Literature DB >> 34792722

Mucormycosis as SARS-CoV2 sequelae in kidney transplant recipients: a single-center experience from India.

Hari Shankar Meshram1, Vivek B Kute2, Sanshriti Chauhan1, Ruchir Dave1, Himanshu Patel1, Subho Banerjee1, Sudeep Desai1, Deepak Kumar1, Vijay Navadiya1, Vineet Mishra3.   

Abstract

PURPOSE: Coronavirus disease (COVID-19) sequelae in the transplant population are scarcely reported. Post-COVID-19 mucormycosis is one of such sequelae, which is a dreadful and rare entity. The purpose of this report was to study the full spectrum of this dual infection in kidney transplant recipients (KTR).
METHODS: We did a comprehensive analysis of 11 mucormycosis cases in KTR who recovered from COVID-19 in IKDRC, Ahmedabad, Gujarat, India during the study period from Nov 2020 to May 2021. We also looked for the risk factors for mucormycosis with a historical cohort of 157 KTR who did not develop mucormycosis.
RESULTS: The median age (interquartile range, range) of the cohort was 42 (33.5-50, 26-60) years with 54.5% diabetes. COVID-19 severity ranged from mild (n = 10) to severe cases (n = 1). The duration from COVID-19 recovery to presentation was 7 (7-7, 4-14) days. Ten cases were Rhino-orbital-cerebral-mucormycosis (ROCM) and one had pulmonary mucormycosis. Functional endoscopic sinus surgery (FESS) was performed in all cases of ROCM. The duration of antifungal therapy was 28 (24-30, 21-62) days. The mortality rate reported was 27%. The risk factors for post-transplant mucormycosis were diabetes (18% vs 54.5%; p-value = 0.01), lymphopenia [12 (10-18) vs 20 (12-26) %; p-value = 0.15] and a higher neutrophil-lymphocyte ratio [7 (4.6-8.3) vs 3.85 (3.3-5.8); p-value = 0.5].
CONCLUSION: The morbidity and mortality with post-COVID-19 mucormycosis are high. Post-transplant patients with diabetes are more prone to this dual infection. Preparedness and early identification is the key to improve the outcomes.
© 2021. The Author(s), under exclusive licence to Springer Nature B.V.

Entities:  

Keywords:  COVID-19; Follow-up; Fungal infections; Mucormycosis; Readmission; Transplant

Mesh:

Substances:

Year:  2021        PMID: 34792722      PMCID: PMC8600912          DOI: 10.1007/s11255-021-03057-5

Source DB:  PubMed          Journal:  Int Urol Nephrol        ISSN: 0301-1623            Impact factor:   2.370


Background

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) has drastically impacted all the domains of humanity and solid-organ transplant recipient (SOT) is not a mere exception. However, there are enough evidence-based data to bolster the increased vulnerability of SOT with SARS-CoV2 compared to the general [1-3] and waitlisted patients [4, 5]. This fact ranks them at the top of the priority list for the medical community. There have been a lot of speculations about the imminent threat to COVID-19 survivors even after discharge. There are a few reports of follow-up studies in the general population, but the data are limited pertaining to SOT. Mucormycosis is one such infection that has emerged as post-COVID-19 sequelae. It is regarded as an opportunistic infection before the pandemic but recently has been recognized in increasing numbers with COVID-19. The causation and association between these two are incompletely understood. As SOT is already a proven risk factor for mucormycosis [6, 7], this problem statement expands in the COVID-19 era. There is a growing need to understand the clinical spectra and management of this deadly combination to improve the outcomes in SOT, as the data are scarce. The authors have previously reported two cases of post-COVID-19 mucormycosis in kidney transplant recipients (KTR) which are included in this study as well [8]. To date, there are only a few cases reports in SOT [9, 10] who acquired post-COVID-19 mucormycosis. To the best of our knowledge, this remains the largest case series of post-COVID-19 mucormycosis in KTR which could sever a learning tool for transplant physicians across the globe.

Methodology

Ethical statement

This was a retrospective study organized in a single center after getting an ethical approval letter from the institution (Registration number: ECRJ143/InstlGJ/2013/RR-19 with application number EC/App/20Jan21/07). The study was reported as per the Strengthening The Reporting of OBservational Studies in Epidemiology (STROBE) checklist. We followed the norms of the Transplantation of Human Organs and Tissues Act (THOTA), India; the declaration of Helsinki, and the declaration of Istanbul. The patient’s privacy and confidentiality were maintained throughout the process of the study.

Design, settings, and study population

The study was conducted at the department of nephrology and transplantation, IKDRC-ITS, Ahmedabad, Gujarat, India. All KTR with COVID-19 confirmed by SARS-CoV2 real-time polymerase chain test (RT-PCR) through nasopharyngeal swab or positive SARS-CoV2 spike protein antibody test by chemiluminescence immunoassay were included during the study period from May 2020 to May 2021. COVID-19 was defined as mild (signs of upper respiratory tract/no oxygen requirement), moderate (signs of pneumonia without the need of supplemental oxygen), and severe (severe pneumonia with oxygen saturation below 90% on room air) [11]. The cases were managed as per the availability of resources and drugs and as per the national guidelines for the management of COVID-19 [12]. The details of the 11 KTR who developed mucormycosis after COVID-19 infection were described in the study. The diagnosis of mucormycosis was confirmed by histopathological examination, KOH mount, and culture.

Institutional immunosuppression protocols

The immunosuppression protocol for COVID-19 in the center involved stopping of antimetabolite for 7 days in mild cases and gradual reintroduction after improvement of symptoms. In cases of moderate to severe COVID-19, both antimetabolite and calcineurin inhibitors (CNI) were stopped for 7 days and were insidiously restored depending on the clinical convalescence. There was no change in drug regimen for asymptomatic cases. The immune modulation in post-COVID-19 mucormycosis involved stopping antimetabolite and giving minimum doses of CNI in stable cases. In cases, with altered sensorium, or oxygen requirements only steroids in minimum doses were resumed. Antimetabolite was reintroduced after 2–3 weeks, and CNI was restored only after clinical recovery from mucormycosis. The immunosuppression changes were personalized depending on the clinical response and physician’s discretion and we were not strict with our baseline protocol.

The treatment regimen for mucormycosis

A dedicated room for managing mucormycosis was arranged in the hospital. The multidisciplinary team composed of nephrologists, transplant physicians, ophthalmologists, and ENT specialists was formed for managing this difficult-to-treat infection. Due to resource limitations, radiological imaging tests such as magnetic resonance imaging Para nasal sinus (MRI-PNS) or computed tomography (CT PNS) with or without contrast were performed in a different nearby imaging laboratory. Antifungal therapy was majorly composed of liposomal amphotericin B that was started with an initial dose of 1 mg/kg and gradually increased to 3–5 mg/kg after monitoring for any side effects. Posaconazole (n = 3) was less used due to limited availability and affordability. The planned duration of antifungal therapy was 21–28 days and beyond as per the clinical response. Functional endoscopic sinus surgery (FESS) was planned and performed as feasible and as early as possible.

Data collection and analysis

Demographic and clinical data which encompass a detailed evaluation of the cases were collected by the two authors (RD and HSM) and analyzed further. Laboratory parameters were retrieved from the hospital’s electronic software. The data were expressed as frequencies, percentages for categorical variables, and median interquartile range (IQR), and range for continuous variables. The comparison between historical cohort [13] which was reported recently and mucormycosis was done by Fisher test, Chi-square with Yates’s correction, or t test as appropriate. A two-tailed p-value of less than 0.05 was considered statistically significant. All statistical analysis was done using SPSS software 17 version.

Results

In the COVID-19 pandemic, we report a total of 11 post-COVID-19 mucormycosis cases were identified among KTR after COVID-19. One KTR and three liver transplant recipients with ROCM from the second wave were excluded due to incomplete details.

Demographic characteristics of the cohort

Table 1 shows the demographic characteristics of the cohort. The median (IQR, range) of the cohort was 42 (33.5–50, 26–60) years with males (n = 10) accounting for the bulk of cases. The gap period from the time of transplant surgery to acquiring COVID-19 was 5 (2–7.5, 2–17) years. The body mass index was 25 (23–31.5, 19–32) kg/m2, and Charlson’s co-morbidity index was 3 (2.5–3.5, 2–6) of the cohort. The blood group distribution for the study included A (n = 4), B (n = 4), and O (n = 3). Only 1 case was a deceased donor, the rest others were living-related transplants. Diabetes as a co-morbidity was seen in 6 of the 11 cases. In only 2 cases, there was a history of uncontrolled blood sugars. Thymoglobulin (n = 8) was the predominant induction used in the study. The majority of the cohort was on triple immunosuppression (n = 8). The median tacrolimus level was 4.9 (4.45–5.15) ng/ml. There was no occupational hazard for mucormycosis. In addition, there was no history of recent trauma or antirejection therapy given. None of the cases was immunized with the SARS-CoV2 vaccine.
Table 1

Demographic features of the cohort

Patient number1234567891011
Age4726494253604231513532
SexMMMMMFMMMMM
BMI, kg/m2313230.42223322332251924
Blood group typingAABBBOOBAOA
Basic kidney diseaseHTNUEUECGNHTNHTNUEUEHTNIgANRSD
Duration from transplant to COVID-19 (years)1721127532582
Type of transplantationLRKTLRKTLRKTLRKTLRKTLRKTLRKTDKTLRKTLRKTLRKT
Induction therapyNoATGNoATGATGATGGATGATGATGATG
Co-morbiditiesHTN, DMDMHTNPTDM, OHAHTNHTNHTNDM, HTN, TBDMDM, HTNHTN
Charlson’s co-morbidity index63233423432
Baseline immunosuppression regimen
 SteroidsYYYYYYYYYYY
 MMF/AZAYYYYYYYYYY
 TacrolimusYYYYYYYYY
 Tacrolimus levels, ng/ml4.655.24.44.25NA4.85.4
 SirolimusY
Others
 H/O ACEi/ARBYYYYYYY
 H/O seasonal flu vaccinationY
 H/O uncontrolled sugarsYY

Cases 1–3 died

BMI body mass index, MMF mycophenolate, AZA azathioprine, CNI calcineurin inhibitors, ACEi angiotensin-converting enzyme inhibitor, ARB angiotensin receptor blocker, DM diabetes, HTN hypertension, H/O history of, OHA oral hypoglycemic drugs, TB tuberculosis, ATG thymoglobulin, G grafalon, LRKT living-related kidney transplant, DKT deceased donor kidney transplant, CGN chronic glomerulonephritis, UE unknown etiology, RSD renal stone disease, IgAN IgA nephropathy, M male, F female, Y yes, NA not available

Demographic features of the cohort Cases 1–3 died BMI body mass index, MMF mycophenolate, AZA azathioprine, CNI calcineurin inhibitors, ACEi angiotensin-converting enzyme inhibitor, ARB angiotensin receptor blocker, DM diabetes, HTN hypertension, H/O history of, OHA oral hypoglycemic drugs, TB tuberculosis, ATG thymoglobulin, G grafalon, LRKT living-related kidney transplant, DKT deceased donor kidney transplant, CGN chronic glomerulonephritis, UE unknown etiology, RSD renal stone disease, IgAN IgA nephropathy, M male, F female, Y yes, NA not available

COVID-19 course of the cohort before admission for mucormycosis

Table 2 exhibits the detailed clinical details during the COVID-19 admission of the cohort. Three cases were managed on an out-patient basis for the COVID-19, while others were hospitalized. Only 1 case was managed in the intensive care unit. The most common clinical manifestations during COVID-19 included fever (n = 11), and cough (n = 10). Anxiety (n = 4) and depression (n = 4) were also present in many cases. The oxygen requirement of the cohort during COVID-19 admission included home-based care (n = 3), no oxygen therapy (n = 5) and low flow oxygen (n = 2), and high flow oxygen (n = 1). No case was on mechanical ventilation. Radiological abnormalities were detected in all the cases. The laboratory derangement during COVID-19 included higher neutrophil–lymphocyte ratio [7 (4.6–8.3, 3.3–11.2)], lower lymphocyte percentage [12 (10–18, 8–25) %], higher interleukin-6 levels [94.2 (66–108, 21–114) pg/ml], higher high sensitivity C-reactive protein [44 (38–128, 7.2–238) mg/dl], high D-dimer [1013 (497–1359, 174–2070) ng/ml] and serum ferritin levels [523 (423–1000, 248–1280) ng/ml]. Most of the cases were treated with a combination of steroids, anticoagulation and remdesivir (n = 7). The majority of the cases were treated with remdesivir, steroids and anticoagulation. The dose of steroids was 6 mg OD dexamethasone for 10 days in the three cases which required oxygen therapy. None of the cases received prophylactic antibiotics or antifungals during the COVID-19 stay. The immunosuppression management for COVID-19 is detailed in methodology. No patient had allograft dysfunction or any other complaints at discharge.
Table 2

Detailed summary of the COVID-19 course of the cohort:

Patient number1*234567891011*
TreatmentHOPDHHOPDOPDHHHHH
Cumulative clinical symptoms
 FeverYYYYYYYYYYY
 DyspneaYY
 Appetite lossYYYY
 AnosmiaYYY
 AgeusiaYY
 CoughYYYYYYYYYY
 Disturbed sleepYY
 AnxietyYYYY
 DepressionYYYY
 FatigueY
COVID-19 severity
 MildYYYY
 ModerateYYYYYY
 SevereY
Laboratory findings during COVID-19
 Hemoglobin, gm/dl1211.615.112.71211.38.6
 TLC, per mm37850846020,310495013,820823015,570
 Lymphocyte, %1481225102210
 NLR, %611.272.98.63.38.1
 ALC, %109967624371237138218101557
 Platelet × 103, per mm3243164227230242232212,000
 IL-6, pg/ml106.721.65114.781.76
 hsCRP, mg/dl238.847.47.238155.741
 D-dimer, ng/ml207043013707001326174
 Ferritin, ng/ml24810005231280423
 PCT, ng/ml0.240.050.070.8
 SGPT, IU/ml37244741343615
 LDH, IU/l549252326366
COVID-19 management
 Not hospitalizedYYY
 Hospitalized, no oxygen needYYYYY
 Low flow oxygen requiredYY
 HFO/NRBM/NIVY
 MV
 Radiological abnormalityYYYYYYYYYYY
 Vasopressor requirementY
 Dialysis required
Anti-COVID-19 therapy
 SteroidYYYYYYY
 AnticoagulationYYYYYYY
 RemdesivirYYYYYYY

Cases 1–3 died

OPD out-patient department, H hospitalized, TLC total leukocyte count, NLR neutrophil lymphocyte ratio, ALC absolute lymphocyte count, IL-6 interleukin-6, hsCRP high sensitive C reactive protein, PCT Procalcitonin, SGPT serum aspartate, LDH lactate dehydrogenase, HFO high flow oxygen, NRBM non-re-breather mask, NIV noninvasive ventilation, MV mechanical ventilation, Y yes

* The laboratory data were not retrieved as patients were admitted in a different center for COVID-19

Detailed summary of the COVID-19 course of the cohort: Cases 1–3 died OPD out-patient department, H hospitalized, TLC total leukocyte count, NLR neutrophil lymphocyte ratio, ALC absolute lymphocyte count, IL-6 interleukin-6, hsCRP high sensitive C reactive protein, PCT Procalcitonin, SGPT serum aspartate, LDH lactate dehydrogenase, HFO high flow oxygen, NRBM non-re-breather mask, NIV noninvasive ventilation, MV mechanical ventilation, Y yes * The laboratory data were not retrieved as patients were admitted in a different center for COVID-19

Clinical features and management of post-COVID-19 mucormycosis in kidney transplant recipients

The time gap between discharge from COVID-19 to the onset of symptoms of mucormycosis was 7 (7–7, 4–14) days. The clinical signs and symptoms (Table 3) described in decreasing order of frequency included facial swelling (n = 10), headache (n = 10), proptosis (n = 10), nasal crusting (n = 10), orbital cellulitis (n = 8), chemosis (n = 6), paresthesia (n = 4), ophthalmoplegia (n = 4), difficulty in vision (n = 3), epistaxis (n = 3), foul-smelling or black discharge from nose or throat (n = 3), toothache (n = 3), vision loss (n = 2), palate crusting (n = 2), fever (n = 1) and sings of pneumonia (n = 1). Most cases were classified as ROCM (n = 7), and only a few had cerebral involvement (n = 3) or pulmonary (n = 1). No cutaneous, disseminated or gastrointestinal tract mucormycosis cases were reported. The confirmatory diagnosis of mucormycosis was made by KOH and HPE + biopsy in all of the cases. The culture was not isolated in any of the cases. The management involved immunosuppression drug regimen alteration which is detailed in the methodology. The antifungal therapy used was liposomal amphotericin B (n = 11) and Posaconazole (n = 3). FESS was performed in all of the ROCM cases. The cumulative median dose of Liposomal amphotericin B received was 280 (240–400) mg/kg for 28 (24–40, 21–62) days of treatment.
Table 3

Clinical features of mucormycosis, treatment and outcome

Patient number1234567891011
Follow-up days from COVID-19 discharge to mucormycosis symptoms41077101478775
Classification of mucormycosis
 ROCM without brain involvedYYYYYYY
 ROCM with brain involvedYYY
 PulmonaryY
Signs and symptoms
 ProptosisYYYYYYYYYY
 Orbital cellulitisYYYYYYYY
 ChemosisYYYYYY
 EpistaxisYYY
 OphthalmoplegiaYYYY
 Vision lossYY
 Blurred visionYYY
 Facial swellingYYYYYYYYYY
 ParesthesiaYYYY
 Foul smelling dischargeYYY
 Black discharge form nose/mouthYYY
 Unremitting feverY
 Unresolving pneumoniaY
 Tooth acheYYY
 Pus discharge in oral cavityY
 Nasal crusting visibleYYYYYYYYYY
 Palate crusting visibleYY
 HeadacheYYYYYYYYYY
Treatment
 Cumulative median dose of liposomal amphotericin B (mg/kg)290280280210240420400260240480210
 Oral posaconazoleYYYYY

 Duration of treatment

(days)

2930282124624026246421
 FESSYYYYYYYYYY
Outcome
 Baseline S. creatinine before COVID-19 (mg/dl)1.31.41.61.41.21.81.111.21.32.1
 Peak S. creatinine during COVID-19 (mg/dl)21.52.11.91.22.311.11.31.53.2
 AKI during COVID-19YYYYYY
 S. creatinine before mucormycosis (mg/dl)1.81.62.82.21.21.91.21.31.41.33.4

 Peak S. creatinine during mucormycosis treatment

(mg/dl)

HDHDHD2.82.22.11.21.61.72.13.6
 AKI during treatmentYYYYYYNYYYN
 Creatinine at last follow-up (mg/dl)HDHDHD1.51.32.11.11.21.41.32.6
 Graft recoveryN/AN/AN/ACCPCCCCP
 DiedYYY
 DischargedYYYYYYYY

FESS functional endoscopic sinus surgery; Case 2 was planned lung lobectomy, but died before surgery; Cases 6 and 10 are on 18th day and 17th day of amphotericin B and both are improving after FESS. Case number 1 underwent orbital exenteration; AKI acute kidney injury, Y yes, N no, HD hemodialysis, N/A not applicable, C complete (serum creatinine reached baseline at follow-up), P partial (serum creatinine declined but did not reach baseline levels)

Clinical features of mucormycosis, treatment and outcome Duration of treatment (days) Peak S. creatinine during mucormycosis treatment (mg/dl) FESS functional endoscopic sinus surgery; Case 2 was planned lung lobectomy, but died before surgery; Cases 6 and 10 are on 18th day and 17th day of amphotericin B and both are improving after FESS. Case number 1 underwent orbital exenteration; AKI acute kidney injury, Y yes, N no, HD hemodialysis, N/A not applicable, C complete (serum creatinine reached baseline at follow-up), P partial (serum creatinine declined but did not reach baseline levels)

The outcome of post-COVID-19 mucormycosis in kidney transplant recipients

Three deaths were reported in the study which corresponds to a mortality rate of 27%. In only one case (Case 1), where orbital exenteration was needed, the patient died after battling a morbid clinical course of around 2 months from the onset of COVID-19 symptoms. The pulmonary mucormycosis (Case 2) presented with ground-glass opacity initially which progressed to right lung cavitary pneumonia. He was diagnosed with mucormycosis from bronchoscopy and biopsy. Lung excision was planned but the patient perished before surgery. The only case, which was on high flow oxygen during COVID-19 (Case 3), developed ROCM with brain involvement after 7 days of COVID-19 discharge. He died even after a timely functional endoscopic sinus surgery. The entire cohort was SARS-CoV2 RT-PCR negative during the entire hospital stay. Acute kidney injury was reported in 6 (54.4%) of the cases. All three patients with mortality required hemodialysis sessions, while it was not needed in any of the survivors. The median serum creatinine value at baseline, peak value during COVID-19, and just before the diagnosis of mucormycosis was 1.3 (1.2–1.6), 1.5 (1.25–2.1), and 1.6 (1.3–2.2) mg/dl, respectively. The peak serum creatinine during mucormycosis treatment and last follow-up were 2.1 (1.67–2.65) mg/dl and 1.35 (1.27–1.95) mg/dl, respectively. All alive cases (n = 8) achieved graft recovery (two had partial and six had complete recovery).

Comparison of COVID-19 course of the historical cohort who had not developed post-COVID-19 mucormycosis

The findings of our cohort were compared with a historical cohort of 157 KTR, in which mucormycosis was not reported (Table 4). Among the comorbidities, the presence of diabetes was associated with post-COVID-19 mucormycosis (18% vs 54.5%; p-value = 0.01). Obesity was also higher but not statistically significant (24% vs 45.5%; p-value = 0.15). Among the clinical symptoms fever (58% vs 100%; p-value = 0.003) and cough (49% vs 90%; p-value = 0.009) were reported higher in post-COVID-19 mucormycosis compared to the historical cohort. There were other differences described below which were statistically not significant. Mild cases (73% vs 43%; p-value = 0.1) were higher and there were fewer cases (20% vs 9%; p-value = 0.69) with severe COVID-19 in post-COVID-19 mucormycosis. Among the laboratory profile, lymphopenia [12 (10–18) vs 20 (12–26); p-value = 0.15] and higher neutrophil–lymphocyte ratio [7 (4.6–8.3) vs 3.85 (3.3 -5.8); p-value = 0.5] was more associated with post-COVID-19 mucormycosis.
Table 4

Comparison of post-COVID-19 mucormycosis with historical cohort

Historical cohort(n = 157)Post-COVID-19 Mucormycosis cases (n = 11)p-value
Demographic characteristics
 Median (interquartile range) age, years43 (32–50)42 (33.5–50)0.80
 Male sex133 (85%)10 (90%)1
 Obesity38 (24%)5 (45.5%)0.15
 Thymoglobulin induction129 (82%)8 (73%)0.42
 History of antirejection therapy in past26 (17%)2 (18%)1
 History of diabetes*29 (18%)6 (54.5%)0.01
Blood group distribution, n (%)
 A37 (24%)4 (36%)0.46
 B61 (39%)4 (36%)1
 AB7 (4%)0 (0%)1
 O52 (33%)4 (36%)1
Clinical symptoms on presentation, n (%)
 Fever*91 (58%)11 (100%)0.003
 Cough*77 (49%)10 (90%)0.009
 Expectoration50 (32%)4 (36%)0.74
 Dyspnea46 (29%)4 (36%)0.73
 Diarrhea37 (23%)1 (9%)0.45
 No symptoms7 (4%)0 (0%)1
Radiological chest abnormalities
 Yes*110 (70%)11 (100%)0.0001
 No47 (30%)0 (0%)
COVID-19 severity
 Asymptomatic7 (4%)0 (0%)1
 Mild71 (45%)8 (73%)0.11
 Moderate48 (31%)2 (18%)0.50
 Severe31 (20%)1 (9%)0.69

Laboratory abnormalities,

Median (interquartile range)

 Lymphocytes %*20 (12–26)12 (10–18)0.01
 Neutrophil lymphocyte ratio*3.85 (3.3–5.8)7 (4.6–8.3)0.0001
 High-sensitivity C-reactive protein (mg/l)49 (19–109)44 (38–128)0.81
 Ferritin (ng/ml)439 (196–998)523 (423–1000)0.64
 D-dimer (μg/l)1060 (540–2330)1013 (497–1359)0.90
 Interleukin-6 (pg/ml) *25 (14–82)94.2 (66–108)0.0001
Steroids use during COVID-1979 (50.3%)7 (63.6%)0.53
Allograft dysfunction during COVID-19 course 79 (50%)5 (45.5%)1

*p-value defined as statistically significant if value was below 0.05; p-value was measured by Chi-square with Yate’s correction, Fisher test or T test as appropriate

Comparison of post-COVID-19 mucormycosis with historical cohort Laboratory abnormalities, Median (interquartile range) *p-value defined as statistically significant if value was below 0.05; p-value was measured by Chi-square with Yate’s correction, Fisher test or T test as appropriate

Discussion

There is an extensive literature in the context of clinical profile and outcome of COVID-19 in SOT [14] including kidney [15-17], liver [18], lung [19], and heart [20, 21]. Transplantation activity ceased around the world during the COVID-19 peak, but it is estimated that postponing transplantation will result in excess of deaths [22] and hence depending on the COVID-19 surge and available resources, the transplantation should be resumed. There are also upcoming reports of usage of lesser potent induction and immunosuppression regimen in the COVID-19 era [23], the future implications of which in is unknown.

Need for follow-up studies in transplantation

There are various reports of follow-up studies of COVID-19 in the general population, but there are limited such reports in SOT [24, 25]. The follow-up studies have shown COVID-19 survivors to be at increased risk of adverse events [26, 27]. There have been concerning reports of readmissions and the risk of heightened clinical deterioration after discharge in COVID-19 [28-30]. In a recent report, comorbidities like diabetes are shown to be more prone to adverse events post-discharge [31, 32]. We report, our experience of readmissions for post-COVID-19 mucormycosis in KTR from India.

Factors for the increased burden of mucormycosis in COVID-19

In a meta-analysis of 101 cases of mucormycosis associated with COVID-19 in general patients, high numbers (n = 82) are constituted from India [33]. The exact culprit for this explosion of mucormycosis is difficult to pinpoint. A confluence of factors may be operating and are postulated for this dual infection such as overuse of steroids, uncontrolled sugars, prolonged hospital stay, and overzealous use of antibiotics, reuse of face mask, steam inhalation, zinc and iron supplementation [34, 35]. In our cohort, all the cases had a history of mask reuse, while multivitamins such as zinc and iron were used in 4 cases, along with steam inhalation in two cases. In addition, SARS-CoV2 in itself can cause immune dysregulation and provide fertile soil for the growth of invasive fungal infections [36, 37]. We have performed an extensive comparison of KTR with COVID-19 who acquired mucormycosis compared to the cohort who did not. We found blood markers such as lymphopenia and high NLR cases to be more prone to post-COVID-19 mucormycosis. Since the advent of the pandemic, these two factors have been associated with poor prognosis and mortality in COVID-19 [38]. In addition, lymphopenia per se is an important risk factor for invasive fungal infection [39]. Another important finding is the higher proportion of diabetics and younger age compared to pre-pandemic cases. This highlights the further vulnerability of KTR for mucormycosis during the pandemic. We also had a comparison of the outcome of mucormycosis cases in pre-pandemic times with post-COVID-19 mucormycosis. Our institute is one of the high-volume transplant centers in India, which has previously reported two to three cases of post-kidney transplant mucormycosis yearly in the pre-COVID-19 era [40]. The incidence of post-COVID-19 mucormycosis has staggeringly increased in our center compared to the pre-COVID-19 era. From 2015 to 2019, 14 cases of non-COVID-19 mucormycosis were identified in our center. Of the 14 cases, 8 (57%) patient was classified as ROCM, 5 (36%) with pulmonary mucormycosis and 1 (7%) with disseminated mucormycosis. Only 3 (21%) of the 14 cases were diabetic. The mean age of the cases was 54.7 years. One graft loss (7%) and three (21%) mortality were reported. Thus, post-COVID-19 mucormycosis in the current report are younger (44 vs 54.7) years, more frequently diabetic (54% vs 21%), and ROCM (91% vs 57%) compared to non-COVID-19 mucormycosis. In addition, the mortality reported was slightly higher in post-COVID-19 mucormycosis (27% vs 21%).

A comparison of mucormycosis in KTR with the general population

The majority of our study had ROCM which is similar to the general population. In our report, CT scans and MRI demonstrated evidence of mucosal thickening of sinuses, orbital and intracranial involvement with maxillary and ethmoidal sinus being the most affected, which simulates the reports from the general population. Diabetes was exclusively reported in a meta-analysis of 41 general patients [41]. Our report also had half of the cases with diabetes. The reports in the general patients had severe COVID-19 and which is dissimilar to our report as the majority had either mild or moderate illness, and only one case was on oxygen therapy in our report. This observation highlights the fact that SOT is more prone to this invasive infection compared to the general masses owing to a pre-existing chronic immunocompromised state. The mortality reported in previous reports in general patients is quite high, which emphasizes the importance of early treatment which could have relatively improved the outcome in our study of post-COVID-19 mucormycosis in SOT. Another significant concern is the graft outcome in this group of patients, where continued treatment with nephrotoxic drugs like Amphotericin B along with attenuation of maintenance IS can result in poor graft outcomes. However, in our report, only two cases had partial recovery, which was expected as IS tailoring is unavoidable in such cases. On an encouraging note, we observed that with gradual introduction and escalation of immunosuppression, creatinine level reached baseline in most cases. Thus, a favorable graft outcome was reported in the study, which is mainly attributed to maintaining a balance between immunosuppression and infection during treatment.

How to manage post-COVID-19 mucormycosis?

Immunosuppression alteration is challenging and there is no fixed consensus in such complex cases. A personalized and low threshold for decreasing drugs was our approach which was quite successful in our report. Antifungal therapy should be started before confirmation of diagnosis even in clinically suspected cases, as early initiation of antifungal therapy is one of the most important factors responsible for survival [42]. Antifungal treatment alone is ineffective in all mucormycosis cases as there is vascular thrombosis and ischemic necrosis of tissues which prevents effective entry of antifungal drugs. Therefore, radical debridement of infected and necrotic tissue of sinuses should be performed as early as possible to improve the outcomes [35]. All of our patients underwent FESS within an average of 5 days from admission. The pulmonary mucormycosis reported in our case series succumbed before surgery, and it shows the difficulty in isolating and managing such cases. There would be many undiagnosed cases of invasive fungal infections as bronchoscopy and BAL was not done due to resource limitations in many such cases, and were treated with empirical antifungal therapies. Transplant patients with COVID-19 must have a preliminary eye, nose, oral, and cranial nerve examination for any signs such as eschar, black nasal or oral discharge, eye swelling, or cranial nerve palsy [43]. After discharge, these patients should be informed about the risk and instructed to look for any signs at home.

Future implications

Further research in transplant settings will help in better delineating the pathogenesis and spectrum of post-COVID-19 sequelae. Eradication of COVID-19 through vaccination or drug therapy seems far at this point. Moreover, there are reports of decreased efficacy [44] and breakthrough COVID-19 after vaccination in SOT [45, 46]. Hence, COVID-19 is still a constant menace for SOT and they should undertake adequate precautions to safeguard themselves. SOT and transplant physicians should be aware of any possibility of sequelae following COVID-19 discharge.

Conclusion

The occurrence of mucormycosis has dramatically increased in COVID-19-recovered transplant patients. This poses additional morbidity and mortality in the follow-up of COVID-19. The strict control of blood sugars, judicious use of steroids, and balancing immunosuppression medications is essential to decrease the incidence and burden. Increased awareness on the part of the patient and physician is invariably warranted for early diagnosis and management. Prompt medical therapy along with surgical intervention is the mainstay for improving survival.
  15 in total

1.  Long-term follow-up of SARS-CoV-2 recovered renal transplant recipients: A single-center experience from India.

Authors:  Sanshriti Chauhan; Hari Shankar Meshram; Vivek Kute; Himanshu Patel; Sudeep Desai; Ruchir Dave
Journal:  Transpl Infect Dis       Date:  2021-10-06

2.  Assessment of thirty-day readmission rate, timing, causes and predictors after hospitalization with COVID-19.

Authors:  I Yeo; S Baek; J Kim; H Elshakh; A Voronina; M S Lou; J Vapnik; R Kaler; X Dai; S Goldbarg
Journal:  J Intern Med       Date:  2021-02-05       Impact factor: 13.068

3.  Mucormycosis associated with COVID-19 in two kidney transplant patients.

Authors:  Carolt Arana; Rafael E Cuevas Ramírez; Marc Xipell; Joaquim Casals; Asunción Moreno; Sabina Herrera; Marta Bodro; Frederic Cofan; Fritz Diekmann; Núria Esforzado
Journal:  Transpl Infect Dis       Date:  2021-06-13

4.  Recovery of kidney function after AKI because of COVID-19 in kidney transplant recipients.

Authors:  Divya Bajpai; Satarupa Deb; Sreyashi Bose; Chintan Gandhi; Tulsi Modi; Abhinav Katyal; Nikhil Saxena; Ankita Patil; Sayali Thakare; Atim E Pajai; Ashwathy Haridas; Vaibhav S Keskar; Sunil Y Jawale; Amar G Sultan; Tukaram E Jamale
Journal:  Transpl Int       Date:  2021-06       Impact factor: 3.782

5.  Molnupiravir in COVID-19: A systematic review of literature.

Authors:  Awadhesh Kumar Singh; Akriti Singh; Ritu Singh; Anoop Misra
Journal:  Diabetes Metab Syndr       Date:  2021-10-30

6.  Multicenter Epidemiologic Study of Coronavirus Disease-Associated Mucormycosis, India.

Authors:  Atul Patel; Ritesh Agarwal; Shivaprakash M Rudramurthy; Manoj Shevkani; Immaculata Xess; Ratna Sharma; Jayanthi Savio; Nandini Sethuraman; Surabhi Madan; Prakash Shastri; Deepak Thangaraju; Rungmei Marak; Karuna Tadepalli; Pratik Savaj; Ayesha Sunavala; Neha Gupta; Tanu Singhal; Valliappan Muthu; Arunaloke Chakrabarti
Journal:  Emerg Infect Dis       Date:  2021-06-04       Impact factor: 6.883

7.  Epidemiology, clinical profile, management, and outcome of COVID-19-associated rhino-orbital-cerebral mucormycosis in 2826 patients in India - Collaborative OPAI-IJO Study on Mucormycosis in COVID-19 (COSMIC), Report 1.

Authors:  Mrittika Sen; Santosh G Honavar; Rolika Bansal; Sabyasachi Sengupta; Raksha Rao; Usha Kim; Mukesh Sharma; Mahipal Sachdev; Ashok K Grover; Abhidnya Surve; Abhishek Budharapu; Abhishek K Ramadhin; Abhishek Kumar Tripathi; Adit Gupta; Aditya Bhargava; Animesh Sahu; Anjali Khairnar; Anju Kochar; Ankita Madhavani; Ankur K Shrivastava; Anuja K Desai; Anujeet Paul; Anuradha Ayyar; Aparna Bhatnagar; Aparna Singhal; Archana Sunil Nikose; Arun Bhargava; Arvind L Tenagi; Ashish Kamble; Ashiyana Nariani; Bhavin Patel; Bibbhuti Kashyap; Bodhraj Dhawan; Busaraben Vohra; Charuta Mandke; Chinmayee Thrishulamurthy; Chitra Sambare; Deepayan Sarkar; Devanshi Shirishbhai Mankad; Dhwani Maheshwari; Dilip Lalwani; Dipti Kanani; Diti Patel; Fairooz P Manjandavida; Frenali Godhani; Garima Amol Agarwal; Gayatri Ravulaparthi; Gondhi Vijay Shilpa; Gunjan Deshpande; Hansa Thakkar; Hardik Shah; Hare Ram Ojha; Harsha Jani; Jyoti Gontia; Jyotika P Mishrikotkar; Kamalpreet Likhari; Kamini Prajapati; Kavita Porwal; Kirthi Koka; Kulveer Singh Dharawat; Lakshmi B Ramamurthy; Mainak Bhattacharyya; Manorama Saini; Marem C Christy; Mausumi Das; Maya Hada; Mehul Panchal; Modini Pandharpurkar; Mohammad Osman Ali; Mukesh Porwal; Nagaraju Gangashetappa; Neelima Mehrotra; Neha Bijlani; Nidhi Gajendragadkar; Nitin M Nagarkar; Palak Modi; Parveen Rewri; Piyushi Sao; Prajakta Salunkhe Patil; Pramod Giri; Priti Kapadia; Priti Yadav; Purvi Bhagat; Ragini Parekh; Rajashekhar Dyaberi; Rajender Singh Chauhan; Rajwinder Kaur; Ram Kishan Duvesh; Ramesh Murthy; Ravi Varma Dandu; Ravija Kathiara; Renu Beri; Rinal Pandit; Rita Hepsi Rani; Roshmi Gupta; Ruchi Pherwani; Rujuta Sapkal; Rupa Mehta; Sameeksha Tadepalli; Samra Fatima; Sandeep Karmarkar; Sandeep Suresh Patil; Sanjana Shah; Sankit Shah; Sapan Shah; Sarika Dubey; Saurin Gandhi; Savitha Kanakpur; Shalini Mohan; Sharad Bhomaj; Sheela Kerkar; Shivani Jariwala; Shivati Sahu; Shruthi Tara; Shruti Kochar Maru; Shubha Jhavar; Shubhda Sharma; Shweta Gupta; Shwetha Kumari; Sima Das; Smita Menon; Snehal Burkule; Sonam Poonam Nisar; Subashini Kaliaperumal; Subramanya Rao; Sudipto Pakrasi; Sujatha Rathod; Sunil G Biradar; Suresh Kumar; Susheen Dutt; Svati Bansal; Swati Amulbhai Ravani; Sweta Lohiya; Syed Wajahat Ali Rizvi; Tanmay Gokhale; Tatyarao P Lahane; Tejaswini Vukkadala; Triveni Grover; Trupti Bhesaniya; Urmil Chawla; Usha Singh; Vaishali L Une; Varsha Nandedkar; Venkata Subramaniam; Vidya Eswaran; Vidya Nair Chaudhry; Viji Rangarajan; Vipin Dehane; Vivek M Sahasrabudhe; Yarra Sowjanya; Yashaswini Tupkary; Yogita Phadke
Journal:  Indian J Ophthalmol       Date:  2021-07       Impact factor: 1.848

View more
  4 in total

Review 1.  Clinical Features and Mortality of COVID-19-Associated Mucormycosis: A Systematic Review and Meta-Analysis.

Authors:  Atsuyuki Watanabe; Matsuo So; Hayato Mitaka; Yoshiko Ishisaka; Hisato Takagi; Ryota Inokuchi; Masao Iwagami; Toshiki Kuno
Journal:  Mycopathologia       Date:  2022-03-21       Impact factor: 3.785

Review 2.  Definition, diagnosis, and management of COVID-19-associated pulmonary mucormycosis: Delphi consensus statement from the Fungal Infection Study Forum and Academy of Pulmonary Sciences, India.

Authors:  Valliappan Muthu; Ritesh Agarwal; Atul Patel; Soundappan Kathirvel; Ooriapadickal Cherian Abraham; Ashutosh Nath Aggarwal; Amanjit Bal; Ashu Seith Bhalla; Prashant N Chhajed; Dhruva Chaudhry; Mandeep Garg; Randeep Guleria; Ram Gopal Krishnan; Arvind Kumar; Uma Maheshwari; Ravindra Mehta; Anant Mohan; Alok Nath; Dharmesh Patel; Shivaprakash Mandya Rudramurthy; Puneet Saxena; Nandini Sethuraman; Tanu Singhal; Rajeev Soman; Balamugesh Thangakunam; George M Varghese; Arunaloke Chakrabarti
Journal:  Lancet Infect Dis       Date:  2022-04-04       Impact factor: 71.421

3.  The adverse effects of high-dose corticosteroid on infectious and non-infectious sequelae in renal transplant recipients with coronavirus disease-19 in India.

Authors:  Vamsidhar Veeranki; Narayan Prasad; Jeyakumar Meyyappan; Dharmendra Bhadauria; Manas R Behera; Ravi Kushwaha; Manas R Patel; Monika Yaccha; Anupama Kaul
Journal:  Transpl Infect Dis       Date:  2022-07-23

4.  Hyperglycemia and steroid use increase the risk of rhino-orbito-cerebral mucormycosis regardless of COVID-19 hospitalization: Case-control study, India.

Authors:  Manickam Ponnaiah; Sivaraman Ganesan; Tarun Bhatnagar; Mahalakshmy Thulasingam; Marie Gilbert Majella; Mathan Karuppiah; S A Rizwan; Arun Alexander; Sonali Sarkar; Sitanshu Sekhar Kar; Tamilarasu Kadhiravan; Aparna Bhatnagar; Prasanna Kumar S; Vivekanandan M Pillai; Pradeep Pankajakshan Nair; Rahul Dhodapkar; Pampa Ch Toi; Rakesh Singh; Nirupama Kasthuri; Girish C P Kumar; Saranya Jaisankar; Vaibhav Saini; Ankita Kankaria; Anuradha Raj; Amit Goyal; Vidhu Sharma; Satyendra Khichar; Kapil Soni; Mahendra Kumar Garg; Kalaiselvi Selvaraj; ShriKrishna B H; Kranti Bhavana; Bhartendu Bharti; C M Singh; Neha Chaudhary; Vijayaravindh R; Gopinath K; Karthikeyan Palaninathan; Simmi Dube; Rita Singh Saxena; Nikhil Gupta; A Rathinavel; S Priya; Shama A Bellad; Avinash Kavi; Anilkumar S Harugop; Kailesh Pujary; Kirthinath Ballala; Sneha Deepak Mallya; Hanumanth M Prasad; D Ravi; N K Balaji; Raghuraj Hegde; Neha Mishra; Shalina Ray; S Karthikeyan; Sudha Ramalingam; A Murali; Sudhakar Vaidya; Mohit Samadhiya; Dhaval Bhojani; Somu Lakshmanan; Sudagar R B Singh; Nataraj Pillai; P Deepthi; K Banumathi; V Sumathi; D Ramesh; Sonam Poonam Nissar; Khushnood M Sheikh; Manisha N Patel; Vipul Shristava; Suresh S Kumar; K Shantaraman; Rajkamal D Pandian; Manoj Murhekar; Rakesh Aggarwal
Journal:  PLoS One       Date:  2022-08-08       Impact factor: 3.752

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.