S218 in the man’s family and used in prenatal diagnosis indicates that the chromosome carrying pathogenic mutation originated from his father. The fetus inherited pathogenic chromosome from his father. (B) Genotyping for STR D13S894 in the woman’s family and used in prenatal diagnosis indicates that the chromosome carrying pathogenic mutation originated from her mother. The fetus inherited the normal chromosome from his mother. (C) Genotyping for STR D13S1253 in the man’s family and used in prenatal diagnosis indicates that the chromosome carrying pathogenic mutation originated from his father. The fetus inherited the pathogenic chromosome from his father.
Primers used in this study.
|
|
|
|
|
| c.2689C | FREM2_1F | GTCCTCAACACCGGCTTCA | chr13:39261173-39461268 |
| FREM2_1R | GAGTGCCAGTAGGATGGCTC | ||
| c.7542_7543insG | FREM2_15F | TCCACAGAGAAGTTGAAAGTACACA | |
| FREM2_15R | GCTTACCCAAGTCACCTACCA | ||
| D13S218 | D13S218F | GATTTGAAAATGAGCAGTCC | chr13:38458094-38458429 |
| D13S218R | GTCGGGCACTACGTTTATCT | ||
| D13S1288 | D13S1288F | TTCAGAGACCATCACGGC | chr13:38949133-38949542 |
| D13S1288R | CTGGAAAAATCAGTTGAATCCTAGC | ||
| D13S1253 | D13S1253F | CCTGCATTTGTGTACGTGT | chr13:39572161-39572531 |
| D13S1253R | CAGAGCCGTGGTAGTATATTTTT |