Role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma malignancy via the regulation of the microRNA-197-3p/anterior GRadient 2 axis.

OBJECTIVE: This study investigates the differential expression and the mechanism of long intergenic non-protein coding RNA (LINC) 01857 in hepatocellular carcinoma (HCC) proliferation and apoptosis.
METHODS: LINC01857 expression in HCC tissues and cells was evaluated. In addition, gain-of and loss-of functions were carried out to assess HCC cell proliferation and apoptosis. After that, LINC01857 subcellular localization was predicted and verified. Additionally, the binding relations between LINC01857 and microRNA (miRNA)-197-3p and between miR-197-3p and anterior GRadient 2 (AGR2) were detected and confirmed. Besides, HCC cell proliferation and apoptosis were assessed after silencing LINC01857 or overexpressing AGR2. Next, levels of key factors in the AKT and ERK pathways were measured. Additionally, xenograft transplantation was also conducted to confirm the effect of LINC01857 in HCC.
RESULTS: LINC01857 was overexpressed in HCC. Silencing LINC01857 leads to a blockage in HCC cell proliferation but improved apoptosis. LINC01857 could competitively bind to miR-197-3p and thus upregulate AGR2. miR-197-3p was poorly expressed in HCC, while AGR2 was overexpressed. Mechanistically, downregulated miR-197-3p or overexpressed AGR2 were observed to attenuate the effect of the LINC01857 knockdown on suppressing cell proliferation and enhancing apoptosis. Moreover, LINC01857 activated the AKT and ERK pathways through the manipulation of the miR-197-3p/AGR2 axis in HCC.
CONCLUSION: The results of this study indicated that LINC01857 was highly expressed in HCC, and it could improve HCC cell proliferation and reduce apoptosis via competitively binding to miR-197-3p, promoting AGR2 and upregulating the AKT and ERK pathways.

Introduction

Hepatocellular carcinoma (HCC) refers to a prevalent and lethal carcinoma classified under chronic hepatic disorders that leads to an unfavorable prognostic aftermath and high mortality [1, 2]. As a complicated tumor with heterogeneity, HCC accounts for almost 90% of primary liver neoplasms has emerged as a challenging dilemma and health burden worldwide [3]. HCC is a unique cancer that typically arises from chronic liver disease, and its incidence rate depends on the complex interaction among the host, disease and environmental factors, and chronic hepatitis B or C virus infection is the main risk factor worldwide [4]. Among HCC individuals at an early stage, excision, hepatic transplantation, therapeutic drugs and ablation are possible treatments [5]. Unfortunately, regarding advanced therapies, curable therapies are inaccessible and might cost a large amount of expenditure but just exert little efficiency on prognosis and overall survival rate [6]. Against this backdrop, acquaintance with the potential crosstalk in HCC is of increasing importance.

Long non-coding RNAs (lncRNAs) mediate cellular activities and influence physiological development, thus participating in different diseases and even tumors [7]. Furthermore, lncRNAs are dysregulated in HCC and they affect HCC cell viability, invasion, vascularization and apoptosis, rendering them necessary choices in HCC detection and therapy [8]. LINC01857 overexpression results in induced lymph node metastasis, cancer cell viability, frustrating clinical outcomes and tumor growth and inhibits apoptosis in human cancers, including gastric cancer and pancreatic ductal adenocarcinoma [9, 10]. Furthermore, based on the effect of LINC01857, its downstream network has been studied.

Competing endogenous RNA (ceRNA) is of great significance in human tumors as it closely connects lncRNAs, microRNAs (miRNAs) and circular RNAs into a tight link [11]. For instance, LINC01857 acts as a tumor promotor in breast cancer by sponging miR-1281 to encourage cell biological behaviors [12], suggesting that LINC01857 could function as a ceRNA to competitively bind to a miR and become involved in cancers. Furthermore, miRs are recognized as HCC inhibitors or drivers since they have contributory or destructive effects on cancer cell viability, apoptosis, metastasis and the epithelial-to-mesenchymal transition (EMT) [13]. miR-197-3p is poorly expressed in HCC, indicating a repulsive prognosis, while overexpressed miR-197-3p could reduce HCC cell metastasis [14]. A recent study has noted that miR-197-3p forms a ceRNA network by connecting circular F-box and WD repeat domain containing 7 (FBXW7) and FBXW7-185aa protein to mediate triple-negative breast cancer progression [15], corroborating that miR-197-3p is a capable factor in ceRNA mechanism. Additionally, it is documented that as a downstream mRNA in HCC, anterior Gradient homolog 2 (AGR2) is exhausted by an lncRNA/miR interaction to protect against HCC mobility [16]. Thus far, no studies directly explored the relationship between LINC01857 and HCC, or the downstream mechanism; however, based on the above evidence, LINC01857 likely exacerbates HCC via the miR-197-3p/AGR2 axis. We hope that this experiment could provide novel insights into HCC treatment.

Materials and methods

Ethics statement

This study was performed with the approval of the Clinical Ethical Committee of Shenzhen People’s Hospital. All procedures were strictly conducted in accordance with the code of ethics. The protocol was approved by the Institutional Animal Care and Use Committee of Shenzhen People’s Hospital. Great efforts were exerted to reduce animal number used and their suffering. The written informed consent was obtained from each participant.

Sample collection [16, 17]

From June 2017 to August 2019, 54 HCC patients undergoing surgery in Shenzhen People’s Hospital were recruited in our experiment to collect the HCC and paracancerous tissues. The separated tissues were immediately deposited in -80°C liquid nitrogen for further use. No patients received chemotherapy or radiotherapy before tissue excision. In addition, the clinical HCC staging was defined by the tumor node metastasis classification of malignant tumors by the Union for International Cancer Control.

Cell culture [18]

Human normal hepatic epithelial cells (HL-7702 cells, American Type Culture Collection (ATCC), Manassas, Virginia, USA) and human HCC cell lines (Hep3B, SMMC7721, Huh7 and HepG2 cells, Cell Bank of Chinese Academy of Sciences, Shanghai, China) were all cultured in Dulbecco’s modified Eagle’s medium (Invitrogen Inc., Carlsbad, CA, USA) consisting of 10% fetal bovine serum (FBS, Invitrogen) in a 37°C incubator with 5% CO2.

Cell treatment and grouping

Hep3B and HepG2 cells were injected with small hairpin-negative control (sh-NC) (sh-NC: 5’-AGAATAGCACGTGGCACACAC-3’) and sh-LINC01857 lentiviral vectors (sh-LINC01857: 5’-GCCAAAGCCCTGGACATAAGA-3’) (Shanghai Jima Company, Shanghai, China) (the multiplicity of infection was 30) and then treated by puromycin (2 μg/mL, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 48 h to identify cells that were stably silenced. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was conducted to examine the transection efficiency. In addition, miR-197-3p mimic, miR-197-3p inhibitor (IN), IN-NC, pcDNA-NC and pcDNA-AGR2 (Shanghai GenePharma Co, Ltd, Shanghai, China) were all transfected into the cells following the instructions of Lipofectamine 3000 (Invitrogen). After 48 h, the cells were collected for the subsequent experiments.

3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay [19]

Hep3B and HepG2 cell proliferation was analyzed using MTT assay. Cells (5×103 cells/well) in different groups were seeded into 96-well plates, with 100 μL cells per well. After the transfection, the cells were stained with MTT staining solution, and then the medium was refreshed with dimethyl sulfoxide solution (150 μL). The optical density (OD) at 490 nm was examined using a microplate reader (Model 550, Bio-Rad, Inc., Shanghai, China). Each step was repeated at least 3 times.

Colony formation assay [19, 20]

Hep3B and HepG2 cells (100 cells) in different groups were seeded into 6-well plates for 14 days, washed twice with phosphate buffer saline (PBS), fixed in 4% paraformaldehyde for 20 min, and incubated with 1% crystal violet solution for 30 min. Then, the cells were rinsed with running water, dried, photographed and analyzed with a camera (Nikon Instruments, Chiyoda-ku, Tokyo, Japan).

Flow cytometry

Subsequently, 100 μL Hep3B and HepG2 cell solutions (3×105 cells) were cultured with 5 μL fluorescein isothiocyanate-labeled Annexin V and 10 μL propidium iodide (Becton, Dickinson Company, NJ, USA) at room temperature in the dark for 15 min, and then mixed with 400 μL binding buffer solution for flow cytometry (Beckman Coulter, CA 92821, USA). The excitation wavelength was 488 nm, and 1×104 cells were counted.

Enzyme-linked immunosorbent assay (ELISA)

The ELISA kits were applied to determine the levels of B-cell lymphoma-2 (Bcl-2, ab272102) and Bcl-2-associated X (Bax, ab199080) (both from Abcam Inc., Cambridge, MA, USA) in the cells following the provided instructions of the manufactures. Then, the levels of Bcl-2 and Bax in the samples were examined according to the optical density (OD) value. Simply put, all kit components were rewarmed to room temperature and 40 μL sample diluent was added to the enzyme-coated plate. Next, 100 μL enzyme-labeled reagent was added to each well. The membrane was sealed and incubated at 37°C for 60 min. The liquid was then discarded, dried, and washed. Then 50 μL developer A was added to each well, and then 50 μL developer B, gently shaking. The color was developed in the dark at 37°C for 15 min, and then 50 μL termination solution was added to each well. The OD value was detected using a microplate reader (Bio-Rad, Hercules, CA, USA).

Fractionation of nuclear and cytoplasmic RNA assay [21]

According to the instructions of the NE-PER nuclear and cytoplasmic extraction reagent (Thermo, Scientific, Rockford, IL, USA), the nucleus and cytoplasm of the cells were separated. HepG2 and Hep3B cells (106) were resuspended in buffer C (20 mM Tris-GCl pH 7.5, 75 mM NaCl, 5 mM MgCl2, 0.5% p/w sodium deoxycholate, 0.2% Triton, 1 mM dithiothreitol (DTT) and 0.5% glycerol), and a protease inhibitor cocktail (Sigma) and RNase inhibitor (Thermo Scientific) were added. Supernatants containing cytoplasmic lysates were harvested after centrifugation. Then, the sphere-forming nuclei were washed with PBS; while the granular nuclei were resuspended in buffer N (10 mM Tris-HCl pH 8, 25 mM NaCl, 5 mM MgCl2, 1% p/w sodium deoxycholate, 1% Triton, 0.2% sodium dodecyl sulfate (SDS), 1 mM DTT) containing protease and RNase inhibitors and then sonicated.

RNA fluorescence in situ hybridization (FISH)

LINC01857 subcellular localization was assessed using the FISH kits (BIS-P0001, Guangzhou BersinBio, Guangzhou, Guangdong China). A digoxigenin-labeled LINC01857 probe hybridization solution was added to the cell slides, and antagonistic LINC01857 probes were used as an NC. The cell slides were hybridized at 42°C for 16 h, immersed in 2× sodium chloride-sodium citrate solution, soaked in 70% ethanol for 3 min and stained with 4’, 6-diamidino-2-phenylindole for 10 min. The cell slides were photographed under a Zeiss LSM880 NLO confocal microscope (Leica, Solms, Germany).

Dual-luciferase reporter gene assay

It was predicted that there were binding sites between LINC01857 and miR-197-3p and between miR-197-3p and AGR2 via the RNA22 database (https://cm.jefferson.edu/rna22/Interactive/) [22] and TargetSacn database (http://www.targetscan.org/vert_71/) [23]. Therefore, wild type (WT) and mutant type (MUT) vectors (Ambion, Austin, Texas, USA) of LINC01857 or AGR2 were respectively constructed. Next, the vectors were co-transfected with a miR-197-3p mimic or mimic NC into 293T cells (ATCC) via Lipofectamine 3000 (Invitrogen). After 48 h of transfection, cells were harvested using a dual-luciferase reporter gene assay system (Promega Corp., Madison, WI, USA) for the following detection of luciferase activity.

RNA immunoprecipitation (RIP)

miR-197-3p mimic or miR-197-3p-NC was transfected into Hep3B or HepG2 cells by Lipofectamine 3000 (Invitrogen). The cell lysates were pre-sealed with protein G beads, incubated with anti-AGO G beads (Pierce, Waltham, MA, USA) for 90 min at 4°C, and then centrifuged at 600 g for 1 min. Then, the beads were collected, washed five times with radio-immunoprecipitation assay (RIPA) buffer solution and resuspended in50 mmol/L Tris-HCl (pH 7.0). After 45 min of incubation at 70°C, the beads were reversely cross-linked to extract RNA, which was quantified by RT-qPCR.

RNA pull-down

miR-197-3p and NC were Biotinylated with biotinylated RNA mixture and T7/SP6 RNA polymerase. Biotinylated miR-197-3p and NC were transfected into Hep3B or HepG2 cells using Lipofectamine 3000 (Invitrogen). After 48 hours, the cells were collected and incubated with streptavidin-coupled beads. RT-qPCR was used to verify the expression of LINC01857 and AGR2 by RNeasy Mini Kit (cat# 74104, Qiagen).

RT-qPCR

According to the manufacturers’ instructions, the Trizol method (Invitrogen) was employed to separate the total RNA in tissue homogenates and cells. The RNA concentration was measured with a spectrophotometer (NanoVueTM, General Electric Company, Schenectady, NY, USA), and the RNA purity was evaluated by OD260/OD280 (1.8~2.0). Then 2 μg RNA was reverse transcribed into cDNA by RT kits (Invitrogen). Real-time PCR was carried out using an ABI7500 qPCR instrument (7500, ABI, Inc., Foster City, CA, USA). The reaction conditions included the cDNA template (1 μL), primers (1 μL), 2X SYBR Green Mix (10 μL, Shanghai GeneCore BioTechnologies Co., Ltd., Shanghai, China) and ddH2O (8 μL). PCR was performed using an ABI 7500 system platform (Applied Biosystems, Inc., Carlsbad, CA, USA). The primer sequences (Table 1) were designed by Sangon Biotech Co., Ltd. (Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 served as the internal reference and the 2-ΔΔCT method was employed to measure the relative expression level.

Table 1

Primers sequence of RT-qPCR.

Gene	Sequence (5’-3’)
LINC01857	F: ATGGCACGATCTCGGCTCACTGCA
	R: TTATAGGTGTGAGCCCCAGCGCCCA
miR-197-3p	F: TTCACCACCTTCTCCACCCAGC
	R: GCTGGGTGGAGAAGGTGGTGAA
AGR2	F: ATGGAGAAAATTCCAGTGTCAGCAT
	R: TTACAATTCAGTCTTCAGCAACT
GAPDH	F: ATGGTTTACATGTTCCAATATG
	R: TTACTCCTTGGAGGCCATGTGG
U6	F: CGCTTCGGCAGCACATATAC
	R: AATATGGAACGCTTCACGA

Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; LINC, long intergenic non-protein coding RNA; miR, microRNA; AGR2, anterior GRadient 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse

Western blot analysis

Cells were mixed with RIPA lysis buffer (Beyotime Biotechnology Co., Ltd, Shanghai, China) consisting of protease inhibitor cocktail (Sigma), lysed on ice 30 min and centrifuged at 13000 rpm for 10 min with the supernatant extracted. Then, the extracted proteins were quantified using a bicinchoninic acid kit (Beyotime). Subsequently, the same amount of proteins was transferred onto polyvinylidene fluoride membranes via an electrophoresis tank after SDS polyacrylamide gel electrophoresis. The membranes were removed, blocked with the correct amount of blocking reagent (PBST containing 3% FBS and 0.1% Tween-20) for 1 h and then incubated with the following primary antibodies (all from Abcam) at a 4°C shaker overnight: GAPDH (1: 2500, ab9485), p-protein kinase B (Akt) (1: 500, ab38449, 56kDa), p-extracellular signal-regulated kinase (ERK) (1: 1000, ab201015, 44kDa). Then, the membranes were cultivated with secondary antibody (ab182016, Abcam). Subsequently, the membranes were developed by Beyo ECL Plusd chemiluminescence and analyzed by Alpha Ease FC 4.0 (Alpha Innotech, CA, USA) to obtain the gray value of the bands.

Xenografts tumors in nude mice [21]

Additionally, 24 female BALB/c nude mice (6 weeks old, 18–22 g) (Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China, SYXK (Beijing) 2017–0033) were housed in microisolation cages. The mice were divided into the sh-LINC01857 group (mice were subcutaneously injected with 0.2 mL PBS containing 5×106 HepG2 cells infected with sh-LINC01857 on the right side of axillary) and the sh-NC group (mice were subcutaneously injected with 0.2 mL PBS containing 5×106 HepG2 cells infected with sh-NC on the right side of axillary) (n = 12). The mice were monitored daily, and the tumor volume was measured every 3 days. The tumor volume was assessed as V (mm3) = length×width2×0.5. Then, 15 days after the injection [21], the mice were euthanized; pentobarbital sodium (≥100 mg/kg) was intraperitoneally injected for the tumor separation and weighing. Tumors from every 6 mice were selected for immunohistochemistry and tumors from the other 6 mice were selected for RT-qPCR.

Immunohistochemistry [16]

Tumor tissues were sliced into paraffin-embedded sections (5 μm), dewaxed, dehydrated, subjected to antigen retrieval, and sealed with sheep serum (Beyotime) for 20 min with the sheep serum discarded. Subsequently, the sections were incubated with Ki67 primary antibody (ab16667, Abcam) at 4°C overnight. After that, the sections were incubated with Ki67 secondary antibody (ab205718, Abcam) for 1 h and then detected by DAB system (Beyotime).

Statistical analysis

SPSS 21.0 (IBM Corp. Armonk, NY, USA) was utilized to analyze data. The results were expressed as mean ± standard deviation. The data were normally distributed. A t-test was applied to perform comparisons between two groups, one-way or two-way analysis of variance (ANOVA) was used to compare different groups, and Sidak’s multiple comparisons test or Tukey’s post-hoc multiple comparisons test or Dunnett’s multiple comparisons test was used to analyze pairwise comparisons after ANOVA. A difference was considered statistically significant at a p value < 0.05.

Results

LINC01857 is overexpressed in HCC

To determine the role of LINC01857 in HCC, the Starbase database (http://starbase.sysu.edu.cn/panCancer.php) predicted that LINC01857 was robustly expressed in HCC (Fig 1A). Therefore, LINC01857 expression was measured in HCC and paracancerous tissues obtained from Shenzhen People’s Hospital, and the results revealed that LINC01857 was overexpressed in HCC tissues; moreover, according to the detection of LINC01857 expression in HCC cells and HL-7702 cells, LINC01857 was sufficiently upregulated in HCC cells as compared with that in HL-7702 cells (all p<0.01) (Fig 1B and 1C). In summary, LINC01857 was overexpressed in HCC and it might be associated with HCC tumorigenesis.

Fig 1

LINC01857 is overexpressed in HCC.

A, LINC01857 expression in HCC predicted by the Starbase database. B, LINC01857 expression in HCC and paracancerous tissues detected via RT-qPCR, n = 54. C, LINC01857 expression in HCC cells examined by RT-qPCR. Three independent repeated cell tests were performed. The results were presented as mean ± standard deviation. The paired t-test was applied to analyze the data in panel B. One-way ANOVA was employed to analyze the data in panel C. Tukey’s multiple comparisons test was employed for the post hoc test. ** p<0.01, *** p<0.001.

LINC01857 silencing leads to a blockage in HCC cell proliferation and promotes apoptosis

To determine the role of LINC01857 in HCC, LINC01857 expression was successfully silenced in HCC cells via the administration of sh-LINC01857 (all p<0.01) (Fig 2A). Subsequently, MTT and colony formation assay indicated that HCC cell proliferation was reduced (all p<0.01) (Fig 2B and 2C); while flow cytometry revealed that apoptosis was promoted (all p<0.01) (Fig 2D). Moreover, the levels of pro-apoptotic protein Bax and the anti-apoptotic protein Bcl-2 were measured through ELISA, which revealed that the Bax level was upregulated while the Bcl-2 level was decreased (all p<0.01) (Fig 2E). These findings suggested that silencing of LINC01857 suppressed HCC cell proliferation but enhanced apoptosis.

Fig 2

LINC01857 inhibition inhibits HCC cell proliferation and promotes apoptosis.

HCC cells were infected with sh-LINC01857, with sh-NC as NC. A, LINC01857 expression in HCC cells verified by RT-qPCR. B and C, HCC cell proliferation detected by MTT (B) and colony formation assay (C). D, apoptotic rate assessed by flow cytometry. E, levels of Bax and Bcl-2 in HCC cells measured via ELISA. Three independent repeated tests were conducted. The results were presented as mean ± standard deviation. One-way ANOVA was employed to analyze the data in panels A, C and D. Two-way ANOVA was employed to analyze the data in panels B and E. Tukey’s multiple comparisons test was applied for the post hoc test. ** p<0.01.

LINC01857 competitively binds to miR-197-3p to improve AGR2 expression

To clarify the downstream molecular mechanism of HCC cell proliferation and apoptosis, the fractionation of nuclear and cytoplasmic RNA assay and FISH assay were performed, which verified that LINC01857 was mainly located at the cytoplasm (all p<0.01) (Fig 3A and 3B), illustrating that LINC01857 could influence HCC by regulating downstream genes through the ceRNA network. Thus, downstream miRNAs and mRNAs of LINC01857 were probed, and we noticed that there were binding relationships between LINC01857 and miR-197-3p and between miR-197-3p and AGR2. Low expression of miR-197-3p was observed in HCC [14]. The downstream target gene AGR2 of miR-197-3p was highly expressed in HCC [16, 21]. We hypothesized that LINC01857 might affect HCC by sponging miR-197-3p to modulate AGR2 expression. Firstly, RIP assay confirmed that LINC01857 could competitively bind to miR-197-3p (all p < 0.01, Fig 3C). Then, based on the binding sites between LINC01857 and miR-197-3p and between miR-197-3p and AGR2 (Fig 3D), a dual-luciferase reporter gene assay was carried out, which revealed that LINC01857 bound to miR-197-3p and miR-197-3p bound to AGR2 (all p<0.01) (Fig 3E). In addition, the binding relationships between LINC01857 and miR-197-3p, miR-197-3p and AGR2 were also verified by RNA pull-down assay (all p < 0.01, Fig 3F). Besides, our experiment revealed that miR-197-3p was weakly expressed in HCC; while AGR2 was overexpressed (all p<0.01) (Fig 3G). Besides, in HCC cells with LINC01857 silencing, miR-197-3p expression was upregulated and AGR2 was downregulated (all p<0.01) (Fig 3H). Therefore, LINC01857 could competitively bind to miR-197-3p to improve AGR2 expression in HCC.

Fig 3

LINC01857 competitively binds to miR-197-3p to improve AGR2 expression.

A, LINC01857 expression in HCC cells detected by fractionation of nuclear and cytoplasmic RNA and RT-qPCR. B, fluorescence localization of LINC01857 in HCC cells verified by RNA-FISH. C, binding relation between LINC01857 and miR-197-3p verified by RIP assay; D: binding sites between LINC01857 and miR-197-3p and between miR-197-3p and AGR2 predicted by RNA22 and TargetScan database. E-F, binding relations between LINC01857 and miR-197-3p and between miR-197-3p and AGR2 certified by RIP assay and dual-luciferase reporter gene assay. G, expression of miR-197-3p and AGR2 mRNA in HCC and paracancerous tissues examined by RT-qPCR, n = 54. H, expression of miR-197-3p and AGR2 mRNA in HCC cells assessed by RT-qPCR. Three independent repeated cell tests were conducted. The results were presented as mean ± standard deviation. The paired t-test was employed to analyze the data in panels G/F. One-way ANOVA was used to analyze the data in panel H. Tukey’s multiple comparisons test was applied for post hoc test. Two-way ANOVA was employed to analyze the data in panels A, C, E, and H. Tukey’s multiple comparisons test or Sidak’s multiple comparisons test was employed for the post hoc test. ** p<0.01, *** p<0.001.

miR-197-3p knockdown attenuates the effect of silenced LINC01857 on reducing HCC cell proliferation and improving apoptosis

To confirm that LINC01857 could mediate HCC by sponging miR-197-3p, functional rescue assays were conducted as miR-197-3p expression was downregulated in HepG2 cells with silenced LINC01857 (all p<0.01) (Fig 4A) to evaluate cell proliferation and apoptosis. Then, we found that when miR-197-3p was downregulated, cell proliferation was enhanced (all p<0.01) (Fig 4B) while apoptosis was degraded (all p<0.01) (Fig 4C), indicating that downregulation of miR-197-3p reversed the effect of silencing LINC01857 on reducing cell proliferation and improving apoptosis in HCC.

Fig 4

miR-197-3p knockdown attenuates the effect of silenced LINC01857 on reducing HCC cell proliferation and improving apoptosis.

miR-197-3p-IN was transfected into HepG2 cells with silenced LINC01857, with IN-NC as NC. A, miR-197-3p inhibitor transfection efficiency detected by RT-qPCR. B, cell proliferation measured by MTT. C, apoptosis examined via flow cytometry. Three independent repeated tests were conducted. The results were presented as mean ± standard deviation. One-way ANOVA was employed to analyze the data in panel A. Two-way ANOVA was employed to analyze the data in panels B and C. Tukey’s multiple comparisons test was applied for the post hoc test. ** p<0.01.

AGR2 overexpression attenuates the effect of silenced LINC01857 on reducing HCC cell proliferation and improving apoptosis

Similarly, to confirm the role of LINC01857 in HCC progression by controlling AGR2, AGR2 was overexpressed in HCC cells with silencing LINC01857 (all p<0.01) (Fig 5A), and HCC cell proliferation was potentiated (Fig 5B), but apoptosis was quenched (all p<0.01) (Fig 5C). These findings showed that AGR2 overexpression reversed the effect of silencing LINC01857 on reducing HCC cell proliferation and improving apoptosis.

Fig 5

AGR2 overexpression attenuates the effect of silenced LINC01857 on reducing HCC cell proliferation and improving apoptosis.

pcDNA-AGR2 was transfected into HepG2 cells with silenced LINC01857, with pcDNA-NC as NC. A, pcDNA-AGR2 transfection efficiency detected by RT-qPCR. B, cell proliferation measured by MTT. C, apoptosis examined via flow cytometry. Three independent repeated tests were conducted. The results were presented as mean ± standard deviation. One-way ANOVA was used to analyze the data in panel A. Two-way ANOVA was used to analyze the data in panels B and C. Tukey’s multiple comparisons test was applied for the post hoc test. ** p<0.01.

LINC01857 activates the AKT and ERK pathways by mediating the miR-197-3p/AGR2 axis

The investigations of the downstream mechanism of AGR2 revealed that AGR2 could upregulate the AKT and ERK pathways, which are related to the development of HCC [24, 25]. Therefore, levels of the key factors of the AKT and ERK pathways in HCC cells were assessed, and then it was discovered that the sh-LINC01857 group expressed downregulated phosphorylation levels of AKT and ERK in HCC cells (all p<0.01) (Fig 6A). However, in the sh-miR-197-3p-IN and the sh-LINC01857+pc-AGR2 groups, the phosphorylation levels of AKT and ERK were evidently stimulated (all p<0.01) (Fig 6B). In addition, the original unadjusted images of all imprints are presented in S1 Raw images. Overall, LINC01857 could activate the AKT and ERK pathways in HCC via the manipulation of the miR-197-3p/AGR2 axis.

Fig 6

LINC01857 activates the AKT and ERK pathways by mediating the miR-197-3p/AGR2 axis.

A and B, protein levels and phosphorylation levels of AKT and ERK in HCC cells from different groups verified by western blot analysis. Three independent repeated tests were conducted. The results were presented as mean ± standard deviation. Two-way ANOVA was employed to analyze the data. Tukey’s multiple comparisons test was applied for the post hoc test. ** p<0.01.

Silencing of LINC01857 inhibits HCC growth in vivo

Since the previous studies clarified that LINC01857 could affect HCC cell proliferation and apoptosis, we attempted to validate its role in vitro by establishing xenograft tumors in nude mice via the injection of HepG2 cells on the right side of axillary. Subsequently, our study revealed that compared with the sh-NC group, the sh-LINC01857 group exhibited repressed tumor growth (all p<0.01) (Fig 7A) and reduced tumor weights (p<0.01) (Fig 7B). The immunohistochemistry results showed that the sh-LINC01857 group possessed a decreased positive rate of Ki67 protein, which served as a marker of cell proliferation [26] (p<0.01) (Fig 7C). Moreover, compared with the sh-NC group, LINC01857 was under-expressed, miR-197-3p was regulated and AGR2 mRNA was reduced in the sh-LINC01857 group (all p<0.01) (Fig 7D–7F). The above results showed that silencing of LINC01857 could increase miR-197-3p expression to suppress AGR2 expression, thereby inhibiting HCC growth in vivo.

Fig 7

Silencing of LINC01857 inhibits HCC growth in vivo.

A, tumor volume in HCC model, n = 12. B, representative images and weights of tumors, n = 6. C, ki67 positive rate of tumors in each group analyzed by immunohistochemistry, n = 6. D, E and F, expression of LINC01857, miR-197-3p and AGR2 mRNA detected by RT-qPCR, n = 6. The results in panels A, B and C were presented as mean ± standard deviation. The independent t-test was employed to analyze the data in panels B, C, D, E and F. Two-way ANOVA was employed to analyze the data in panel A. Tukey’s multiple comparisons test was applied for the post hoc test. Compared with the si-NC group, ** p<0.01.

Discussion

HCC is a malignant carcinoma that emerges in the interaction among disease, the environment and patients with chronic hepatic disorders, and it has caused the second largest number of deaths [4]. Studies have increasingly reported that lncRNAs are involved in a wide range of disorders, including neoplasms, via alterations in mRNA or miR expression, chromatin construction, gene scaffolding, gene transcription modulation and serving in the ceRNA network [27, 28]. As a member of lncRNAs, LINC01857 acts as a perilous signature in cancers ranging from breast cancer and glioma to diffuse large B-cell lymphoma as it augments cell mobility and viability [29]. To the best of our knowledge, the present study initially elucidated the expression pattern and mechanism of LINC01857 in LC cells.

The most principal finding of this study was that LINC01857 was strongly expressed in HCC. As it was recently reported, LINC01857 overexpression was observed in individuals with breast cancer, resulting in aggrandized cell expansion, aggressiveness, poor clinical aftermath and continuous apoptosis [30]. It was revealed that LINC01857 overexpression was correlated with the poor recurrence‑free survival rate in HCC patients with fibrosis, illustrating that LINC01857 is detrimental to HCC development and prognosis [31]. Generally, LINC01857 is detrimental in some cancers. In this study, silencing LINC01857 expression limited HCC cell proliferation and promoted apoptosis as presented by the stimulated Bax level and reduced Bcl-2 level. Apoptosis represents a process of cell death aiming to balance the normal cells and pathological cells, and its absence might lead to neoplastic diseases or genomic disintegration [32]. Since apoptosis mainly affects injured, infected or redundant cells, it remains a conspicuous program that protects against hepatic oncogenesis [33]. Saleem and his colleagues noted that the activation of Bax and restriction of Bcl-2 were effective in inducing apoptosis to defend against cancers [34]. In diffuse large B-cell lymphoma, Li et al. noted that LINC01857 deteriorated tumor malignancy by reducing apoptosis [29]. Furthermore, when HCC cells were treated with anti-tumor drugs, the Bax level was improved while the Bcl-2 level was limited [35]. Therefore, silencing LINC01857 might effectively alleviate HCC progression.

LINC01857 could competitively bind to miR-197-3p to enhance AGR2 expression. It was reported that LINC01857 targets miR-200b to strengthen gastric cancer cell aggressiveness and dissemination [10]. Furthermore, Li et al. discovered that LINC01857 could competitively bind to miR-141-3p to upregulate mitogen-activated protein kinase 4, thereby accelerating the EMT in diffuse large B-cell lymphoma [29]. Besides, a recent study suggested that miR-197-3p is inactivated in colorectal cancer and functions as a sponge in a lncRNA/miR/mRNA crosstalk to sensitize cancer cells to curative drugs [36]. Similarly, miR-197-3p was specifically bound to tumor suppressor candidate 8 and EH‑domain containing 2, thus to influence osteosarcoma growth and metastasis [37]. Our results showed that the expression of miR-197-3p is weak in LC tissues and cells. Previous studies have noted that AGR2 is expressed in many solid tumor types, including prostate, pancreatic, breast and lung cancer, and that the overexpression of AGR2 is closely associated with the growth, metastasis and survival of tumors (PMID: 27283903) [38, 39]. Collectively, the LINC01857/miR-197-3p/AGR2 axis in HCC cells was identified.

Moreover, weakly expressed miR-197-3p attenuated the effect of silenced LINC01857 on reducing HCC cell proliferation and improving apoptosis. According to the research developed by Cabral and his colleagues, miR-197-3p was decreased in HCC, which was accompanied by high metastasis and unwelcomed clinical results [40]. Besides, miR-197-3p was weakly expressed in primary biliary cirrhosis, suggesting that it was conducive to hepatic diseases [41]. When apoptosis was reduced in gastric cancer by overexpressed oncogenes, miR-197-3p was also decreased, illustrating the positive correlation between miR-197-3p and apoptosis [42]. Furthermore, AGR2 overexpression reversed the effect of silencing LINC01857 on reducing HCC cell proliferation and improving apoptosis. Notably, when AGR2 was upregulated by the competitive binding between LINC00460 and miR-342-3p, HCC expansion, aggressiveness and invasiveness were all enhanced [21]. AGR2 represses apoptosis in cancers, including pancreatic cancer, cervical cancer and breast cancer [43-45]. Significantly, LINC01857 activated the AKT and ERK pathways by mediating the miR-197-3p/AGR2 axis with the involvement of a high Ki67 protein positive rate. Lim et al. revealed that AKT and ERK knockdown brought about suppression of HCC vitality, aggressiveness and EMT [25]. The levels of AGR2, AKT, ERK and Ki67 were all decreased in pancreatic cancer with downregulated tumor promotors, which confirmed the oncogenic role of the above cytokines [24]. Moreover, in endometrial cancer with overexpressed AGR2, Ki67-positive rate was accordingly elevated, indicating the detrimental role of Ki67 in tumors [46]. Thus, the modulation of the miR-197-3p/AGR2 axis and the AKT and ERK pathways by LINC01857 is necessarily involved in HCC growth.

Conclusion

In summary, it was originally unearthed through this experiment that silencing of LINC01857 could alleviate HCC malignancy by participating in the ceRNA interaction to upregulate miR-197-3p and inactivate AGR2, thereby downregulating the AKT and ERK pathways. These findings unveiled a novel prevention strategy for HCC. However, there are still some limitations in the research, for example, We found that LINC01857 was highly expressed in LC tissues, and other studies could investigate the function of LINC01857 in future research. Other miRNAs downstream of LINC01857 and other target genes of miR-197-3p also need to be explored. In addition, the function of the AKT and ERK pathways isn’t fully identified. Besides, this study represents a preclinical effort, and although our experiment offers therapeutic clues regarding HCC, the experimental findings and practical application in reality need further corroboration.

The phosphorylation levels of AKT and ERK in HCC cells were decreased after LINC01857 expression was silenced, while the phosphorylation levels of AKT and ERK were increased significantly after miR-197-3p downregulation or AGR2 overexpression in HCC cells with silencing LINC01857 expression.

(PDF)

Click here for additional data file.

14 Jul 2021

PONE-D-21-13013

Role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma malignancy via regulating the microRNA-197-3p/anterior GRadient 2 axis

PLOS ONE

Dear Dr. Xu,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please fully address both reviewers comments and concerns.

Please submit your revised manuscript by Aug 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Olorunseun Ogunwobi, MD, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent.

3. Please ensure you have thoroughly discussed any potential limitations of this study within the Discussion section, including the potential impact of confounding factors.

4. Thank you for stating the following financial disclosure:

This research was supported by funds from the Medical Science and Technology Research Foundation of Guangdong Province (A2020559).

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have shown that role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma via regulating the microRNA-197-3p/AGR2. The work is really interesting, however there are a few minor mistakes which needs to be rectified.

1. Some of the fonts used in the figures are not clear (For eg, Fig 1a, 3a, 3d etc.). I recommend you to provide a better figure for 3c.

2. Please provide the sequences of siRNAs used in the study.

3. Mention the details of the ELISA kit used in this study.

4. How much total RNA was used for the reverse transcription?

5. It is better to write “miRNA”, not “miRs”.

6. Some typos are there in the manuscript.

a. “TRIzol”

b. In some places you have written “tumour” and in some other places “tumor”. Please maintain a consistency.

c. Spelling mistake: “behavirs”

Reviewer #2: The study is interesting and useful in deciphering the contributors to HCC development and progression. However, there are a number of obstacles in achieving clarity in the manuscript preparation including numerous grammatical errors. In the Introduction: “Except for chronic hepatitis B or C virus infection, unbalanced lifestyle in rich regions and the lack of dietary aflatoxin uptake in underdeveloped economies are all boosters for HCC expansion” is not clearly stated. It would be better to state that “…lack of dietary aflatoxin uptake and elimination….”

The sentence: “Furthermore, based on the effect of LINC01857, its downstream network is researched” needs more refining. It seems an incomplete sentence.

In the Methods: “Dual-luciferase reporter gene assay”- the letter “e” appear as “c”s. These substitutions between the letters “c” and “e” occur throughout the manuscript including in the Discussion.

In the Results: The caption: “LINC01857 under-expression inhibits HCC cell proliferation and promotes apoptosis” implies that silencing of LINC0857 is a direct mechanism, which at this point in the experiment is premature and not accurate. It is better stated that” LINC01857 under-expression leads to a blockage in HCC cell proliferation and promotes apoptosis.”

Fig. 1A is not clear. In fact, a number of the figures are blurry including #a,3B, etc.

Also, the Discussion section needs more alignment with the experimental results obtained instead of regurgitating the contents of the Introduction. The logistical writing of the manuscript will add significantly to the experimental output of the study which is very important.

The evidence for physical protein-protein interaction between LINC01857 and microRNA (miR)-197-3p and between miR-197-3p and anterior GRadient 2 (AGR2) needs more convincing results - perhaps using a pull down assay since this study seems to show a novel interaction.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Review_RNA 01857 in hepatocellular carcinoma malignancy .docx

Click here for additional data file.

10 Aug 2021

Dear Editor and Reviewers,

We thank you very much for giving us an opportunity to make the revision, and thank you very much for your comments and opinions. The reviewer’s comments were highly insightful and enabled us to greatly improve the quality of our manuscript. We have revised the manuscript, according to the comments and suggestions of reviewers and editor, and responded point by point to the comments.

With regard to the reviewers’ comments and suggestions, we’d like reply as follows

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

5.Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have shown that role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma via regulating the microRNA-197-3p/AGR2. The work is really interesting, however there are a few minor mistakes which needs to be rectified.

1. Some of the fonts used in the figures are not clear (For eg, Fig 1a, 3a, 3d etc.). I recommend you to provide a better figure for 3c.

Response: Thank you for your review. We have modified the fonts and provided higher quality pictures to make the pictures look clearer and easier to understand. Please review again.

2. Please provide the sequences of siRNAs used in the study.

Response: Thank you for your suggestion. We have added the sequence to the corresponding method. Please review again.

3. Mention the details of the ELISA kit used in this study.

Response: Thanks for your reminding. We have mentioned the details of the ELISA kits.

4. How much total RNA was used for the reverse transcription?

Response: Thank you for your question. 2 μg RNA was reverse transcribed into cDNA, which we have described in the method.

5. It is better to write “miRNA”, not “miRs”.

Response: Thanks for your comments. We have replaced “miRs” with “miRNA”.

6. Some typos are there in the manuscript.

a. “TRIzol”

b. In some places you have written “tumour” and in some other places “tumor”. Please maintain a consistency.

c. Spelling mistake: “behavirs”

Response: Thanks very much for your review and comments. We have revised these typos in the manuscript.

Reviewer #2: The study is interesting and useful in deciphering the contributors to HCC development and progression. However, there are a number of obstacles in achieving clarity in the manuscript preparation including numerous grammatical errors. In the Introduction: “Except for chronic hepatitis B or C virus infection, unbalanced lifestyle in rich regions and the lack of dietary aflatoxin uptake in underdeveloped economies are all boosters for HCC expansion” is not clearly stated. It would be better to state that “…lack of dietary aflatoxin uptake and elimination….”

The sentence: “Furthermore, based on the effect of LINC01857, its downstream network is researched” needs more refining. It seems an incomplete sentence.

Response: Thanks. We have refined this sentence. Please review again.

In the Methods: “Dual-luciferase reporter gene assay”- the letter “e” appear as “c”s. These substitutions between the letters “c” and “e” occur throughout the manuscript including in the Discussion.

Response: Thanks. We have corrected these errors.

In the Results: The caption: “LINC01857 under-expression inhibits HCC cell proliferation and promotes apoptosis” implies that silencing of LINC0857 is a direct mechanism, which at this point in the experiment is premature and not accurate. It is better stated that” LINC01857 under-expression leads to a blockage in HCC cell proliferation and promotes apoptosis.”

Response: Thank you very much. We have revised this caption accordingly.

Fig. 1A is not clear. In fact, a number of the figures are blurry including #a,3B, etc.

Response: Thank you for your review. We have checked all the pictures and provided higher quality pictures.

Also, the Discussion section needs more alignment with the experimental results obtained instead of regurgitating the contents of the Introduction. The logistical writing of the manuscript will add significantly to the experimental output of the study which is very important.

Response: Thank you for your professional advice. We revised the discussion part to make it more logical. Please review it again.

The evidence for physical protein-protein interaction between LINC01857 and microRNA (miR)-197-3p and between miR-197-3p and anterior GRadient 2 (AGR2) needs more convincing results - perhaps using a pull down assay since this study seems to show a novel interaction.

Response: Thank you for your review. According to your suggestion, we supplemented the RNA pull-down experiment to confirm the binding relationship between LINC01857 and miR-197-3p and miR-197-3p and AGR2 (Fig. 3F), and further verified the ceRNA network composed of linc01857/miR-197-3p/AGR2 in hepatocellular carcinoma. Thanks again.

If you have any queries, please do not hesitate to contact us.

Once again, thank you very much for your time spent on this manuscript.

Looking forward to hearing from you.

Your sincerely,

Ping Xu

drxuping244@163.com

Submitted filename: Response to reviewers.docx

Click here for additional data file.

24 Sep 2021

Role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma malignancy via the regulation of the microRNA-197-3p/anterior GRadient 2 axis

PONE-D-21-13013R1

Dear Dr. Xu,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Olorunseun Ogunwobi, MD, PhD

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have addressed all the comments. The manuscript has been improved significantly and is now ready for publication.

Reviewer #2: The authors addressed my concerns including adding ny suggested experiments to validate their results.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Zaki Sherif

29 Sep 2021

PONE-D-21-13013R1

Role of long intergenic non-protein coding RNA 01857 in hepatocellular carcinoma malignancy via the regulation of the microRNA-197-3p/anterior GRadient 2 axis

Dear Dr. Xu:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Olorunseun Ogunwobi

Academic Editor

PLOS ONE