Literature DB >> 34787058

CircSLC7A6 promotes the progression of Wilms' tumor via microRNA-107/ ABL proto-oncogene 2 axis.

Jiaju Xu1, Ying Hao1, Xingjuan Gao1, Yanqiu Wu1, Yanjie Ding1, Baohong Wang1.   

Abstract

The dysregulation of circular RNAs (circRNAs) has been proved to be involved in the carcinogenesis of various cancers. Nevertheless, the biological function of circSLC7A6 remains unclear in Wilms' tumor (WT). In our study, we found that circSLC7A6 was upregulated in cancerous WT tissues and cells. Cell apoptosis was increased while cell viability, migration, and invasion were repressed by circSLC7A6 silencing. Besides, circSLC7A6 knockdown suppressed WT tumor growth in vivo. miR-107 was identified as a direct target of circSLC7A6, and circSLC7A6 could negatively regulate miR-107 expression. In addition, circSLC7A6 knockdown inhibited WT progression, while the effect was partially abolished by the downregulation of miR-107. Additionally, ABL proto-oncogene 2 axis (ABL2) was verified as a downstream gene of miR-107, and circSLC7A6 could upregulate ABL2 expression by serving as a ceRNA of miR-107. Moreover, functional assays revealed that ABL2 overexpression reversed the impact of circSLC7A6 depletion on cell proliferation, migration, invasion, and apoptosis of WT. In conclusion, the present study demonstrated that circSLC7A6 facilitated WT progression by upregulating ABL2 through inhibiting miR-107 expression. These results suggested that circSLC7A6 might serve as a potential therapeutic target for WT.

Entities:  

Keywords:  ABL2; CIRCSLC7A6; Wilms’ tumor; miR-107

Mesh:

Substances:

Year:  2022        PMID: 34787058      PMCID: PMC8805947          DOI: 10.1080/21655979.2021.2001204

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Wilms’ tumor (WT) is one of the most common pediatric kidney cancer and accounts for about 7% of malignant tumors in children under 15 years old [1,2]. In recent decades, with the development of treatment, such as surgery, radiotherapy, and chemotherapy, the overall survival rate of WT patients has been significantly improved [3,4]. However, WT still causes tens of thousands of child deaths due to recurrence and metastasis [5,6]. Thus, it is imperative to reveal the carcinogenesis of WT and identify novel molecular targets for the treatment of WT. Circular RNAs (CircRNAs), a class of non-coding RNAs with a stable circular structure, originate from exonic, intronic, and intergenic regions [7,8]. Recent studies indicated that circRNAs participated in the regulation of various types of cancer by acting as a tumor promoter or suppressor. For example, circRNA_00580631 promoted the tumorigenesis of bladder cancer through sponging miR-486-3p and targeting FOXP4 [9]. CircRNA MTO1 inhibited gastric carcinoma progression via regulating the miR-3200-5p/PEBP1 axis [10]. CircSLC7A6, a newly discovered circRNA, has been reported to exert a cancer-promoting effect in human cancers. For instance, Gu et al indicated that circSLC7A6 promoted the tumorigenesis of colorectal cancer [11]. However, the molecular mechanisms of circSLC7A6 in WT tumorigenesis largely remain unknown. MicroRNAs (miRNAs) are another type of RNAs without protein-coding ability with 18–24 nucleotides in length [12,13]. Multiple pieces of evidence showed that miRNAs were involved in the occurrence and progression of various cancers, including WT. For instance, miR-155-5p attenuated cell viability and facilitated cell apoptosis in WT through targeting IGF2 via the PI3K signaling [14]. miRNA-203a-5p alleviated the malignant progression of WT via regulating JAG1 expression [15]. miR-107 has been discovered as a tumor suppressor in various cancers, such as renal clear cell carcinoma, gastric cancer, and prostate cancer [16-18]. Nonetheless, the biological role of miR-107 in WT is still unclear. The present study aimed to determine the potential mechanisms of circSLC7A6 in WT, and we hypothesized that circSLC7A6 functioned as an oncogenic gene in WT. This study might provide a promising therapeutic target for WT treatment.

Materials and methods

Clinical samples

32 pairs of WT tissues and adjacent noncancerous kidney tissues were gained from patients at Yantai Yuhuangding Hospital. All samples were instantly frozen in liquid nitrogen and stored at −80°C. Patients diagnosed with WT and who provided informed consent were included in this study, and patients who had received chemotherapy or radiotherapy were excluded. All participators signed written informed consents, and our work was approved by the ethics committee of Yantai Yuhuangding Hospital (Yantai, China).

Cell culture

Human WT cell lines (HFWT, WiT49, and 17–94) and normal renal tubular epithelial cell line (HK-2) were bought from the American Type Culture Collection (ATCC; USA). Cells were incubated in Dulbecco’s Modified Eagle Medium (DMEM; Corning Life Sciences, MA, USA) with 10% fetal bovine serum (FBS; Gibco, MD, USA) at 37°C with 5% CO2.

Cell transfection

The short hairpin RNA (shRNA) targeting circSLC7A6 (shcircSLC7A6) with negative control (shNC), miR-107 mimics and miR-107 inhibitor with their corresponding controls (NC mimics and NC inhibitor) were acquired from GenePharma (Shanghai, China). To overexpress circSLC7A6 or ABL2, the full-length of circSLC7A6 or ABL2 was cloned into the pcDNA3.1 vector (GenePharma, Shanghai, China). Cell transfection was performed using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

RT-qPCR

The RNA extraction was performed using Trizol reagent (Invitrogen, Carlsbad, CA). Then, Takara® Reverse transcription kit (TaKaRa, Kyoto, Japan) was used to synthesize cDNA. RT-qPCR was performed by SYBR® Premix Ex TaqTM II reagent kit (TaKaRa, Kyoto, Japan) with an ABI 7500 real-time PCR system (Applied Biosystems, CA, USA). GAPDH and U6 were used for normalization. The Relative expression was calculated using the 2−ΔΔCq method. The primer sequences were presented in Table 1.
Table 1.

Primer sequences for RT-qPCR

GeneDirectionSequence (5ʹ-3ʹ)
circSLC7A6forwardCCTTTGCAGAAGTCACCGGG
 reverseCCCAGGAGACCACAAAGCTAC
miR-107forwardGCATCGTTCCTTCAAGCCGATCT
 reverseTGGGTGAGTCGTTCGG
ABL2forwardCTGCTGCTCAACACCACCT
 reverseGCCACATATTCTGTCAGGAACC
GAPDHforwardACCACAGTCCATGCCATCAC
 reverseTCCACCACCCTGTTGCTGTA
U6forwardGCAGGAGGTCTTCACAGAGT
 reverseTCTAGAGGAGAAGCTGGGGT
Primer sequences for RT-qPCR

CCK-8 assay

Cells (HFWT and 17–94 cells) were seeded into 96-well plates. Then, at 0, 24, 48, 72 h after incubation, 10 μl CCK-8 reagent (Dojindo, Molecular Technologies, Dojindo, Japan) was added to each well. Next, the cells were incubated for 4 h at room temperature. The absorbance at 450 nm was observed using a microplate reader (Bio-Rad, Hercules, CA) [19].

Flow cytometry analysis

Cell apoptosis was evaluated using Annexin V-FITC Apoptosis Assay Kit. Firstly, the transfected WT cells were collected by trypsin, centrifuged at 1000 rpm, and then resuspended and dispersed to the density of 1 × 106 cells/mL. Thereafter, the cells were incubated with Annexin-V-FITC and PI reagent in darkness. Finally, the cell apoptosis was analyzed with a flow cytometer (BD Biosciences, USA) [20].

Wound healing assay

After transfection, HFWT and 17–94 were seeded into 6-well plates and incubated in standard conditions until 80–90% confluent. Subsequently, a sterile pipette tip was applied to generate scratches. The wound width at 0 h and 24 h were observed under a light microscope (Leica DMI4000B, Milton Keynes, Bucks, UK). The wound closing area was calculated using the formula: distance at 24 h/distance at 0 h x100% [21].

Transwell assay

Transwell chambers pre-coated with Matrigel (BD Biosciences) were used to evaluate cell invasive ability. WT cells (5 × 104 cells/well) were seeded into the upper chambers after transfection and suspended in 200 μL serum-free DMEM (Corning Life Sciences). In the meantime, 600 μL DMEM with 10% FBS was added into the lower chambers. After 48 h, the invaded cells in the lower chamber were fixed by 4% methanol and stained with 0.5% crystal violet (Sigma-Aldrich, USA). The number of cells invaded into the lower chambers was counted with a microscope (Olympus, Tokyo, Japan) [22].

Luciferase reporter assay

Wild-type and mutant circSLC7A6 (or ABL2) sequences were cloned into the pmirGLO to establish pmirGLO-circSLC7A6-WT/Mut (or pmirGLO-ABL2-WT/Mut) reporters (GenePharma). Then, miR-107 mimics or NC mimics was co-transfected with the above reporters into HFWT and 17–94 cells. After 48 h co-transfection, the Dual-Luciferase Reporter Assay System (Promega, USA) was utilized to evaluate luciferase activities [23].

RNA immunoprecipitation (RIP)

RIP assay was carried out by using a Magna RIP RNA-binding protein RIP Kit (Millipore, Bedford, MA, USA) [24]. After 48 h transfection, HFWT and 17–94 cells were lysed by RIP lysis buffer. Subsequently, cell lysates were cultured with magnetic beads conjugated with anti-Ago2 or anti-IgG (Both from Millipore, Billerica, MA, USA). After purified, the enrichment of circSLC7A6 and miR-107 was measured by RT-qPCR.

In vivo experiments

Six BALB/c nude mice (6 weeks old) were randomly divided into two groups. HFWT cells transfected with shcircSLC7A6 or its negative control were subcutaneously injected into the mice. Every 7 days, tumors were examined. Four weeks later, mice were sacrificed through cervical dislocation after being deeply anesthetized with 2% isoflurane. Tumor length (L) and width (W) were measured. Tumor volume was calculated by the following formula: V = 1/2 × L × W2. The experiments were approved by the Ethics Committee of Yantai Yuhuangding Hospital (Yantai, China).

Immunohistochemistry (IHC)

Tumor tissues resected from the xenografts were fixed using 10% formaldehyde, embedment by paraffin, and then cut into sections (4 μm-thick). Following the above procedures, the sections were cultured with Ki67 antibody (Abcam, USA) at 4°C overnight. After harvesting with a secondary antibody, they were stained with diaminobenzidine. Finally, a light microscope was used to take photographs [25].

Statistical analysis

Data were presented as mean ± SD and each experiment was repeated at least 3 times. Statistical analysis was conducted using SPSS 19.0 (IBM Corp., Chicago, IL, USA). The student’s t-test was applied for comparisons between two groups, and one-way ANOVA was applied to compare more than two groups. Pearson’s correlation analysis was used to determine the correlation between miR-107 and circSLC7A6 or ABL2. p < 0.05 was considered statistically significant.

Results

CircSLC7A6 knockdown inhibits the tumorigenesis of WT

Firstly, we investigated the role of circSLC7A6 in WT progression in vitro. RT-qPCR indicated that circSLC7A6 expression was enhanced in WT tissues and cell lines (HFWT, WiT49, and 17–94 cells) (Figure 1a and b). To investigate the biological function of circSLC7A6 in WT, shcircSLC7A6 and shNC were transfected into HFWT and 17–94 cells. The efficiency of circSLC7A6 silence was determined by RT-qPCR (Figure 1c). CCK-8 assay demonstrated that circSLC7A6 silence markedly repressed WT cell viability (Figure 1d). Moreover, wound healing and transwell assays revealed that migration and invasion of HFWT and 17–94 cells were suppressed by circSLC7A6 depletion (Figure 1e and f). Besides, flow cytometry analysis results demonstrated that circSLC7A6 silence enhanced HFWT and 17–94 cell apoptosis (Figure 1g). To summarize, circSLC7A6 knockdown inhibited WT progression in vitro.
Figure 1.

Knockdown of circSLC7A6 inhibits WT progression. (a) RT-qPCR showed the relative expression of circSLC7A6 in WT tissues and adjacent normal tissues (n = 32). (b) RT-qPCR showed the relative expression of circSLC7A6 in WT cell lines (HFWT, WiT49, and 17–94) and normal renal tubular epithelial cell line (HK-2). (c) RT-qPCR showed the relative expression of circSLC7A6 in HFWT and 17–94 transfected with shNC and shcircSLC7A6. (d) CCK-8 assay showed the cell viability of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (e) Wound healing assay revealed the cell migration of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (f) Transwell assay indicated the cell invasion of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (g) Flow cytometry assay showed the cell apoptosis of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. *p < 0.05, **p < 0.001, and ***p < 0.0001.

Knockdown of circSLC7A6 inhibits WT progression. (a) RT-qPCR showed the relative expression of circSLC7A6 in WT tissues and adjacent normal tissues (n = 32). (b) RT-qPCR showed the relative expression of circSLC7A6 in WT cell lines (HFWT, WiT49, and 17–94) and normal renal tubular epithelial cell line (HK-2). (c) RT-qPCR showed the relative expression of circSLC7A6 in HFWT and 17–94 transfected with shNC and shcircSLC7A6. (d) CCK-8 assay showed the cell viability of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (e) Wound healing assay revealed the cell migration of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (f) Transwell assay indicated the cell invasion of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. (g) Flow cytometry assay showed the cell apoptosis of HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. *p < 0.05, **p < 0.001, and ***p < 0.0001.

Silencing of circSLC7A6 represses WT tumor growth in vivo

An in vivo xenograft experiment was carried out to further analyze the impact of circSLC7A6 on WT tumorigenesis. It was found that the volume and weight of tumors were significantly decreased in the circSLC7A6-knockdown group compared with those in shNC group (Figure 2a-c). In addition, it was manifested by IHC staining that Ki67 expression was decreased by circSLC7A6 knockdown (Figure 2d). In sum, these results demonstrated that the silence of circSLC7A6 suppressed the progression of WT.
Figure 2.

Silencing of circSLC7A6 represses WT tumor growth (a-c) Xenograft experiment showed that knockdown of circSLC7A6 reduced the volume and weight of tumors in mice. (d) IHC assay showed the Ki67 expression in shcircSLC7A6 and shNC group. *p < 0.05.

Silencing of circSLC7A6 represses WT tumor growth (a-c) Xenograft experiment showed that knockdown of circSLC7A6 reduced the volume and weight of tumors in mice. (d) IHC assay showed the Ki67 expression in shcircSLC7A6 and shNC group. *p < 0.05.

CircSLC7A6 targets miR-107 in WT cells

Through starBase 2.0 website, miR-107 was predicted to have binding sites on circSLC7A6 (Figure 3a). Via Luciferase reporter assay, it was discovered that luciferase activity of wild-type circSLC7A6 reporter was lessened by miR-107 overexpression whilst no alteration was observed in circSLC7A6-Mut reporter in HFWT and 17–94 cells (Figure 3b). Additionally, RIP assay indicated that circSLC7A6 and miR-107 enrichment were markedly higher in anti-Ago2 of WT cells (Figure 3c). Moreover, RT-qPCR uncovered that miR-107 expression was lowly expressed in WT tissues and cells (Figure 3d and e). Pearson’s analysis found a negative correlation between circSLC7A6 and miR-107 expression in WT tissues (figure 3f). In addition, circSLC7A6 deletion increased miR-107 expression in HFWT and 17–94 cells (Figure 3g).
Figure 3.

CircSLC7A6 targets miR-107 in WT cells. (a) The binding site between circSLC7A6 and miR-107 was predicted by starBase website. (b) Luciferase reporter assay was performed to testify the interaction between circSLC7A6 and miR-107 in HFWT and 17–94 cells. (c) RIP assay was performed to determine the enrichment of circSLC7A6 and miR-107 in anti-IgG and anti-Ago2. (d) RT-qPCR showed the relative expression of miR-107 in WT tissues and adjacent normal tissues (n = 32). (e) RT-qPCR showed the relative expression of miR-107 in WT cell lines (HFWT, WiT49, and 17–94) and normal renal tubular epithelial cell line (HK-2). (f) Pearson’s correlation analysis was used to analyze the correlation between circSLC7A6 and miR-107 expression in WT tissues. (g) RT-qPCR was employed to assess miR-107 expression in HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. *p < 0.05 and **p < 0.001.

CircSLC7A6 targets miR-107 in WT cells. (a) The binding site between circSLC7A6 and miR-107 was predicted by starBase website. (b) Luciferase reporter assay was performed to testify the interaction between circSLC7A6 and miR-107 in HFWT and 17–94 cells. (c) RIP assay was performed to determine the enrichment of circSLC7A6 and miR-107 in anti-IgG and anti-Ago2. (d) RT-qPCR showed the relative expression of miR-107 in WT tissues and adjacent normal tissues (n = 32). (e) RT-qPCR showed the relative expression of miR-107 in WT cell lines (HFWT, WiT49, and 17–94) and normal renal tubular epithelial cell line (HK-2). (f) Pearson’s correlation analysis was used to analyze the correlation between circSLC7A6 and miR-107 expression in WT tissues. (g) RT-qPCR was employed to assess miR-107 expression in HFWT and 17–94 cells transfected with shNC and shcircSLC7A6. *p < 0.05 and **p < 0.001.

CircSLC7A6 positively regulates WT progression by sponging miR-107

To explore whether circSLC7A6 regulated WT progression via miR-107, shNC, shcircSLC7A6, or shcircSLC7A6+ miR-107 inhibitor was transfected into HFWT and 17–94 cells. CCK-8 assay revealed that silencing of miR-107 attenuated the repressive effects of circSLC7A6 depletion on cell viability of WT cells (Figure 4a). Furthermore, circSLC7A6 depletion attenuated migration and invasion of WT cells and increased apoptosis of WT cells, which were abolished by miR-107 inhibition (Figure 4b-D). The above data indicated that circSLC7A6 modulated the progression of WT by interacting with miR-107.
Figure 4.

CircSLC7A6 positively regulates WT progression by sponging miR-107. (a-d) CCK-8, wound healing, transwell and flow cytometry assays showed the cell viability, migration, invasion, and apoptosis of WT cells transfected with shNC, shcircSLC7A6, and shcircSLC7A6+ miR-107 inhibitor. *p < 0.05, **p < 0.001, and ***p < 0.0001.

CircSLC7A6 positively regulates WT progression by sponging miR-107. (a-d) CCK-8, wound healing, transwell and flow cytometry assays showed the cell viability, migration, invasion, and apoptosis of WT cells transfected with shNC, shcircSLC7A6, and shcircSLC7A6+ miR-107 inhibitor. *p < 0.05, **p < 0.001, and ***p < 0.0001.

ABL2 is a downstream gene of miR-107

Through starBase 2.0 program, ABL2 was predicted to be a downstream gene of miR-107 with a putative binding site (Figure 5a). MiR-107 overexpression remarkably reduced the luciferase activity of wild-type ABL2, while there was no change of mutant ABL2 in HFWT and 17–94 cells (Figure 5b). Subsequently, RT-qPCR proved that ABL2 expression was increased in WT tissues and cells (Figure 5c and d). Additionally, a negative correlation was found between miR-107 expression and ABL2 expression (Figure 5e). Moreover, ABL2 was notably suppressed by miR-107 overexpression, which could be restored by the upregulation of circSLC7A6 in HFWT and 17–94 cells (figure 5f), indicating circSLC7A6 could upregulate ABL2 expression by directly binding to miR-107 in WT.
Figure 5.

ABL2 is a downstream gene of miR-107. (a)StarBase website predicted the binding site between ABL2 and miR-107. (b) Luciferase reporter assay was performed to testify the interaction between ABL2 and miR-107 in HFWT and 17–94 cells. (c and d) RT-qPCR showed ABL2 expression in WT tissues (n = 32) and cell lines. (e) Pearson’s correlation analysis was used to analyze the correlation between ABL2 and miR-107 expression in WT tissues. (f) RT-qPCR was employed to assess ABL2 expression in WT cells transfected with NC mimics, miR-107 mimics and miR-107 mimics+circSLC7A6. *p < 0.05 and **p < 0.001.

ABL2 is a downstream gene of miR-107. (a)StarBase website predicted the binding site between ABL2 and miR-107. (b) Luciferase reporter assay was performed to testify the interaction between ABL2 and miR-107 in HFWT and 17–94 cells. (c and d) RT-qPCR showed ABL2 expression in WT tissues (n = 32) and cell lines. (e) Pearson’s correlation analysis was used to analyze the correlation between ABL2 and miR-107 expression in WT tissues. (f) RT-qPCR was employed to assess ABL2 expression in WT cells transfected with NC mimics, miR-107 mimics and miR-107 mimics+circSLC7A6. *p < 0.05 and **p < 0.001.

CircSLC7A6 knockdown suppresses the tumorigenesis of WT by regulating ABL2

To investigate the role of ABL2 in WT, HFWT and 17–94 cells were transfected with pcDNA3.1 and pcDNA3.1/ABL2. RT-qPCR results indicated that ABL2 expression was enhanced in WT cells transfected with ABL2 overexpression plasmid (Figure 6a). In addition, functional assays revealed that cell growth, migration, and invasion were promoted while cell apoptosis was reduced by ABL2 upregulation in WT cells (Figure 6b-e). Besides, considering that circSLC7A6 modulated ABL2 expression via miR-107, we hypothesized that ABL2 might participate in circSLC7A6-mediated regulation in WT cells. To verify this hypothesis, HFWT and 17–94 cells were transfected with shNC, shcircSLC7A6, and shcircSLC7A6 + pcDNA3.1/ABL2. RT-qPCR demonstrated that the level of ABL2 was inhibited by circSLC7A6 downregulation, which could be restored by ABL2 overexpression (figure 6f). Subsequently, rescue assay indicated that ABL2 overexpression abolished circSLC7A6 silence-mediated suppressive effects on WT cell progression (Figure 6g-J). Thus, we confirmed that circSLC7A6 silence inhibited WT progression via modulating ABL2.
Figure 6.

CircSLC7A6 knockdown suppresses the tumorigenesis of WT through regulating ABL2. (a) RT-qPCR showed the expression of ABL2 in HFWT and 17–94 cells transfected with pcDNA3.1 and pcDNA3.1/ABL2. (b-e) CCK-8, wound healing, transwell, and flow cytometry assays showed the cell viability, migration, invasion, and apoptosis of HFWT and 17–94 cells transfected with pcDNA3.1 and pcDNA3.1/ABL2. (f) RT-qPCR analysis showed the relative expression of ABL2 in HFWT and 17–94 cells transfected with shNC, shcircSLC7A6, shcircSLC7A6 + pcDNA3.1/ABL2. (g-j) CCK-8, wound healing, transwell, and flow cytometry assays were adopted to evaluate the cell viability, migration, invasion, and apoptosis of HFWT and 17–94 cells transfected with shNC, shcircSLC7A6, and shcircSLC7A6 + pcDNA3.1/ABL2. *p < 0.05, **p < 0.001, and ***p < 0.0001.

CircSLC7A6 knockdown suppresses the tumorigenesis of WT through regulating ABL2. (a) RT-qPCR showed the expression of ABL2 in HFWT and 17–94 cells transfected with pcDNA3.1 and pcDNA3.1/ABL2. (b-e) CCK-8, wound healing, transwell, and flow cytometry assays showed the cell viability, migration, invasion, and apoptosis of HFWT and 17–94 cells transfected with pcDNA3.1 and pcDNA3.1/ABL2. (f) RT-qPCR analysis showed the relative expression of ABL2 in HFWT and 17–94 cells transfected with shNC, shcircSLC7A6, shcircSLC7A6 + pcDNA3.1/ABL2. (g-j) CCK-8, wound healing, transwell, and flow cytometry assays were adopted to evaluate the cell viability, migration, invasion, and apoptosis of HFWT and 17–94 cells transfected with shNC, shcircSLC7A6, and shcircSLC7A6 + pcDNA3.1/ABL2. *p < 0.05, **p < 0.001, and ***p < 0.0001.

Discussion

The present study revealed that circSLC7A6 promoted WT tumorigenesis by regulating the miR-107/ABL2 axis. This study not only discovered a novel regulatory mechanism in WT, but also might offer a new therapy for patients with WT. Although lacking the protein-coding ability, increasing evidence indicated that circRNA could regulate tumor progression by sponging miRNAs or targeting signaling pathways. For instance, Amaresh et al. reported that CDR1as facilitated hepatocellular carcinoma development through sponging miR-7 [26]. Panda et al. indicated that circPVT1 interacted with several miRNAs to promote the progression of tumors [27]. Gao et al. hsa_circ_0007059 inhibited cell viability and epithelial-mesenchymal transition process in lung cancer by sponging miRNA-378 [28]. CircSLC7A6 has been reported to act as an oncogene or a tumor suppressor in human cancers. For example, Zhang et al. pointed out that circSLC7A6 could bind with tumor-related miRNAs to promote the tumorigenesis of prostate cancer [29]. Wang et al. indicated that circSLC7A6 inhibited the proliferation and invasion of non-small cell lung cancer cells in vitro and retarded tumor growth in vivo by regulating miR-21 [30]. However, the circRNA-related ceRNA network has never been studied in WT. In this research, we found circSLC7A6 knockdown repressed WT cell growth, migration, and invasion and accelerated apoptosis of WT cell in vitro and inhibited tumor growth in vivo. In addition, miR-107 was confirmed to be a downstream gene of circSLC7A6 and was negatively regulated by circSLC7A6 in WT cells. Furthermore, miR-107 inhibitor was able to counteract the effect of circSLC7A6 depletion on cell growth, migration, invasion, and apoptosis. Taken together, these results demonstrated that circSLC7A6 regulated WT progression by targeting miR-107. ABL2 belongs to Abelson family of non-receptor tyrosine kinase and regulates numerous cellular functions, such as cell viability, migration, apoptosis, and morphogenesis, in response to stimulation of cell surface receptors [31,32]. Liu et al. demonstrated that ABL2 inhibited the cell apoptosis of gastric cancer [33]. Xing et al. reported that the upregulation of ABL2 contributed to unsatisfactory prognosis and facilitated cell migration and invasion in HCC [34]. Our results discovered that ABL2 level was elevated in WT tissues and cells, and overexpression of ABL2 accelerated the progression of WT. In addition, ABL2 has been reported to bind with miRNAs to regulate cancer progression. For example, miR-143 suppressed the metastatic ability of renal cell carcinoma by targeting ABL2 [35]. miR-125a-5p attenuated the proliferation and migration of cervical carcinoma by interacting with ABL2 [36]. In our study, we found that miR-107 could directly target ABL2, and circSLC7A6 upregulated ABL2 expression by sponging miR-107. Moreover, functional assays demonstrated that overexpressing ABL2 neutralized the inhibitory effect of circSLC7A6 depletion on the progression of WT. In sum, the above results indicated that circSLC7A6 promoted WT progression and acted as ceRNA to target ABL2 by sponging miR-107. However, some limitations remain to be further addressed: Firstly, other miRNAs or downstream effectors of circSLC7A6 need to be further identified in WT. Secondly, the interaction between circSLC7A6 and host gene should be investigated in the future.

Conclusions

It was the first time to determine the role of circSLC7A6 in WT, and we discovered that circSLC7A6 promoted WT progression via the miR-107/ABL2 axis, implying a novel and possible tactic for WT treatment.
  36 in total

1.  MiRNA-203a-5p alleviates the malignant progression of Wilms' tumor via targeting JAG1.

Authors:  J-W Bao; W-J Li; J-H Guo; Z-B Lv; Z Whang
Journal:  Eur Rev Med Pharmacol Sci       Date:  2020-05       Impact factor: 3.507

2.  Circular RNA hsa_circ_0007059 restrains proliferation and epithelial-mesenchymal transition in lung cancer cells via inhibiting microRNA-378.

Authors:  Shunji Gao; Yanyan Yu; Lu Liu; Jun Meng; Guifang Li
Journal:  Life Sci       Date:  2019-07-25       Impact factor: 5.037

3.  A TAZ-AXL-ABL2 Feed-Forward Signaling Axis Promotes Lung Adenocarcinoma Brain Metastasis.

Authors:  Jacob P Hoj; Benjamin Mayro; Ann Marie Pendergast
Journal:  Cell Rep       Date:  2019-12-10       Impact factor: 9.423

4.  Identification of senescence-associated circular RNAs (SAC-RNAs) reveals senescence suppressor CircPVT1.

Authors:  Amaresh C Panda; Ioannis Grammatikakis; Kyoung Mi Kim; Supriyo De; Jennifer L Martindale; Rachel Munk; Xiaoling Yang; Kotb Abdelmohsen; Myriam Gorospe
Journal:  Nucleic Acids Res       Date:  2017-04-20       Impact factor: 16.971

5.  The long non-coding RNA NNT-AS1 promotes clear cell renal cell carcinoma progression via regulation of the miR-137/ Y-box binding protein 1 axis.

Authors:  Yadi Zhou; Zhenghao Zhang; Mingyi Wo; Wenfang Xu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

6.  microRNA-877-5p exerts tumor-suppressive functions in prostate cancer through repressing transcription of forkhead box M1.

Authors:  Bin Yang; Huifeng Diao; Pu Wang; Fengju Guan; Hechen Liu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

7.  Overexpression of Abl2 predicts poor prognosis in hepatocellular carcinomas and is associated with cancer cell migration and invasion.

Authors:  Quan-Tai Xing; Chun-Mei Qu; Gang Wang
Journal:  Onco Targets Ther       Date:  2014-05-30       Impact factor: 4.147

8.  Expanded identification and characterization of mammalian circular RNAs.

Authors:  Junjie U Guo; Vikram Agarwal; Huili Guo; David P Bartel
Journal:  Genome Biol       Date:  2014-07-29       Impact factor: 13.583

9.  MicroRNA-125a-5p modulates human cervical carcinoma proliferation and migration by targeting ABL2.

Authors:  Xian Qin; Yajun Wan; Saiying Wang; Min Xue
Journal:  Drug Des Devel Ther       Date:  2015-12-24       Impact factor: 4.162

10.  CircRNA_0058063 functions as a ceRNA in bladder cancer progression via targeting miR-486-3p/FOXP4 axis.

Authors:  Haote Liang; Hang Huang; Yeping Li; Yongyong Lu; Tingyu Ye
Journal:  Biosci Rep       Date:  2020-03-27       Impact factor: 3.840

View more
  5 in total

Review 1.  LncRNAs and CircRNAs in cancer.

Authors:  Xin Yin; Huiran Lin; Lei Lin; Lei Miao; Jing He; Zhenjian Zhuo
Journal:  MedComm (2020)       Date:  2022-05-12

2.  Knockdown of lncRNA HAGLROS inhibits metastasis and promotes apoptosis in nephroblastoma cells by inhibition of autophagy.

Authors:  Pugui Li; Kun Zhang; Shijie Tang; Weizhu Tang
Journal:  Bioengineered       Date:  2022-03       Impact factor: 6.832

3.  Overexpression of microRNA-107 suppressed proliferation, migration, invasion, and the PI3K/Akt signaling pathway and induced apoptosis by targeting Nin one binding (NOB1) protein in a hypopharyngeal squamous cell carcinoma cell line (FaDu).

Authors:  Xin Gao; Xinlong Fan; Wei Zeng; Jiwang Liang; Nan Guo; Xiao Yang; Yuejiao Zhao
Journal:  Bioengineered       Date:  2022-03       Impact factor: 6.832

4.  circHIPK3 regulates cell proliferation and migration by sponging microRNA-124 and regulating serine/threonine kinase 3 expression in esophageal squamous cell carcinoma.

Authors:  Da Yao; Shengcheng Lin; Size Chen; Zhe Wang
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

Review 5.  Mechanism underlying circRNA dysregulation in the TME of digestive system cancer.

Authors:  Zeyu Wu; Xiao Yu; Shuijun Zhang; Yuting He; Wenzhi Guo
Journal:  Front Immunol       Date:  2022-09-27       Impact factor: 8.786

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.