Literature DB >> 34813599

Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatment.

Seogwon Lee1, Ju Yeong Kim1, Myung-Hee Yi1, In-Yong Lee1,2, Dongeun Yong3, Tai-Soon Yong1.   

Abstract

PURPOSE: Allergens present in the feces or frass of cockroaches can cause allergic sensitization in humans. The use of fecal and frass extracts for immunotherapy has been previously investigated but has not yet been fully standardized. Here, we treated cockroaches with ampicillin to produce extracts with reduced amounts of total bacteria.
METHODS: We performed targeted high-throughput sequencing of 16S rDNA to compare the microbiomes of ampicillin-treated and untreated (control) cockroaches. RNA-seq was performed to identify differentially expressed genes (DEGs) in ampicillin-treated cockroaches.
RESULTS: Analysis of the microbiome revealed that alpha diversity was lower in the ampicillin-treated group than in the control group. Beta diversity analysis indicated that ampicillin treatment altered bacterial composition in the microbiome of cockroaches. Quantitative polymerase chain reaction revealed that almost all bacteria were removed from ampicillin-treated cockroaches. RNA-seq analysis revealed 1,236 DEGs in ampicillin-treated cockroaches (compared to untreated cockroaches). Unlike bacterial composition, the DEGs varied between the two groups. Among major allergens, the expression of Bla g 2 decreased significantly in ampicillin-treated cockroaches (compared to untreated group).
CONCLUSIONS: In this study, the reduced level of allergens observed in cockroaches may be related to lower amounts of total bacteria caused by treatment with antibiotics. It is possible to make a protein extract with few bacteria for use in immunotherapy.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34813599      PMCID: PMC8610280          DOI: 10.1371/journal.pone.0257114

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Cockroaches spread pathogenic bacteria through their feces or frass while traveling between locations, such as homes, shops, and hospitals [1]. Their omnivorous nature enables them to survive under a wide variety of conditions. The German cockroach, Blattella germanica, and its microbiome have been extensively investigated [2–4, 6]. Different gut microbiomes of B. germanica were identified at various locations inside and outside laboratory settings, likely due to differences in the diets available at these locations [2]. A laboratory-based study investigating the effect of diet on B. germanica confirmed that their microbiome changed dynamically according to food intake [3]. Several studies have reported that antibiotics directly affect the bacterial composition in the cockroach microbiota. Rosas et al. showed that rifampicin altered the B. germanica microbiota and that the second generation of insects following antibiotic treatment underwent microbiota recovery through fecal intake [4]. Antibiotic-treated cockroaches showed changes in bacterial diversity and composition, including the removal of the endosymbiont Blattabacterium [4]. Another study reported difficulties in cockroach reproduction and growth following antibiotic treatment [5]. In Riptortus pedestris, the absence of an endosymbiont led to a decrease in hexamerin and vitellogenin, which affected egg production and insect development [6]. Cockroaches can spread pathogenic bacteria present in their gut or body to places with high human traffic, such as restaurants or hospitals [7], and the allergens in their feces or frass can cause allergen sensitization in humans [8]. Production of the major cockroach allergen Bla g 1 in female cockroaches is related to their reproductive cycle and is also affected by their food intake [9]. Bla g 1 can bind various lipids, suggesting that it has a digestive function related to the nonspecific transport of lipid molecules [10]. Similar to Bla g 1, Bla g 2 is present at high concentrations in the digestive organs of cockroaches (esophagus, gut, and proventriculus), suggesting that Bla g 2 functions as a digestive enzyme [11]. Bla g 2 is regarded the most important B. germanica allergen, with the rate of sensitization being the highest among common cockroach allergens at 54–71% generally [12]. Because the potency of the cockroach protein extract was different for each cohort depending on the allergen content of the extract—as recently demonstrated in several studies on allergen immunotherapy [13, 14]—it is important to select a suitable protein extract for each patient [13]. Despite these variables, no studies have been conducted to determine the effect of bacteria in the cockroach on allergen production before extracting the protein for immunotherapy. The extract of the cockroach not only contains allergens but also harbors various immunomodulatory molecules such as endotoxin and bacterial DNA from the microbiome, which are not easily removed by the filtration process. In the present study, we aimed to obtain a protein extract of B. germanica with reduced levels of bacteria using ampicillin, a broad-spectrum antibiotic. In addition, we attempted to investigate the amount and composition of the microbiome of cockroaches treated with ampicillin, and whether the production of allergens in the cockroach was affected by the treatment.

Materials and methods

Rearing conditions

Cockroaches (B. germanica) were reared for several generations under the same laboratory conditions to minimize the potential influence of environmental factors and diet on their performance. All cockroaches were reared in plastic boxes (27 cm × 34 cm × 19 cm) and incubated at 25°C and 50% relative humidity. B. germanica were fed sterilized fish food and provided with sterilized untreated or ampicillin-containing (autoclaved before the addition of 0.025% ampicillin) tap water ad libitum.

Experimental design

Newly hatched cockroaches (G1) were randomly divided into two groups (n = 5 from each group). We used G1 cockroaches because we had to administer ampicillin immediately after hatching. Group A was offered ampicillin-treated water, while group C (control) was offered untreated water. Twenty-one days after becoming adults, ampicillin-treated (A) and untreated (C) female cockroaches were sampled for further analyses. B. germanica were sacrificed with CO2 then surface-sterilized using alcohol and flash-frozen in liquid nitrogen. They were then individually crushed using a mortar and pestle and stored at −80°C until further analysis. The powder of the crushed body of each cockroach was used for DNA, RNA, and protein extraction. Three biological replicates were analyzed.

DNA extraction

Total DNA was extracted using the NucleoSpin DNA Insect Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. The DNA extracted from each sample was eluted in 20 μL of elution buffer. Procedures were all conducted at a clean bench, under a sterilized hood, and in a DNA-free room. DNA concentrations were quantified using an ND-1000 Nanodrop system (Thermo-Fisher Scientific, Waltham, MA, USA).

Next-generation sequencing

The 16S rDNA V3–V4 region was amplified through polymerase chain reaction (PCR) using forward and reverse primers (Table 1) [15, 16], in an Illumina MiSeq V3 cartridge (San Diego, CA, USA) with a 600-cycle format. A limited-cycle amplification step was performed to add multiplexing indices and Illumina sequencing adapters to the samples. The libraries were normalized, pooled, and sequenced on the Illumina MiSeq V3 cartridge platform according to the manufacturer’s instructions.
Table 1

Primers used in this study.

Primer NamePrimer Sequence (5’ → 3’)
16S rDNA V3–V4_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
16S rDNA V3–V4_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC
ActinF CACATACAACTCCATTATGAAGTGCGA
ActinR TGTCGGCAATTCCGGTACATG
BACT1369 CGGTGAATACGTTCYCGG
PROK1492R GGWTACCTTGTTACGACTT
Blag1F CTATATGACGCCATCCGTTCTC
Blag1R CACATCAACTCCCTTGTCCTT
Blag2F TGATGGGAATGTACAGGTGAA A
Blag2R TGTTGAGATGTCGTGAGGTTAG
Blag5F GATTGATGGGAAGCAAACACAC
Blag5R CGATCTCCAAGTTCTCCCAATC

Bioinformatic and statistical analyses

Bioinformatics analyses were performed according to the methods described in our previous study [16]. Taxonomic assignment was performed using the EzBioCloud database (https://www.ezbiocloud.net/) [16] and BLAST (v. 2.2.22), and pairwise alignments were generated to measure sequence similarity [17, 18]. All analyses were performed using BIOiPLUG, a commercially available ChunLab bioinformatics cloud platform for microbiome research (https://www.bioiplug.com/) [16]. The reads were normalized to 11,000 to perform the analyses. Phylogenetic analysis was performed, and Shannon indexes, unweighted pair group method with arithmetic mean (UPGMA) clustering, principal coordinates analysis (PCoA), permutational multivariate analysis of variance, linear discriminant analysis, and linear discriminant analysis effect size (LEfSe) were determined according to our previous study [16].

Protein extraction

Total protein was extracted by first adding 2 mL of PBS to each sample. The samples were then sonicated (QSonica Q500, Fullerton, CA, USA) and centrifuged at 10,000 ×g for 30 min at 4°C. The resulting supernatants were filtered using a 0.22-μm membrane filter (Millex®, Tullagreen, Carrigtwohill, Co. Cork, Ireland). Defatting was not performed as there was little fat in the sample and to minimize bacterial contamination.

Enzyme-linked immunosorbent assay (ELISA)

Cockroach protein extracts (2 mg/mL) were diluted 100-fold to measure Bla g 1 and Bla g 2 levels and were diluted 10-fold to measure Bla g 5 level using corresponding ELISA kits (Indoor Biotechnologies, Charlottesville, VA, USA) according to the manufacturer instructions. In brief, the detection antibody and conjugate mix were used for the immunoassay, and color development was performed with the substrate 3,3′,5,5′-tetramethylbenzidine.

RNA extraction and cDNA synthesis

Total RNA was extracted by adding 1 mL of TRIZOL Reagent (GeneAll, Seoul, Korea) to each sample. TRIZOL supernatant was added to react with the sample and was mixed with isopropanol to obtain a pellet. The RNA extracted from each sample was eluted in 20 μL of the elution buffer. A master mix comprised 5× cDNA synthesis mix, and 20× RTase was added to mRNA samples in PCR tubes for cDNA synthesis.

Quantitative real-time PCR (qPCR)

Quantitative real-time PCR (qPCR) was performed to quantify Bla g 1, Bla g 2, Bla g 5, and bacterial 16S rRNA in whole cockroaches. Actin 5C (accession number AJ861721.1) was used as the internal control, and primers specific to this gene were designed for this experiment: ActinF and ActinR (Table 1) [4]. All bacterial 16S rRNA were amplified using the forward primer BACT1369 and the reverse primer PROK1492R (Table 1) from XenoTech with AMPIGENE qPCR Mixes (ENZO, USA) [19]. Bla g 1 (accession number EF202179.1), Bla g 2 (accession number EF203068.1), and Bla g 5 (accession number EF202178.1) gene expression was used as a measurement of major allergen content. We designed the following primers for this experiment: Blag1F and Blag1R, Blag2F and Blag2R, and Blag5F and Blag5R (Table 1). qPCR analyses were performed using the 2× SensiFAST™ SYBR® Hi-ROX kit (Bioline Meridian Bioscience, Humber Rd, London) with SYBR Green as the fluorescent reporter, H2O, corresponding primers, and either genomic or complementary DNA. At the end of each reaction, a melting curve was generated to check the specificity of amplification and to confirm the absence of primer dimers. All reactions, including negative controls (containing water instead of DNA), were run in duplicate in 96-well plates.

RNA-seq analysis

We used total RNA (n = 3 from each group) and the TruSeq Stranded mRNA LT Sample Prep Kit (San Diego, California, USA) to construct cDNA libraries. The protocol consisted of polyA-selected RNA extraction, RNA fragmentation, random hexamer primed reverse transcription, and 100 nt paired-end sequencing by Illumina NovaSeq 6000 (San Diego, California, USA). The libraries were quantified using qPCR according to the qPCR Quantification Protocol Guide and qualified using an Agilent Technologies 2100 Bioanalyzer. Raw reads from the sequencer were preprocessed to remove low-quality and adapter sequences. The processed reads were aligned to the B. germanica genome using HISAT v2.1.0 [20]. HISAT utilizes two types of indexes for alignment (a global, whole-genome index, and tens of thousands of small local indexes). These index types are constructed using the same Burrows–Wheeler transform, and graph Ferragina Mangini index as Bowtie2. HISAT generates spliced alignments several times faster than the Burrows–Wheeler Aligner (BWA) and Bowtie because of how efficiently it utilizes these data structures and algorithms. The reference genome sequence of B. germanica and annotation data were downloaded from NCBI. Known transcripts were assembled using StringTie v1.3.4d [21, 22], and the results were used to calculate the expression abundance of transcripts and genes as read count or fragments per kilobase of exon per million fragments mapped value per sample. Expression profiles were used to further analyze differentially expressed genes (DEGs). DEGs or transcripts from groups with different conditions can be filtered through statistical hypothesis testing.

Statistical analysis of gene expression

The relative abundances of gene expression were measured in the read count using StringTie. We performed statistical analyses to detect DEGs using the estimates of abundance for each gene in individual samples. Genes with more than one “zero” read count value were excluded. Filtered data were log2-transformed and subjected to trimmed mean of M-values normalization. The statistical significance of the fold change in expression (i.e., differential expression data) was determined using the exact test from edgeR [23], wherein the null hypothesis was that no difference exists among groups. The false discovery rate (FDR) was controlled by adjusting the p-value using the Benjamini-Hochberg algorithm. For DEGs, hierarchical clustering analysis was performed using complete linkage and Euclidean distance as a measure of similarity. Gene-enrichment and KEGG pathway analyses for DEGs were also performed based on the Gene Ontology (http://geneontology.org/) and KEGG pathway (https://www.genome.jp/kegg/) databases, respectively. We used the multidimensional scaling (MDS) method to visualize the similarities among samples and applied the Euclidean distance as a measure of dissimilarity. Hierarchical clustering analysis was also performed using complete linkage and Euclidean distance as a measure of similarity to display the expression patterns of differentially expressed transcripts that satisfied a |fold change| ≥ 2 and a raw P-value <0.05.

Results

First-generation cockroaches reached the adult stage and were kept for an additional 21 days before being sacrificed for further analysis (Fig 1). The number of laid eggs did not vary between the groups, but the offspring were reduced approximately ten times after ampicillin treatment. In addition, no morphological differences were observed between the groups. qPCR analysis showed that the number of total bacteria in the cockroaches was 2,000 times higher in the control group than that in the ampicillin-treated group (Fig 2).
Fig 1

Experimental design depicting ampicillin treatment of B. germanica.

The cockroaches were divided into two groups (A and C) and individuals were either treated with ampicillin (A) or left untreated as control specimens (C). Ampicillin was administered to cockroaches from the G1 (i.e., offspring from G0) generation, 21 days after they had reached the adult stage. Whole bodies were then collected and analyzed.

Fig 2

Relative quantification of the total bacterial population in the ampicillin-treated (A) and untreated (C) cockroach groups.

Experimental design depicting ampicillin treatment of B. germanica.

The cockroaches were divided into two groups (A and C) and individuals were either treated with ampicillin (A) or left untreated as control specimens (C). Ampicillin was administered to cockroaches from the G1 (i.e., offspring from G0) generation, 21 days after they had reached the adult stage. Whole bodies were then collected and analyzed. Relative quantification of the total bacterial population in the ampicillin-treated (A) and untreated (C) cockroach groups. Comparison of the microbial composition data showed, in the control group, the endosymbiont Blattabacterium CP001487_s was the most abundant (27.43%), followed by Fusobacterium varium. By contrast, Desulfovibrio_g2 was the most abundant (64.39%) in the ampicillin-treated group (Fig 3A). LEfSe analysis of sampled cockroaches showed that, in the control group, Blattabacterium CP001487_s showed the greatest difference in composition, followed by F. varium, Rhodopila_uc, and Dysgonomonas_uc (Fig 3B). In the ampicillin-treated group, Desulfovibrio_g2 and Planctomycetes were the bacteria that showed the greatest differences in abundance (Fig 3B). Analysis of alpha diversity revealed a significantly lower number of operational taxonomic units (OTUs) (P = 0.009) in the ampicillin-treated group (Fig 4A). Although not statistically significant, phylogenetic diversity tended to be low in the ampicillin-treated group (P = 0.076) (Fig 4B), indicating low overall abundance. A significant difference was noted in the Shannon diversity index, reflecting richness and equity simultaneously (P = 0.009) (Fig 4C). Analysis of diversity using UPGMA clustering showed that the samples from the control and ampicillin-treated groups were clustered separately (S1A Fig). Similarly, principal coordinates analysis showed that both groups were clustered separately, with samples from the ampicillin-treated and control groups located on the left and right sides of the plot, respectively (S1B Fig).
Fig 3

Bacterial composition at the species level in the control and ampicillin-treated groups.

(A) Microbiome composition of each group (n = 5). (B) Linear discriminant analysis effect size analysis of differentially abundant bacterial taxa among the two groups. Only taxa meeting a significant (>4) linear discriminant analysis threshold are shown.

Fig 4

Box plots showing alpha diversity in the control and ampicillin-treated groups.

(A) The number of operational taxonomic units. (B) Phylogenetic diversity (abundance). (C) Shannon diversity index (measuring richness and equity in the distribution of the species). * indicates a P-value < 0.05 from the Wilcoxon rank-sum test.

Bacterial composition at the species level in the control and ampicillin-treated groups.

(A) Microbiome composition of each group (n = 5). (B) Linear discriminant analysis effect size analysis of differentially abundant bacterial taxa among the two groups. Only taxa meeting a significant (>4) linear discriminant analysis threshold are shown.

Box plots showing alpha diversity in the control and ampicillin-treated groups.

(A) The number of operational taxonomic units. (B) Phylogenetic diversity (abundance). (C) Shannon diversity index (measuring richness and equity in the distribution of the species). * indicates a P-value < 0.05 from the Wilcoxon rank-sum test. RNA-sequencing was performed to explore the effect of ampicillin on gene expression in cockroaches. UPGMA clustering results showed that the control group was grouped together, but that one ampicillin-treated sample was clustered separately (Fig 5A). Principal components analysis (PCA) confirmed that separation was achieved between the control and ampicillin-treated groups (Fig 5B). Hierarchical clustering analysis between the control and ampicillin-treated groups generated a heat map of 1,236 DEGs for both groups (Fig 5C). Gene Ontology (GO) functional classification analysis revealed that these 1,236 DEGs were divided among three main categories (biological process, cellular component, and molecular function), where differential expression more than doubled in 28, 16, and 13 items, respectively, between the control and ampicillin-treated groups (Fig 6).
Fig 5

Transcriptome analysis in ampicillin-treated and control cockroaches.

(A) UPGMA (unweighted pair group method with arithmetic mean) clustering. (B) Principal components analysis depicting the differences in the differentially expressed genes (DEGs) between the control and ampicillin-treated groups. (C) Heat map of transcriptional expression patterns of the two groups, displaying the expression profile of the top 1,236 DEGs for each sample in the RNA-seq dataset.

Fig 6

Gene Ontology (GO) functional classification analysis of differentially expressed genes (DEGs) between the control and ampicillin-treated groups.

Based on sequence homology, 1,236 DEGs were categorized into three main categories, biological process, cellular component, and molecular function, with 28, 16, and 13 functional groups, respectively.

Transcriptome analysis in ampicillin-treated and control cockroaches.

(A) UPGMA (unweighted pair group method with arithmetic mean) clustering. (B) Principal components analysis depicting the differences in the differentially expressed genes (DEGs) between the control and ampicillin-treated groups. (C) Heat map of transcriptional expression patterns of the two groups, displaying the expression profile of the top 1,236 DEGs for each sample in the RNA-seq dataset.

Gene Ontology (GO) functional classification analysis of differentially expressed genes (DEGs) between the control and ampicillin-treated groups.

Based on sequence homology, 1,236 DEGs were categorized into three main categories, biological process, cellular component, and molecular function, with 28, 16, and 13 functional groups, respectively. RNA-seq showed that the expression level of Bla g 2 decreased by four times in the ampicillin-treated group (S1 Table). Subsequently, RNA levels of the genes encoding the three major allergens Bla g 1 (Fig 7A), Bla g 2 (Fig 7B), and Bla g 5 (Fig 7C) were measured using qPCR. Our findings confirmed that the expression levels of Bla g 1 (P = 0.000594) and Bla g 2 (P < 0.00001), but not Bla g 5 (P = 0.05067), were significantly decreased in the ampicillin-treated group compared to those in the control group. Additionally, we noted a larger decrease in the level of Bla g 2 than that of Bla g 1 (Fig 7).
Fig 7

Quantitative PCR (qPCR) analysis showing gene expression levels in cockroaches.

(A) Bla g 1, (B) Bla g 2, and (C) Bla g 5.

Quantitative PCR (qPCR) analysis showing gene expression levels in cockroaches.

(A) Bla g 1, (B) Bla g 2, and (C) Bla g 5. At the protein level, we measured the amounts of Bla g 1 (S2A Fig), Bla g 2 (S2B Fig), and Bla g 5 (S2C Fig). The results were similar to those obtained from transcriptomic analyses. No significant difference was detected in Bla g 5 (P = 0.296897), whereas a significant decrease in the expression of Bla g 1 (P = 0.000463) and Bla g 2 (P = 0.00001) was observed in the ampicillin-treated group compared to that in the control group. Here, Bla g 2 sustained yet again a more notable decrease than Bla g 1 (S2 Fig).

Discussion

We treated cockroaches (B. germanica) with ampicillin to obtain a protein extract containing a minimal number of bacteria for immunotherapy. Analysis of B. germanica following treatment revealed several changes. First, the total bacterial population was notably affected. Compared with the control group, total bacteria in cockroaches from the ampicillin-treated group disappeared almost completely, perhaps because ampicillin eliminated both gram-positive and gram-negative bacteria. One of the objectives of the study was to produce a protein extract of cockroach with a reduced bacteria content. When rearing cockroaches for clinical use such as for allergy diagnosis and immunotherapy, strict control of the bacteria using measures such as ampicillin treatment is recommended. The microbiome study revealed marked differences at the species level. A ‘super-resistant’ taxon was previously identified in B. germanica treated with rifampicin instead of ampicillin [4]. The Desulfovibrio and Planctomycetes genera occurred in lower numbers in control cockroaches but comprised most of the microbiota of ampicillin-treated cockroaches. This finding is supported by the fact that all Plantomycetes are resistant to β-lactam antibiotics [24], including ampicillin, which belongs to the penicillin group of antibiotics. Similarly, Desulfovibrio and Adiutrix are resistant to ampicillin, which eliminated other bacterial species. Among the several bacterial species found in the control group, Blattabacterium is the most important. In a previous study, treatment with rifampicin failed to eliminate Blattabacterium from the first generation of cockroaches; however, with continued treatment, the bacteria were eliminated from second-generation specimens [4]. Our data showed that treatment with ampicillin immediately eliminated Blattabacterium from first-generation adults. Blattabacterium is an endosymbiont of B. germanica, in which it is involved in the synthesis of essential amino acids and various vitamins, as well as in nitrogen recycling [25]. A previous study showed that tetracycline removed the endosymbiont of Riptortus pedestris, and that the expression of genes encoding hexamerin and vitellogenin was reduced. Consequently, these findings confirmed the factors that affected egg production and development [6]. Here, we expected that the absence of an endosymbiont would lead to several changes. Essentially, the reported decrease in bacterial composition produced differences in alpha and beta diversity. Because ampicillin reduced the bacterial load, OTUs were significantly lower in the ampicillin-treated group than in the control group. Phylogenetic diversity (indicating abundance) was not significantly different but tended to be lower in the ampicillin-treated group. The Shannon diversity index significantly decreased, reducing both richness and equity. Analysis of beta diversity using UPGMA and PCoA showed a clear difference in clustering between the two groups. RNA-seq was performed to identify changes in gene expression at the RNA level caused by ampicillin. Results similar to those from microbiome clustering analysis were confirmed at the RNA level. Hierarchical clustering and heat map analysis showed that one of the ampicillin-treated samples was clustered separately, but samples in the control group clustered well. PCA confirmed that each group was well clustered. Most of the ampicillin-treated B. germanica showed decreased levels of DNA; however, gene levels were either substantially increased or decreased at the RNA level. DEGs were enriched in biological, metabolic, and cellular processes. Differential expression of various genes from the two groups was also noted in developmental process and growth, as well as in cellular component, with several differences noted between the cells and the organelles. The RNA-seq data showed that the expression level of the Bla g 2 gene (encoding aspartic protease) was reduced by more than four times following ampicillin treatment (S1 Table). Therefore, gene expression levels for the major allergens Bla g 1, Bla g 2, and Bla g 5 were further measured via qPCR, and the protein production level was also measured. Similar patterns of expression changes of the major allergens Bla g 1, Bla g 2, and Bla g 5 were observed at both the mRNA and protein levels. There was no significant difference in Bla g 5 expression between the ampicillin-treated cockroaches and control group, but its abundance tended to be lower in the ampicillin-treated group than in the control group. By contrast, Bla g 1 and Bla g 2 showed a significant decrease in abundance in the ampicillin-treated group compared to the control group. The exact mechanism of allergen production in German cockroaches is unknown. However, clear differences in Bla g 1 production were observed based on the insect’s level of starvation or its stage in the gonadotropic cycle [9]. Therefore, we expected to observe changes caused by several factors in the present study as well. Bacteria were removed by ampicillin treatment and likely included species that promoted the growth of cockroaches, accounting for the difference in total bacteria. The inhibition of bacterial growth may have affected allergen production, with Blattabacterium being probably the most influential member of the cockroach microbiota. This endosymbiont is responsible for the nitrogen cycle and the production of essential amino acids and vitamins in the German cockroach [25]. Moreover, in other insects, Blattabacterium reduces the expression of genes involved in reproduction and growth inhibition. Similar growth rates were observed in R. pedestris originally without the endosymbiont and in those treated with antibiotics to remove the bacterium [6]. German cockroaches may also experience changes in reproduction and growth due to the removal of Blattabacterium. RNA-seq highlighted numerous changes in gene expression. Therefore, we suggest that ampicillin may have influenced the production of allergens. Although antibiotics primarily affect bacteria, they may also indirectly affect allergens through their effects on bacteria. In this study, treatment with ampicillin eliminated Blattabacterium, an endosymbiont of B. germanica, and reduced the production of several allergens. This suggests that Blattabacterium may play a key role in allergen production in cockroaches either directly or indirectly. To the best of our knowledge, the effect of the microbiome on cockroach allergens has not been reported. However, in Riptortus pedestris, the absence of the endosymbiont Burkholderia spp. led to a decrease in vitellogenin, an allergen in B. germanica [26]. A limitation of this experiment was that it was not possible to culture Blattabacterium alone. If Blattabacterium in German cockroaches could be specifically regulated, it would be possible to study only the effects of Blattabacterium on allergen production while excluding those of other bacteria. In the present study, protein extraction from ampicillin-treated B. germanica was optimized to obtain an extract containing a small amount of Bla g 2 compared to Bla g 1 and Bla g 5, with very few bacteria. Ampicillin treatment reduced total numbers of bacteria associated with cockroaches. As a result, we suggest that reduced numbers of bacteria may have influenced the production of allergens. Future studies should investigate the effect of bacteria on the therapeutic efficacy of immunotherapy using protein extracts obtained from the German cockroach. In addition, further research is needed to confirm that a reduced allergen content of the cockroach protein extract after ampicillin treatment may induce immune tolerance in immunotherapy recipients. Furthermore, a comparative study on the effect of ampicillin treatment on the microbiome and allergen production between adult and nymph cockroaches is needed.

Beta diversity in the control and ampicillin-treated groups.

(A) UPGMA (unweighted pair group method with arithmetic mean) clustering. (B) Principal coordinates analysis depicting differences in the taxonomic compositions of the bacterial communities among the two groups. (TIF) Click here for additional data file.

Allergen levels in the extracts from the two cockroach groups.

Concentrations of (A) Bla g 1, (B) Bla g 2, and (C) Bla g 5 in the extracts were measured using enzyme-linked immunosorbent assays. (TIF) Click here for additional data file.

List of differentially expressed genes (DEGs) between the control and ampicillin-treated groups.

(XLSX) Click here for additional data file. 24 Sep 2021 PONE-D-21-26586Reduced production of the major allergen Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatmentPLOS ONE Dear Dr. Yong, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Nov 08 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Chun Wie Chong Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: [This study was supported by a National Research Foundation of Korea (NRF) Grant funded by the Korean Government (MEST; Numbers NRF-2019R1A2B5B01069843 and NRF-2020R1I1A2074562).] We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [Acknowledgments: This study was supported by a National Research Foundation of Korea (NRF) Grant funded by the Korean Government (MEST; Numbers NRF-2019R1A2B5B01069843 and NRF-2020R1I1A2074562).] Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed. Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ. 4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. 5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript prepared by Lee and team reported interesting findings that ampicillin-treated cockroaches had significantly reduced total bacteria or gut microbiome which eventually contributed to lower Bla g 1 and 2 allergen levels. The manuscript was organised in an easy-to-follow manner and very limited syntax errors. All the data were analysed and presented systematically. The manuscript can be considered for publication at PloS One after few minor amendments. The aim of the reported study was to obtain extract of B. germanica with reduced levels of bacteria/allergen for immunotherapy. Wonder the reduced allergenicity (reduced Bla g 1 and 2 allergens) after ampicillin treatment be able to trigger immune recognition/stimulation of the recipient of the immunotherapy? Has this been verified? How many biological replicates were conducted? How about the allergenicity and concentrations of other allergens (besides Bla g 1, 2 and 5 allergens)? Any clues? How significant are other allergens on allergenicity and/or immunotherapy? Shall this be verified or take into consideration? Suggest providing some background summary of other allergens also. How do you assign the newly hatched cockroaches into control and treatment group? How do you determine the sex (male/female) of the newly hatched? What is the rationale of using G1 and female cockroaches for this experiment? Will the cockroaches treated with ampicillin be able to produce eggs? Are there any morphological and development changes to the ampicillin-treated cockroaches after endosymbiont/microbiome changes? Will the overgrowth of the ampicillin-resistant bacteria affect the allergenicity of the cockroaches? Were the five cockroaches use for the DNA extraction female? How many samples were used for next-generation sequencing? All five, three or pool of 5? With reference to your method on protein extraction (lines 144-147), wonder will sonication be sufficient to solubilise/release most of the proteins of the cockroach? Please specify clearly where the total RNA was extracted from. Was it from the same five cockroaches that were used for DNA extraction? Another aspect that you highlighted is the standardisation of allergen for immunotherapy, how would you standardise your protein extract? Which generation of the ampicillin treated cockroaches would you recommend? Any feasibility or practically analyses? The authors may consider revising and standardising the reference format and abbreviation (e.g. PCA / PCoA) used within the article and also according to the journal’s specification/requirement. Reviewer #2: The authors analysed and compared between the microbiomes of the German cockroach (Blattella germanica) treated with ampicillin and the untreated control. The aim for the antibiotic treatment was to reduce the total bacterial population that may directly or indirectly be involved in allergen production found in the cockroach. This would assist in producing protein (allergen) extracts with minimal presence of the bacteria for immunotherapy. Overall, the manuscript was well-written. The microbiome data analyses based on 16S rRNA amplicon sequencing and RNA-seq were thorough. An adequate number of samples and statistics were also included. However, whilst the manuscript is technically sound, there are several issues that I would like to highlight to the authors. Addressing these comments by the authors would hopefully help to strengthen their manuscript. The comments are categorised under major, minor and miscellaneous as follows: Major comments 1. In the introduction, the authors stressed that resident bacteria play a role in the insect’s growth and reproduction, and antibiotic treatments alter its microbiome composition. The authors then presented their results that supported the latter. They showed that antibiotics brought about several changes to the bacterial population, microbiome composition, gene expression and allergen (bla protein) quantification, etc. These are all justified. However, the underlying motivation of this study (i.e. through antibiotic treatment of B. germanica), as stated by the authors (in the abstract, introduction and discussion), was to obtain the allergen protein extracts with “minimal amount of bacteria” for immunotherapy purposes. The authors brought this argument only towards the end of the introduction (lines 81-88), and mentioned this aim very briefly in the discussion (lines 320-321) without providing a strong justification for the antibiotic treatment. I wondered if filter sterilising the crude extracts (line 146) would solve the problem i.e. to obtain the protein extracts without bacteria and without needing the antibiotic application. If filter-sterilising the extracts do not work, why not? In addition, the justification/rationale for the microbiome analyses were weak and were not even highlighted at the end of the introduction despite these analyses being the major results of this study. What questions were the authors attempting to answer by performing the microbiome analyses? What was the rationale? The authors need to address the above gaps by providing and elaborating on the reasoning behind the study and analyses presented. The justification should be clarified in the introduction and re-stated in the discussion, and should be linked to the results in a meaningful way. Doing so serves as a fundamental basis to any scientific study including this one. 2. The discussion section, although in general was well-written, lacked the depth necessary to understand the results in a more meaningful way. Most of what was written in the discussion is a reiteration of the results. For example, it is clear that the antibiotic treatment gave rise to ‘super-resistant’ taxa (Desulfovibrio and Plantomycetes) in/on the cockroach, and the control cockroach contained Blattabacterium as the main taxon (lines 327-354). However, how does these results relate to the Bla protein production quantified in the study or other insights that might be derived from the results? The authors could extend this discussion by e.g. stating that it is probably Blattabacterium that may be involved in the allergen production by the cockroach directly/indirectly and provide evidence based on the other results and those of past studies related to the study’s main objective. The arguments presented for the RNA-seq results (lines 355-368) were also equally weak. The authors found that there was a “significant difference in the molecular functions related to catalytic activity and binding” (line 366) but did not link these to anything relevant in this study. Gene expression of the microbiome was found higher in antibiotic-treated cockroach compared to control, but can the authors speculate why this was so? The authors discussed that ampicillin may have influenced the production of allergens directly or indirectly (lines 390-392), which I agree, based on their results. However, would it be possible to do some correlation analyses between the results the authors obtained to support this statement? The authors went on by stating that a limitation of the study was that Blattabacterium is not yet culturable. However, there are methods that the authors can use e.g. qPCR, FISH, to study the bacterium’s behaviour against the bacterial population. These can be explored and mentioned. Minor comments 1. Some of the results, e.g. Figs. 5 and 9, only re-iterated the message of the earlier figure(s) and thus could be better presented as supplementary data. This ensures that the section is more concise. 2. In addition to the results, there are also data that the authors should provide as supplementary. These were mentioned as ‘data not shown’ (lines 99, 296). Having these data available are in line with PLOS ONE’s principles on data transparency, availability and reproducibility. 3. Some of the methods need to be a bit more elaborated, particularly on ELISA (lines 150-151) and TRIZOL RNA extraction (Line 154). 4. Some sub-sections in the methods need to be condensed, re-organised and have its format readjusted. Repetition was found for sample processing (Line 107-112), RNA extraction/cDNA libraries (Lines 153-157; Lines 178-184), statistical analyses (Lines 130-141; lines >200). Reorganisation/merging the sub-sections would make it less repetitive and ensure that readers can follow the procedures better. Miscellaneous Line 62: Reference to the author is missing Line 82: What do the authors mean by “suitable” protein extract? What is considered “suitable”? This comment links to the first major comment of this review. Line 85-86: The effect of cockroach on what? The same also goes for line 395: ‘the effects of Blattabacterium” on what? And line 402: To investigate the effect of bacteria on patients in what sense? These need more clarification. Line 99: Add ‘the’ before ‘concentration’ Line 117-118: Format adjustment required Line 127: Table caption should be placed before the table Line 130-131: “Bioinformatic analyses”, not “bioinformatics analyses” Line 279-280: The authors mentioned that the 1236 DEGs doubled, but which one doubled? Was it in ampicillin-treated group? Please clarify. Line 295-296: “The expression of Bla g 2 RNA more than doubled in the ampicillin-treated group”. Isn’t this ironic compared to the results presented in Figs. 8 and 9? What is the difference between this result not shown and the results presented in Fig. 8? Aren’t they both RNA-seq of the bla gene? Line 352: Ratio of bacteria to what? Line 358-359: What did the authors mean by “clustering occurred first among the control group”? Line 369-370: This opening statement is confusing when the authors stated “…to confirm changes in the allergens according to the changes”. Please rephrase this. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Reviewer Recommendation and Comments for Manuscript Number PONE.docx Click here for additional data file. 25 Oct 2021 Oct 21, 2021 Dr Emily Chenette Editor-in-Chief PLoS One Re: #PONE-D-21-26586; “Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatment” Dear Editors and Reviewers: Thank you for your helpful comments regarding our manuscript titled “Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatment” (#PONE-D-21-26586) and for providing us with the opportunity to submit a revised version. We have carefully revised the manuscript to reflect the comments of the reviewers, addressing all issues and questions raised. We believe that the quality of this manuscript has been greatly improved thanks to your invaluable comments. Once again, thank you very much for your consideration and effort. Please find the point-by-point responses to each of the reviewers’ comments attached. We hope that the manuscript will now be deemed suitable for publication in PLoS One. I look forward to hearing from you. Sincerely, Tai-Soon Yong Department of Environmental Medical Biology, Institute of Tropical Medicine and Arthropods of Medical Importance Resource Bank, Yonsei University College of Medicine Seoul 03722, Korea Telephone: +82-2-2228-1841 Fax: +82-2-363-8676 E-mail: tsyong212@gmail.com Responses to Reviewer Comments Reviewer #1: The aim of the reported study was to obtain extract of B. germanica with reduced levels of bacteria/allergen for immunotherapy. Wonder the reduced allergenicity (reduced Bla g 1 and 2 allergens) after ampicillin treatment be able to trigger immune recognition/stimulation of the recipient of the immunotherapy? Has this been verified? -> Thank you for raising this important comment. This study did not demonstrate that reduction in allergens can trigger immune recognition/stimulation of the recipient of the immunotherapy. To address this point, we have added the following statement to the Discussion that further research on this aspect is needed: (Lines 417–419, in DISCUSSION) In addition, further research is needed to confirm that a reduced allergen content of the cockroach protein extract after ampicillin treatment may induce immune tolerance in immunotherapy recipients. How many biological replicates were conducted? -> We have added the following sentence to the Materials and Methods to clarify this part of the experimental design: (Lines 112–113, in MATERIALS AND METHODS) Three biological replicates were analyzed. How about the allergenicity and concentrations of other allergens (besides Bla g 1, 2 and 5 allergens)? Any clues? How significant are other allergens on allergenicity and/or immunotherapy? Shall this be verified or take into consideration? Suggest providing some background summary of other allergens also. -> We only measured the Bla g 1, Bla g 2, and Bla g 5 allergens in this study. These were selected as they are the major allergens that cause allergic sensitization and commonly result in symptoms. We agree that it would have been ideal to have measured other minor allergens, but unfortunately we did not have sufficient RNA and protein samples to measure all allergens. In addition, there are only commercial kits available for the German cockroach allergens Bla g 1, Bla g 2, and Bla g 5. We have added the following sentence to the Discussion to justify this choice: (Lines 377–378, in DISCUSSION) Gene expression levels for the major allergens Bla g 1, Bla g 2, and Bla g 5 were further measured… How do you assign the newly hatched cockroaches into control and treatment group? How do you determine the sex (male/female) of the newly hatched? -> Newly hatched cockroaches were randomly divided into the two groups. After breeding with a male cockroach and rearing the newly hatched cockroaches until reaching the adult stage, only females were used in the experiment. We have added the word “randomly” in the following sentence of the Materials and Methods to clarify this point: (Lines 105–106, in MATERIALS AND METHODS) Newly hatched cockroaches (G1) were randomly divided into two groups. What is the rationale of using G1 and female cockroaches for this experiment? -> We used G1 cockroaches because we had to administer the ampicillin treatment immediately after hatching. Although not described in this manuscript, female cockroaches were used for an initial reproduction study. Will the cockroaches treated with ampicillin be able to produce eggs? -> The cockroaches laid eggs, but few offspring were born. Therefore, we are currently focusing on this issue to determine the reasons for the impact on fertility. Are there any morphological and development changes to the ampicillin-treated cockroaches after endosymbiont/microbiome changes? -> There was no statistically significant difference in the development rate or size between groups in our study. Will the overgrowth of the ampicillin-resistant bacteria affect the allergenicity of the cockroaches? -> Since the total amount of bacteria was greatly reduced by the treatment, it appears unlikely that the treatment resulted in ampicillin-resistant bacteria overgrowth. Were the five cockroaches use for the DNA extraction female? How many samples were used for next-generation sequencing? All five, three or pool of 5? -> The powder of the crushed body of each cockroach was used for DNA, RNA, and protein extraction. Five DNA samples were used in the microbiome study. For RNAseq, 3 out of the 5 RNA samples were used. We have added the following to the Material and Methods to clarify: (Line 185, in MATERIALS AND METHODS) (n = 3 from each group) With reference to your method on protein extraction (lines 144-147), wonder will sonication be sufficient to solubilise/release most of the proteins of the cockroach? -> As mentioned above, the powder of the crushed body of each cockroach was used for DNA, RNA, and protein extraction. Since only one-third of each cockroach was used for protein extraction, there was almost no fat in the sample and therefore there was no need to remove fat. In addition, since this was a microbiome-sensitive study, the protein manufacturing process was minimized to reduce potential contamination. Please specify clearly where the total RNA was extracted from. Was it from the same five cockroaches that were used for DNA extraction? -> We have added the following sentence to clarify the sampling methods: (Lines 111–112, in MATERIALS AND METHODS) The powder of the crushed body of each cockroach was used for DNA, RNA, and protein extraction. Another aspect that you highlighted is the standardisation of allergen for immunotherapy, how would you standardise your protein extract? -> In this study, we propose a method for producing a cockroach extract using ampicillin. This method can help to reduce the amount of bacteria compared to the conventional method, and it was confirmed that the amount of allergen is also changed by this treatment. In addition, we have added the following statement to the Discussion that additional studies are needed to apply this method for producing an immunotherapeutic agent. (Lines 417–419, in DISCUSSION) In addition, further research is needed to confirm that a reduced allergen content of the cockroach protein extract after ampicillin treatment may induce immune tolerance in immunotherapy recipients. Which generation of the ampicillin treated cockroaches would you recommend? Any feasibility or practically analyses? -> We treated the cockroaches with antibiotics as soon as they hatched. In the future, we plan to study the effects of antibiotic treatment at the adult stage. The authors may consider revising and standardising the reference format and abbreviation (e.g. PCA / PCoA) used within the article and also according to the journal’s specification/requirement. -> We have revised abbreviation (e.g. PCA / PCoA) used within the article. In addition, references were carefully checked to meet the journal’s standards Reviewer #2: The authors analysed and compared between the microbiomes of the German cockroach (Blattella germanica) treated with ampicillin and the untreated control. The aim for the antibiotic treatment was to reduce the total bacterial population that may directly or indirectly be involved in allergen production found in the cockroach. This would assist in producing protein (allergen) extracts with minimal presence of the bacteria for immunotherapy. Overall, the manuscript was well-written. The microbiome data analyses based on 16S rRNA amplicon sequencing and RNA-seq were thorough. An adequate number of samples and statistics were also included. However, whilst the manuscript is technically sound, there are several issues that I would like to highlight to the authors. Addressing these comments by the authors would hopefully help to strengthen their manuscript. The comments are categorised under major, minor and miscellaneous as follows: Major comments 1. In the introduction, the authors stressed that resident bacteria play a role in the insect’s growth and reproduction, and antibiotic treatments alter its microbiome composition. The authors then presented their results that supported the latter. They showed that antibiotics brought about several changes to the bacterial population, microbiome composition, gene expression and allergen (bla protein) quantification, etc. These are all justified. However, the underlying motivation of this study (i.e. through antibiotic treatment of B. germanica), as stated by the authors (in the abstract, introduction and discussion), was to obtain the allergen protein extracts with “minimal amount of bacteria” for immunotherapy purposes. The authors brought this argument only towards the end of the introduction (lines 81-88), and mentioned this aim very briefly in the discussion (lines 320-321) without providing a strong justification for the antibiotic treatment. I wondered if filter sterilising the crude extracts (line 146) would solve the problem i.e. to obtain the protein extracts without bacteria and without needing the antibiotic application. If filter-sterilising the extracts do not work, why not? In addition, the justification/rationale for the microbiome analyses were weak and were not even highlighted at the end of the introduction despite these analyses being the major results of this study. What questions were the authors attempting to answer by performing the microbiome analyses? What was the rationale? The authors need to address the above gaps by providing and elaborating on the reasoning behind the study and analyses presented. The justification should be clarified in the introduction and re-stated in the discussion, and should be linked to the results in a meaningful way. Doing so serves as a fundamental basis to any scientific study including this one. -> Thank you very much for the comment and advice. Based on your comments, the following sentences have been added. We are grateful that you raised these issues, which has helped us to strengthen the rationale of the study in the manuscript. With regard to the method, we filtered live bacteria so that they were not included in the final protein extract. However, substances produced by bacteria such as lipopolysaccharide and bacterial DNA can pass through the filter. Nevertheless, antibiotics can decrease these as well. (Lines 86–88, in INTRODUCTION) The extract of the cockroach not only contains allergens but also harbors various immunomodulatory molecules such as endotoxin and bacterial DNA from the microbiome, which are not easily removed by the filtration process. (Lines 90–93, in INTRODUCTION) In addition, we attempted to investigate the amount and composition of the microbiome of cockroaches treated with ampicillin, and whether the production of allergens in the cockroach was affected by the treatment. (Lines 335–338, in DISCUSSION) One of the objectives of the study was to produce a protein extract of cockroach with a reduced bacteria content. When rearing cockroaches for clinical use such as for allergy diagnosis and immunotherapy, strict control of the bacteria using measures such as ampicillin treatment is recommended. 2. The discussion section, although in general was well-written, lacked the depth necessary to understand the results in a more meaningful way. Most of what was written in the discussion is a reiteration of the results. For example, it is clear that the antibiotic treatment gave rise to ‘super-resistant’ taxa (Desulfovibrio and Plantomycetes) in/on the cockroach, and the control cockroach contained Blattabacterium as the main taxon (lines 327-354). However, how does these results relate to the Bla protein production quantified in the study or other insights that might be derived from the results? The authors could extend this discussion by e.g. stating that it is probably Blattabacterium that may be involved in the allergen production by the cockroach directly/indirectly and provide evidence based on the other results and those of past studies related to the study’s main objective. According to your comments, we have added the following sentences to the Discussion: (Lines 403–406, in DISCUSSION) In this study, treatment with ampicillin eliminated Blattabacterium, an endosymbiont of B. germanica, and reduced the production of several allergens. This suggests that Blattabacterium may play a key role in allergen production in cockroaches either directly or indirectly. The arguments presented for the RNA-seq results (lines 355-368) were also equally weak. The authors found that there was a “significant difference in the molecular functions related to catalytic activity and binding” (line 366) but did not link these to anything relevant in this study. Gene expression of the microbiome was found higher in antibiotic-treated cockroach compared to control, but can the authors speculate why this was so? -> We agree with your opinion. The content related to “catalytic activity and binding” was removed because it did not seem to be directly relevant to the focus of the paper and therefore impacted flow. It seems that the sentence related to “microbiome’s gene expression” was also misunderstood. This sentence has also been removed. Alternatively, to provide clearer interpretation of the RNAseq data, we have added a section related to allergen (Bla g 2) production along with supplementary data (S1 Table): (Lines 375–379, in DISCUSSION) The RNA-seq data showed that the expression level of the Bla g 2 gene (encoding aspartic protease) was reduced by more than four times following ampicillin treatment (S1 Table). Therefore, gene expression levels for the major allergens Bla g 1, Bla g 2, and Bla g 5 were further measured via qPCR, and the protein production level was also measured. The authors discussed that ampicillin may have influenced the production of allergens directly or indirectly (lines 390-392), which I agree, based on their results. However, would it be possible to do some correlation analyses between the results the authors obtained to support this statement? Based on the results obtained at this point, we can speculate that the production of the allergen decreased after ampicillin treatment due to a reduction of the microbiome, including reduced abundance of Blattabacterium. The authors went on by stating that a limitation of the study was that Blattabacterium is not yet culturable. However, there are methods that the authors can use e.g. qPCR, FISH, to study the bacterium’s behaviour against the bacterial population. These can be explored and mentioned. -> Our intention with this statement was not regarding the measurement of the bacterial population but rather to gain control of the increase or decrease of the Blattabacterium population. We have corrected the sentence as follows for clarification: (Lines 408–409, in DISCUSSION) “… specifically targeted…”, � “… specifically regulated…”, Minor comments 1. Some of the results, e.g. Figs. 5 and 9, only re-iterated the message of the earlier figure(s) and thus could be better presented as supplementary data. This ensures that the section is more concise. -> Based on your comments, we have moved Figs. 5 and 9 to the supplementary data. 2. In addition to the results, there are also data that the authors should provide as supplementary. These were mentioned as ‘data not shown’ (lines 99, 296). Having these data available are in line with PLOS ONE’s principles on data transparency, availability and reproducibility. -> We have removed the following sentence: (Line 102, in MATERIALS AND METHODS) “The concentration of ampicillin was set based on data from a preliminary study, which showed that the concentration did not significantly affect the survival of B. germanica (data not shown).” -> The following sentence has been revised and a supplementary table has been added. (Lines 303–304) “RNA-seq showed that the expression level of Bla g 2 decreased by four times in the ampicillin-treated group (S1 Table).” 3. Some of the methods need to be a bit more elaborated, particularly on ELISA (lines 150-151) and TRIZOL RNA extraction (Line 154). -> We have modified or added the following sentences to the Materials and Methods. (Lines 152–157, MATERIALS AND METHODS) Cockroach protein extracts (2 mg/mL) were diluted 100-fold to measure Bla g 1 and Bla g 2 levels and were diluted 10-fold to measure Bla g 5 level using corresponding ELISA kits (Indoor Biotechnologies, Charlottesville, VA, USA) according to the manufacturer instructions. In brief, the detection antibody and conjugate mix were used for the immunoassay, and color development was performed with the substrate 3,3′,5,5′-tetramethylbenzidine. (Lines 161–162, MATERIALS AND METHODS) TRIZOL supernatant was added to react with the sample and was mixed with isopropanol to obtain a pellet. 4. Some sub-sections in the methods need to be condensed, re-organised and have its format readjusted. Repetition was found for sample processing (Line 107-112), RNA extraction/cDNA libraries (Lines 153-157; Lines 178-184), statistical analyses (Lines 130-141; lines >200). Reorganisation/merging the sub-sections would make it less repetitive and ensure that readers can follow the procedures better. We have closely reviewed the structure of the Methods section and have removed the following duplicated sentence: (Line 116, in MATERIALS AND METHODS) Cockroaches (n = 5 from each group) were frozen in liquid nitrogen and individually crushed using a mortar and pestle. The sample processing details for the microbiome and RNA-seq analyses were not removed given the different statistical processing methods. Miscellaneous Line 62: Reference to the author is missing -> We have added the reference to Line 63. Line 82: What do the authors mean by “suitable” protein extract? What is considered “suitable”? This comment links to the first major comment of this review. -> We hope that we have sufficiently responded to your first major comment. In “Cockroach Extract Composition Greatly Impacts T Cell Potency in Cockroach-Allergic Donors [13]” (attached), the degree of the patient’s allergen sensitivity depended on the allergen content in the extract. This was the basis of the phrase “suitable protein extract,” which refers to generating extracts of different allergen contents tailored for each individual. Line 85-86: The effect of cockroach on what? The same also goes for line 395: ‘the effects of Blattabacterium” on what? And line 402: To investigate the effect of bacteria on patients in what sense? These need more clarification. -> We have clarified the indicated sentences as follows: (Lines 84–86, in INTRODUCTION) Despite these variables, no studies have been conducted to determine the effect of bacteria in the cockroach on allergen production before extracting the protein for immunotherapy. (Lines 409–410, in DISCUSSION) the effects of Blattabacterium on allergen production (Lines 415–417, in DISCUSSION) Future studies should investigate the effect of bacteria on the therapeutic efficacy of immunotherapy using protein extracts obtained from the German cockroach. Line 117-118: Format adjustment required -> We have corrected the format Line 127: Table caption should be placed before the table -> We have changed the location of the table caption accordingly Line 279-280: The authors mentioned that the 1236 DEGs doubled, but which one doubled? Was it in ampicillin-treated group? Please clarify. -> This means that the greatest difference in any group was selected according to a more than two-fold difference. We have replaced “doubled” with “two-fold” for clarity. (Line 287, in RESULTS) Line 295-296: “The expression of Bla g 2 RNA more than doubled in the ampicillin-treated group”. Isn’t this ironic compared to the results presented in Figs. 8 and 9? What is the difference between this result not shown and the results presented in Fig. 8? Aren’t they both RNA-seq of the bla gene? -> We apologize for this error and thank you for your careful review. The indicated sentence was indeed a typographical error, which has been corrected as follows: (Lines 375–377, in DISCUSSION) The RNA-seq data showed that the expression level of the Bla g 2 gene (encoding aspartic protease) was reduced by more than four times following ampicillin treatment (S1 Table). Line 352: Ratio of bacteria to what? -> We have removed this problematic sentence. Line 358-359: What did the authors mean by “clustering occurred first among the control group”? -> This sentence has been modified as follows to clarify the meaning: (Lines 368–369, in DISCUSSION) …, but samples in the control group clustered well. Line 369-370: This opening statement is confusing when the authors stated “…to confirm changes in the allergens according to the changes”. Please rephrase this. -> According to your comment, we have revised the sentences as follows: (Line 380–381, in DISCUSSION) Therefore, gene expression levels for the major allergens Bla g 1, Bla g 2, and Bla g 5 were measured using qPCR, and the protein production level was also measured. (Lines 380–381, in DISCUSSION) Similar patterns of expression changes of the major allergens Bla g 1, Bla g 2, and Bla g 5 were observed at both the mRNA and protein levels. Submitted filename: Response to Reviewers.docx Click here for additional data file. 3 Nov 2021 PONE-D-21-26586R1Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatmentPLOS ONE Dear Dr. Yong, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Dec 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Chun Wie Chong Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments: Majority of the comments from reviewer 1 have been addressed in the revised version. However, some of the responses to the reviewer's comments were surprisingly left out from the main text. For instance, 1. The rational of using G1 cockroaches 2. The reduction of fertility after ampicillin treatment 3. No morphological differences between the cockroaches 4. The justification to use only sonification for protein extraction 5. The future plan to study the effect or ampicillin treatment to the adult cockroaches These should be included in the manuscript. Further, I am not convince that comment 2 from reviewer#2 (However, how does these results relate to the Bla protein production quantified in the study or other insights that might be derived from the results?) had been properly addressed. Also, has the link between Bla protein and microbiome been reported previously? If yes, please elaborate in discussion. Finally, please provide reference for the the assertion that "Blattabacterium may play a key role in allergen production in cockroaches". [Note: HTML markup is below. Please do not edit.] Reviewers' comments: [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 5 Nov 2021 Responses to Reviewer Comments For reviewer 1. 1. The rational of using G1 cockroaches -> We have included following sentence: (Lines 106–107 in MATERIALS AND METHODS) We used G1 cockroaches because we had to administer ampicillin immediately after hatching. 2. The reduction of fertility after ampicillin treatment -> We have included following sentence: (Lines 233–235 in RESULTS) The number of laid eggs did not vary between the groups, but the offspring were reduced approximately ten times after ampicillin treatment. 3. No morphological differences between the cockroaches -> We have included following sentence: (Lines 235–236 in RESULTS) In addition, no morphological differences were observed between the groups. 4. The justification to use only sonification for protein extraction -> We have included following sentence. (Lines 150–151 in MATERIALS AND METHODS) Defatting was not performed as there was little fat in the sample and to minimize bacterial contamination. 5. The future plan to study the effect or ampicillin treatment to the adult cockroaches -> We have included following sentence: (Lines 428–429 in DISCUSSION) Furthermore, a comparative study on the effect of ampicillin treatment on the microbiome and allergen production between adult and nymph cockroaches is needed. For reviewer 2. Further, I am not convince that comment 2 from reviewer#2 (However, how does these results relate to the Bla protein production quantified in the study or other insights that might be derived from the results?) had been properly addressed. Also, has the link between Bla protein and microbiome been reported previously? If yes, please elaborate in discussion. Finally, please provide reference for the the assertion that "Blattabacterium may play a key role in allergen production in cockroaches". To the best of our knowledge, the effect of the microbiome on cockroach allergens or that of antibiotic treatment on allergens has not yet been reported. However, in Riptortus pedestris, the absence of the endosymbiont, Burkholderia spp., led to a decrease in vitellogenin (the reference for this study has been added to the manuscript). Vitellogenin was reported as an allergen in B. germanica; however, Burkholderia spp. was not detected in our B. germanica samples. Based on our results, we inferred that "Blattabacterium may play a key role in allergen production in cockroaches"; therefore, there was no reference provided. -> The following sentences have been added in the manuscript. (Lines 408–414 in DISCUSSION) In this study, treatment with ampicillin eliminated Blattabacterium, an endosymbiont of B. germanica, and reduced the production of several allergens. This suggests that Blattabacterium may play a key role in allergen production in cockroaches either directly or indirectly. To the best of our knowledge, the effect of the microbiome on cockroach allergens has not been reported. However, in Riptortus pedestris, the absence of the endosymbiont Burkholderia spp. led to a decrease in vitellogenin, an allergen in B. germanica (26). Submitted filename: Response to Reviewers.docx Click here for additional data file. 8 Nov 2021 Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatment PONE-D-21-26586R2 Dear Dr. Yong, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Chun Wie Chong Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 12 Nov 2021 PONE-D-21-26586R2 Reduced production of the major allergens Bla g 1 and Bla g 2 in Blattella germanica after antibiotic treatment Dear Dr. Yong: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Chun Wie Chong Academic Editor PLOS ONE
  25 in total

1.  The novel structure of the cockroach allergen Bla g 1 has implications for allergenicity and exposure assessment.

Authors:  Geoffrey A Mueller; Lars C Pedersen; Fred B Lih; Jill Glesner; Andrea F Moon; Martin D Chapman; Kenneth B Tomer; Robert E London; Anna Pomés
Journal:  J Allergy Clin Immunol       Date:  2013-07-31       Impact factor: 10.793

2.  Rifampicin treatment of Blattella germanica evidences a fecal transmission route of their gut microbiota.

Authors:  Tania Rosas; Carlos García-Ferris; Rebeca Domínguez-Santos; Pablo Llop; Amparo Latorre; Andrés Moya
Journal:  FEMS Microbiol Ecol       Date:  2018-02-01       Impact factor: 4.194

3.  Allergen content in German cockroach extracts and sensitization profiles to a new expanded set of cockroach allergens determine in vitro extract potency for IgE reactivity.

Authors:  Jill Glesner; Stephanie Filep; Lisa D Vailes; Sabina Wünschmann; Martin D Chapman; Giovanni Birrueta; April Frazier; Kyoung Yong Jeong; Coby Schal; Leonard Bacharier; Avraham Beigelman; Paula Busse; Véronique Schulten; Alessandro Sette; Anna Pomés
Journal:  J Allergy Clin Immunol       Date:  2018-08-28       Impact factor: 10.793

4.  StringTie enables improved reconstruction of a transcriptome from RNA-seq reads.

Authors:  Mihaela Pertea; Geo M Pertea; Corina M Antonescu; Tsung-Cheng Chang; Joshua T Mendell; Steven L Salzberg
Journal:  Nat Biotechnol       Date:  2015-02-18       Impact factor: 54.908

5.  Molecular cloning of a major cockroach (Blattella germanica) allergen, Bla g 2. Sequence homology to the aspartic proteases.

Authors:  L K Arruda; L D Vailes; B J Mann; J Shannon; J W Fox; T S Vedvick; M L Hayden; M D Chapman
Journal:  J Biol Chem       Date:  1995-08-18       Impact factor: 5.157

6.  Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown.

Authors:  Mihaela Pertea; Daehwan Kim; Geo M Pertea; Jeffrey T Leek; Steven L Salzberg
Journal:  Nat Protoc       Date:  2016-08-11       Impact factor: 13.491

Review 7.  Cockroach allergen exposure and risk of asthma.

Authors:  D C Do; Y Zhao; P Gao
Journal:  Allergy       Date:  2016-02-04       Impact factor: 13.146

8.  Variability in German Cockroach Extract Composition Greatly Impacts T Cell Potency in Cockroach-Allergic Donors.

Authors:  Giovanni Birrueta; April Frazier; Anna Pomés; Jill Glesner; Stephanie Filep; Coby Schal; Kyoung Yong Jeong; Curtis McMurtrey; Thomas Vander Schans; William H Hildebrand; Paula Busse; Avraham Beigelman; Leonard B Bacharier; Bjoern Peters; Alessandro Sette; Véronique Schulten
Journal:  Front Immunol       Date:  2019-02-27       Impact factor: 7.561

9.  edgeR: a Bioconductor package for differential expression analysis of digital gene expression data.

Authors:  Mark D Robinson; Davis J McCarthy; Gordon K Smyth
Journal:  Bioinformatics       Date:  2009-11-11       Impact factor: 6.937

10.  Composition of the Cockroach Gut Microbiome in the Presence of Parasitic Nematodes.

Authors:  Cláudia S L Vicente; Sota Ozawa; Koichi Hasegawa
Journal:  Microbes Environ       Date:  2016-08-11       Impact factor: 2.912

View more
  1 in total

1.  Expression profiles of an inactive aspartic protease (Bla g 2 allergen) in different tissues and developmental stages of the German cockroach (Blattella germanica).

Authors:  Aaron R Rodriques; Aaron J Myers; Michael E Scharf; Uma K Aryal; Gary W Bennett; Ameya D Gondhalekar
Journal:  Arch Insect Biochem Physiol       Date:  2022-06-01       Impact factor: 2.454

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.