Association of SNPs within TMPRSS6 and BMP2 genes with iron deficiency status in Saudi Arabia.

BACKGROUND: Globally, iron-deficiency anemia (IDA) remains a major health obstacle. This health condition has been identified in 47% of pre-school students (aged 0 to 5 years), 42% of pregnant females, and 30% of non-pregnant females (aged 15 to 50 years) worldwide according to the WHO. Environmental and genetic factors play a crucial role in the development of IDA; genetic testing has revealed the association of a number of polymorphisms with iron status and serum ferritin. AIM: The current study aims to reveal the association of TMPRSS6 rs141312 and BMP2 rs235756 with the iron status of females in Saudi Arabia.
METHODS: A cohort of 108 female university students aged 18-25 years was randomly selected to participate: 50 healthy and 58 classified as iron deficient. A 3-5 mL sample of blood was collected from each one and analyzed based on hematological and biochemical iron status followed by genotyping by PCR.
RESULTS: The genotype distribution of TMPRSS6 rs141312 was 8% (TT), 88% (TC) and 4% (CC) in the healthy group compared with 3.45% (TT), 89.66% (TC) and 6.89% (CC) in the iron-deficient group (P = 0.492), an insignificant difference in the allelic distribution. The genotype distribution of BMP2 rs235756 was 8% (TT), 90% (TC) and 2% (CC) in the healthy group compared with 3.45% (TT), 82.76% (TC) and 13.79% (CC) in iron-deficient group (P = 0.050) and was significantly associated with decreased ferritin status (P = 0.050). In addition, TMPRSS6 rs141312 is significantly (P<0.001) associated with dominant genotypes (TC+CC) and increased risk of IDA while BMP2 rs235756 is significantly (P<0.026) associated with recessive homozygote CC genotypes and increased risk of IDA.
CONCLUSION: Our finding potentially helps in the early prediction of iron deficiency in females through the genetic testing.

1 Introduction

Recently, iron-deficiency anemia (IDA) has become a global health problem mainly affecting women, children and older adults [1]. The World Health Organization (WHO) estimated in 2013 that 273,000 deaths worldwide were due to IDA [2]. The incidence of IDA is generally higher in low- and middle-income countries [3]. According to the WHO, the greatest numbers of pre-school children, pregnant and non-pregnant women suffering from IDA live in the Eastern Mediterranean countries which include those in the Middle East [1]. A high prevalence of IDA was reported in individuals with poor diets, especially in female students who usually skip breakfast [4]. Also, several recent studies have suggested that IDA is frequently reported in females and infants in Saudi Arabia [5-10]. Considering the detrimental long-term effects and high prevalence of IDA, more attention has been given to its prevention [11]. Current research has suggested that the underlying causes for the disease worldwide include both environmental and genetic factors.

The major causes of IDA in Saudi Arabia include inadequate consumption of Vitamin C, infrequent consumption of red meat and fish, and genetic/or family history of IDA [8, 10]. Several polymorphisms have been previously reported in the Saudi population as causative single nucleotide polymorphisms (SNPs) in diseases such as breast cancer [12-16], colon cancer [17-19], diffuse parenchymal lung disease [20], and acute myeloid leukemia [21, 22]. In addition, genetic risk factors for IDA and causative genes have also been identified including the TMPRSS6 gene [23].

TMPRSS6 is expressed predominantly in the liver and negatively regulates the synthesis of the universal iron governing hormone hepcidin and thus plays a crucial role in iron homeostasis [24]. As TMPRSS6 plays a fundamental role in the development of IDA, several genome-wide association researchs have recognized common SNPs in TMPRSS6 that effect iron status [25-28].

In addition to regulation by TMPRSS6, hepcidin production is delicately controlled by interleukin-6, by bone morphogenic proteins (BMPs) and by other iron-regulated pathways [29]. Bone morphogenic protein 2 (BMP2) induces hepcidin expression through the BMP co-receptor hemojuvenlin [30]. While hepcidin excess induces anemia, hepcidin deficiency induces iron overload. Variants of the BMP2 gene have previously been associated with hemochromatosis but not with IDA [25, 31, 32].

In a study previously undertaken of female students from the northern region of Saudi Arabia, the rs855791 SNP in TMPRSS6 was found to be significantly associated with poor iron status [23]. The purpose of the current study is to investigate TMPRSS6 rs1421312 and BMP2 rs235756 SNPs and their association with iron deficiency status among female students at the University of Tabuk, Saudi Arabia. As far as we know, this is first article reporting on the association of polymorphism rs235756 of the BMP2 gene with iron deficiency status.

2 Methods

2.1 Study design

The study was approved by the Research Ethics Committees of Tabuk University; a total of 108 female students aged 18–25 participated and signed informed consent forms. The students were separated into two groups: 50 healthy students (control) and 58 iron deficient students. Females, were excluded from the study. Ethical approval for the research was obtained from the University of Tabuk’s Committee of Research Ethics and KFSHRC-Jed (IRB# 2018–36).

2.2 Biochemical finding

Blood samples of 3–5 mL were collected. The Beckman Coulter LH750 Analyzer (Beckman Coulter Inc., Miami, FL, USA) was utilized to determine levels of haemoglobin, red blood cells (RBCs), white blood cells (WBCs) and platelets. A useful machine (Hitachi, UK) was utilised to measure serum iron and ferritin. Concentration of ferritin<15 ng/ml and haemoglobin< 12 g/dl were defined as iron deficiency anaemia, whereas levels of ferritin<15 ng/ml and haemoglobin>12 g/dl were defined as iron deficiency without anaemia [33].

2.3 DNA preparation

Genomic DNA was isolated via the QIAamp DNA kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The DNA concentrations were measured by Nano-Drop 8000 spectrophotometer (Thermo Scientific, USA), and the DNA purity was evaluated by the absorbance ratios of A260/A280 and A260/A230. After that, all DNA samples were stored at −80 °C until use. PCR was conducted using a Taq DNA polymerase kit (Invitrogen) according to the manufacturer’s instructions.

2.4 Genotyping

Allele-specific PCR and ARMS-PCR were used to detect TMPRSS6 rs1421312 and BMP2 rs235756, respectively using following primers:

To detect the TMPRSS6 rs1421312 polymorphism (Fig 1) the following primers were used:

Fig 1

Allele-specific PCR of TMPRSS6 (rs1421312).

Forward1 (T allele): AGCCAGTGGCTTAGCCATTCCA

Reverse: GTGGTGGCAGCATCAGAGCAAAG

Forward2 (C allele): AGCCAGTGGCTTAGCCATTCCG

Reverse: GTGGTGGCAGCATCAGAGCAAAG

To detect the BMP2 rs235756 polymorphism (Fig 2) the following primers were used:

Fig 2

ARMS-PCR of BMP2 (rs235756).

Forward1: CATAGAGCAGGGCCCAGAAGCT

Reverse1: TCAGGGTACTCACGAAAGAGAGA

Forward2 (C allele): GAAGACTAAGAATTCTAGAATCCTCTCC

Reverse2 (T allele): AAGATTTTCCTTTGGGCACCTGTTGGT

Amplification was performed in a 25 μl reaction volume containing 50 ng genomic DNA, 0.4 μM of each primer, 250 μM dNTPs, 1.5 mM MgCl2 and 1U Taq DNA polymerase. PCR amplification was performed with a 5-minute initial denaturation step at 95°C followed by 30 seconds at 94°C for denaturation, 30 seconds at 64°C for annealing, 30 seconds at 72°C for extension, and a final extension step at 72°C for 5 minutes. The PCR was performed for 30 cycles. Products were separated using 2% agarose.

2.5 Statistical analysis

Statistical significance was determined using an χ2 test or an independent student’s t-test whenever appropriate. Results were considered statistically significant for the probability value (P) < 0.050. The odds ratios (OR) and 95% confidence intervals (CI) were calculated using the Chi-square test to determine the genetic variations in the two groups. Analyses were performed using SPSS version 16 (SPSS, Chicago, USA).

3 Results

3.1 Genotype distribution of TMPRSS6 rs1421312 and BMP2 rs235756

The genotype distribution of TMPRSS6 rs1421312 was 8% (TT), 88% (TC) and 4% (CC) in the healthy group compared with 3.45% (TT), 89.66% (TC) and 6.89% (CC) in the iron-deficient group (Table 1). There was no significant statistical difference between the groups (P = 0.492) (Table 1).

Table 1

Genotype distribution of TMPRSS6 (rs1421312) gene polymorphism.

	N	TT (%)	TC (%)	CC (%)	Chi-square	DF	p value
Normal students	50	4 (8%)	44 (88%)	2 (4%)	1.42	2	0.492
Iron deficient students	58	2 (3.45%)	52 (89.66%)	4 (6.89%)

In contrast, the genotype distribution of the BMP2 rs235756 was 8% (TT), 90% (TC) and 2% (CC) in the healthy group compared with 3.45% (TT), 82.76% (TC) and 13.79% (CC) in the iron-deficient group (Table 2) which was statistically significant (P = 0.050).

Table 2

Genotype distribution of BMP2 (rs235756) gene polymorphism.

	N	TT	TC	CC	Chi-square	DF	p value
Normal students	50	4 (8%)	45 (90%)	1 (2%)	5.65	2	0.050
Iron deficient students	58	2 (3.45%)	48 (82.76%)	8 (13.79%)

3.2 Genotype distribution of TMPRSS6 rs1421312 and BMP2 rs235756 according to clinical parameters

To evaluate the distribution of TMPRSS6 rs1421312 and BMP2 rs235756 clinically, both were analyzed for iron, ferritin, haemoglobin, platelets, RBCs and WBCs (Tables 3 and 4, respectively) with the result that 78.7% of participants had high hemoglobin, 35% had high iron, 46% had high ferritin, 78% had high RBCs, 98% had high platelet counts and 74% had high WBCs while 22% of the students had low haemoglobin, 65% had low iron, 54% had low ferritin, 22% had low RBCs, 2% had low platelets and 26% had low WBCs.

Table 3

Genotype distribution of TMPRSS6 (rs1421312) gene polymorphism with respect to clinical parameters.

	N=	TT	TC	CC	X2	Df	P value
Hemoglobin
Normal	85	6	75	4	2.16	2	0.339
Abnormal	23	0	21	2
Iron
Normal	38	4	32	2	2.76	2	0.252
Abnormal	70	2	64	4
Ferritin
Normal	50	4	44	2	1.42	2	0.491
Abnormal	58	2	52	4
RBC
Normal	85	5	76	4	0.61	2	0.737
Abnormal	23	1	20	2
Platelets
Normal	106	6	94	6	0.25	2	0.883
Abnormal	02	0	2	0
WBC
Normal	80	6	69	5	2.61	2	0.271
Abnormal	28	0	27	1

Table 4

Genotype distribution of BMP2 (rs235756) gene polymorphism with respect to clinical parameters.

	N=	TT	TC	CC	X2	Df	P value
Hemoglobin
Normal	85	5	75	5	3.16	2	0.20
Abnormal	23	1	18	4
Iron
Normal	38	4	33	1	4.90	2	0.08
Abnormal	70	2	60	8
Ferritin
Normal	50	4	45	1	5.65	2	0.05
Abnormal	58	2	48	8
RBC
Normal	85	4	72	9	3.05	2	0.22
Abnormal	23	2	21	0
Platelets
Normal	106	6	91	9	0.33	2	0.85
Abnormal	02	0	2	0
WBC
Normal	80	4	70	6	0.50	2	0.78
Abnormal	28	2	23	3

Our data indicate that TMPRSS6 rs1421312 was not significantly linked with decreased hemoglobin (P = 0.339), decreased serum iron (P = 0.252), decreased serum ferritin (P = 0.491), decreased RBCs (P = 0.737), decreased platelets (P = 0.883) or decreased WBCs (P = 0.271) (Table 3) while BMP2 rs235756 was significantly associated with decreased serum ferritin (P = 0.050) but was not significantly associated with decreased hemoglobin (P = 0.20), decreased serum iron (P = 0.08), decreased RBCs (P = 0.22), decreased platelets (P = 0.85) or decreased WBCs (P = 0.78) (Table 4).

3.3 Association of TMPRSS6 rs1421312 and BMP2 rs235756 with iron deficiency anemia risk

TMPRSS6 rs1421312 was genotyped in the healthy controls at 8%, 88%, and 4% for the TT, TC, and CC genotypes, respectively and at 0%, 95% and 5% in the iron-deficient group for the TT, TC, and CC genotypes, respectively (Table 5). In the healthy group, the T allele distribution was 52% while the C allele distribution was 48%. In contrast, the T allele distribution was 47% and the C allele distribution was 53% in the iron-deficient group. The OR 95% CI was 3.74(0.19–73.05) for the heterozygous TC genotype and 5.40(0.15–1.88) for the homozygous CC genotype.

Table 5

Genotypes and allele frequencies of TMPRSS6 (rs1421312) polymorphism in normal subjects and in iron deficiency anemia group.

Genotypes	Normal subjects		Anemia group		OR (95% CI)	Risk Ratio (RR)	p-value
	(N = 50)	%	(N = 19)	%
TT	4	8%	0	0%	1(ref.)	1(ref.)
TC	44	88%	18	95%	3.74 (0.19–73.05)	1.40 (1.20–1.65)	0.001
CC	2	4%	1	5%	5.40 (0.15–1.88.8)	1.50 (0.67–3.33)	0.32
Dominant
TT	4	8%	0	0%	1(ref.)	1(ref.)
TC+CC	46	92%	19	100%	3.77 (0.19–73.5)	1.41 (1.20–1.65)	0.001
Recessive
TT+TC	48	96%	18	95%	1(ref.)	1(ref.)
CC	2	4%	1	5%	1.33 (0.11.11.61)	1.09 (0.48–2.46)	0.83
Allele
T	52	52%	18	47%	1(ref.)	1(ref.)
C	48	48%	20	53%	1.20 (0.56–2.54)	1.05 (0.85–1.29)	0.62

ref = Reference

There was a significant association of the heterozygous TC+ homozygous CC genotype with an increased risk for IDA (OR 95% CI; 3.77[0.19–73.5]), risk ratio: 1.41(1.20–1.65) and P = 0.001.

BMP2 rs235756 was also genotyped in the iron-deficient group and was 5.3%, 73.7% and 21% for the TT, TC, and CC genotypes, respectively, whereas in the healthy group it was 6%, 94% and 0% for the TT, TC, and CC genotypes, respectively (Table 6). The T and C allele distributions were 42% for T and 58% for C in the iron-deficient group and 53% for T and 47% for C in the healthy group. The OR 95% CI was 29.3 (1.494–575.401) for the homozygous CC genotype. BMP2 rs235756 was significantly (P<0.026) associated with increased risk for IDA in the female students in the study.

Table 6

Genotypes and allele frequencies of BMP2 (rs235756) polymorphism in normal subjects and in iron deficiency anemia group.

Genotypes	Normal subjects		Anemia group		OR (95% CI)	Risk Ratio (RR)	p-value
	(N = 50)	%	(N = 19)	%
TT	3	6%	1	5.3%	1 (ref.)	1 (ref.)
TC	47	94%	14	73.7%	0.89 (0.086 to 9.282)	0.97 (0.543 to 1.742)	0.92
CC	0	0%	4	21%	21 (0.639 to 690)	7.0 (0.474 to 103.276)	0.08
Dominant
TT	3	6%	1	5.3%	1 (ref.)	1 (ref.)
TC+CC	47	94%	18	94.7	21 (0.639 to 690.030)	1.03 (0.577 to 1.862)	0.08
Recessive
TT+TC	50	100%	15	79%	1(ref.)	1(ref.)
CC	0	0%	4	21%	29.3 (1.494 to 575.401)	7.65 (0.549 to 106.47)	0.026
Allele
T	53	53%	16	42%	1 (ref.)	1 (ref.)
C	47	47%	22	58%	1.55 (0.729 to 3.296)	1.12 (0.916 to 1.387)	0.254

ref = Reference

4 Discussion

In the past, iron deficiency was thought to be due to dietary and environmental factors. While this is partially true, advancements in technology and in the understanding of the underlying disorders of iron metabolism have revealed that genetic factors contribute heavily to the development of iron deficiency [34, 35]. At the population level, compelling evidence of geographic differences in iron status supports the hypothesis of genetic variations across ethnicities [36], in particular among Asian and African populations [1, 37].

SNPs are well known to cause mutations in DNA structures that lead to susceptibility to various diseases [38, 39] and change amino acid sequencing in certain protein [40]. Polymorphisms in the TMPRSS6 gene have a profound impact on iron metabolism. TMPRSS6 SNPs have been associated with IDA but causality has is not established [41]. Among the SNPs in TMPRSS6 involved in IDA are rs869320724, rs767094129, rs786205059, rs137853119, and rs137853120 [42]. Gichohi-Wainaina et al. reported several differences in minor allele frequency in TMPRSS6 SNPs that includes rs228919, rs4820268, rs228921, rs855791, rs2111833, rs575620, rs228918, and rs1421312 [43]. Accordingly, we hypothesized that TMPRSS6 rs1421312 is associated with IDA in the female university students we studied in Saudi Arabia.

McLaren and colleagues studied SNP in TMPRSS6 gene in four different groups and found no significant association in rs1421312 and decreases in serum ferritin concentration [44]. In our study, the same result was observed with respect to iron concentration, serum ferritin and serum iron, but we did find that TMPRSS6 rs1421312 is significantly associated with dominant genotypes (TC+CC) and an increased risk for IDA for female university students in the north of Saudi Arabia.

In humans, the BMP2 gene is located on chromosome 20 and is considered an excellent candidate for fibrodysplasia (myositis) [45]. Most hemochromatosis genetic base conditions are linked to BMP2 as a result of homozygosity for the C282Y missense mutations that cause modification in the HFE gene. Milet and colleagues found a significant association between the rs235756 SNP of BMP2 and the pre-therapeutic serum ferritin level [32] (corrected for multiple testing). Hepcidin excesses inducing anemia and hepcidin deficiencies inducing iron overloads have been associated with BMP2. Variants of BMP2 have previously been associated with hemochromatosis, but not IDA [25, 31, 32]. Accordingly, we hypothesized that the SNP rs235756 on BMP2 is potentially associated with IDA in female university students in Saudi Arabia.

In our study, we observed no significant association between increased risk of IDA and BMP2 rs236756 although there was a significant association between increased risk for IDA and serum ferritin. This result is consistent with the finding of Milet and co-authors [32]. In contrast, in 2012 An and colleagues found a direct association between SNP rs855791 in TMPRSS6 gene and increased risk of IDA but no association between SNP rs235756 in BMP2 gene and increased risk [25]. This contradicts our finding of a direct association between increased risk of IDA and BMP2 variant rs235756 in the recessive genotype (CC) as the RR was 7.65 (0.549–106.475) and. This could be due to other environmental factors and the different genetic make-ups of the populations studied. Although the study size was limited (108 participants), our result is still valid; confirmation with a greater number of participants is required.

5 Conclusions

The current study demonstrates the substantial roles for TMPRSS6 polymorphic variant rs1421312 and BMP2 polymorphic variant rs235756 in increased susceptibility for IDA in Saudi female students aged 18–25. We found that both TMPRSS6 rs1421312 dominant genotype (TC+CC) and BMP2 rs235756 recessive genotype (CC) are associated with an increased risk for IDA. BMP2 rs235756 was found to be associated with ferritin though neither SNP showed a significant association with decreased serum hemoglobin, RBCs, platelets or WBCs. In future clinical settings, our finding potentially helps in the early prediction for iron deficiency in females through the genetic testing.

10 Mar 2021

Submitted filename: English proofreading letter.docx

Click here for additional data file.

7 May 2021

PONE-D-21-07480

Association of polymorphisms of genes BMP2 and TMPRSS6 with iron deficiency status in Saudi Arabia

PLOS ONE

Dear Dr. Hawsawi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please pay particular attention to the criticisms raised by Reviewer2, including the problem with the English and the issue of genotype frequency discrepancy.

Please submit your revised manuscript by Jun 19 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Cinzia Ciccacci

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

4. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. Thank you for stating the following in the Funding Section of your manuscript:

[Deanship of Scientific Research (DSR), University of Tabuk, Tabuk, Saudi Arabia.]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[The author(s) received no specific funding for this work]

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

7. Thank you for submitting the above manuscript to PLOS ONE. During our internal evaluation of the manuscript, we found significant text overlap between your submission and the following previously published works, some of which you are an author.

https://www.sciencedirect.com/science/article/abs/pii/S0378111920304364?via%3Dihub

We would like to make you aware that copying extracts from previous publications, especially outside the methods section, word-for-word is unacceptable. In addition, the reproduction of text from published reports has implications for the copyright that may apply to the publications.

Please revise the manuscript to rephrase the duplicated text, cite your sources, and provide details as to how the current manuscript advances on previous work. Please note that further consideration is dependent on the submission of a manuscript that addresses these concerns about the overlap in text with published work.

We will carefully review your manuscript upon resubmission, so please ensure that your revision is thorough.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Sample size is so small for PhD paper

On which criteria you classified the students as healthy and iron deficient

Have you made any questionnaire for participants? If yes provide it

Provide consent form of participants for provision of blood samples

Primers used for PCR are previously used or novelty designed

What is m in the first line of discussion?

Provide the form of ethical committee or institution review board of university

Reviewer #2: The current study tried to assess the effects of TMPRSS6 and BMP2 SNP on the risk of iron deficiency anaemia in adult females from Saudi Arabia. The authors have done a great job in planning and executing this study. Both the study design and the results are is clear laid out. However, the article would require a complete review of the English grammar to make it suitable for publication.

Here are my comments on the article:

1. The title should be reviewed for correctness. For example, “polymorphisms of genes TMPRSS6 and BMP2” may be written as SNPs within TMPRSS6 and BMP2 genes with iron deficiency….

2. Introduction is unnecessarily long. Can be shortened to begin by talking about IDA and exclude general description of iron.

3. Why was TMPRSS6 rs4820268 not included in the analysis. This SNP has been widely associated with low iron status in different global populations.

4. Further English editing might help to improve the grammar. For example, the last paragraph of the introduction “….to investigate polymorphism rs1421312 of the TMPRSS6 gene…” may be written as TMPRSS6 rs1421312.

5. In section 3.2, it is not clear what this 3-5cc means. It will be helpful to write this use SI units (mL for the blood volume).

6. In the results section, line 1, TMPRSS6 rs1421312 is wrongly written rs141312.

7. Genotype frequencies of the two SNPs in the study population differed widely from the global and all regional populations including Asian populations in the 1000 Genomes project. I recommend that the authors review their genotyping method to ensure that there were no errors.

8. In the section “Genotype distribution of TMPRSS6 rs1421312 and BMP2 rs235756 according to clinical parameters”, the description of the haematology and biochemical parameters using “normal” and “abnormal” should be high and low levels respectively.

9. In page 9, the sentence “Although the exact mechanism is unclear, compelling evidence emphasizes the role of TMPRSS6 polymorphisms in causing IDA”, needs to be reviewed. TMPRSS6 SNPs have been associated with IDA but causality has is not established. Similarly, the grammar in the first sentence of the last paragraph in page 9 needs to be reviewed.

10. In the last sentence on page 9, “TMPRSS6 rs141312” the SNP ID is incorrect.

11. The information about the location of BMP2 mentioned in the second sentence of page 10 needs to be reviewed. BMP2 is located in chromosome 20, see Here, but not Chr 2 as mentioned by the authors.

12. The last paragraph in page 10 needs to be reviewed. The sentence “we observed no significant association between increased risk for IDA and SNP rs235756 on BMP2” may be written as ….risk of IDA and BMP2 rs236756….

13. The conclusion that the results of this study “can be used as a predictive marker of IDA is Sauda Arabia” is premature. Further research on more genetic markers is needed to verify the clinical usability of this findings. These two SNPs are not sufficient to make this conclusion.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr Momodou W. Jallow

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

17 Jul 2021

Letter of Response to Reviewer’s Comments

Dear chief editor for PLOS ONE Journal

Many thanks for your peer review and comments. With great pleasure, we would like to inform you that, the manuscript has been revised comprehensively and we address all the reviewers' comments. We hope our manuscript satisfied the editor and reviewer and be considered for publication in your decent journal. Our updated response to the reviewers as following:

1- Response to Reviewer #1:

Sample size is so small for PhD paper

Many thanks for the important comments and recommendations. In Saudi Arabia and due to the Arabian culture where females are totally separated from males in the university, it was very difficult to collect samples from the female students. We did our best to collect as much as we can and we finally obtained a total of 108 blood samples from female students. Moreover, for the iron deficient students, we excluded all students diagnosed with eating disorders, pregnant, and those taking nutritional medications or supplements which reduced the number of participants.

On which criteria you classified the students as healthy and iron deficient

Many thanks for the important comments and recommendations. The criteria for the students as healthy and iron deficient were according to the WHO iron deficiency anemia assessment which was published in 2001. Levels of ferritin < 15 ng/ml and haemoglobin < 12 g/dl were defined as iron deficiency anaemia, whereas levels of ferritin < 15 ng/ml and haemoglobin > 12 g/dl were defined as iron deficiency without anaemia.

Have you made any questionnaire for participants? If yes provide it

Many thanks for this essential comment. However, because we measured the serum iron level there was no questionnaire for the participants.

Provide consent form of participants for provision of blood samples

Many thanks for this crucial comment. Consent form of participants for provision of blood samples is attached as requested.

Primers used for PCR are previously used or novelty designed

Many thanks for this valuable point. The primers were novelty designed.

What is m in the first line of discussion?

Many thanks for this precise notice. The m was a mistake from the proofreading and it has been removed. The sentence is " was thought to be due to dietary and environmental factors" and it has been highlighted in yellow.

Provide the form of ethical committee or institution review board of university.

Many thanks for this essential point. Ethical approval (IRB #2018-36) is attached as requested.

2- Response to Reviewer #2:

The current study tried to assess the effects of TMPRSS6 and BMP2 SNP on the risk of iron deficiency anaemia in adult females from Saudi Arabia. The authors have done a great job in planning and executing this study. Both the study design and the results are is clear laid out. However, the article would require a complete review of the English grammar to make it suitable for publication.

Many thanks for this and the manuscript has been sent for proofreading and English grammar was reviewed.

1. The title should be reviewed for correctness. For example, “polymorphisms of genes TMPRSS6 and BMP2” may be written as SNPs within TMPRSS6 and BMP2 genes with iron deficiency….

Many thanks for this essential comment. The title has been changed according to your valuable advice, and highlighted in yellow.

2. Introduction is unnecessarily long. Can be shortened to begin by talking about IDA and exclude general description of iron.

This is a valid point and we agree with the reviewer. Therefore, the introduction has been shortened and focused on IDA.

3. Why was TMPRSS6 rs4820268 not included in the analysis. This SNP has been widely associated with low iron status in different global populations.

Many thanks for this valid point. In our previous publication, we studied the TMPRSS6 rs4820268 SNPs in details.

4. Further English editing might help to improve the grammar. For example, the last paragraph of the introduction “….to investigate polymorphism rs1421312 of the TMPRSS6 gene…” may be written as TMPRSS6 rs1421312.

Many thanks for this point and the manuscript has been sent for proofreading and English grammar were reviewed. The mentioned sentence has been corrected and highlighted in yellow.

5. In section 3.2, it is not clear what this 3-5cc means. It will be helpful to write this use SI units (mL for the blood volume).

Many thanks for this point and the 3-5cc was corrected to mL in the manuscript and highlighted in yellow in page 4.

6. In the results section, line 1, TMPRSS6 rs1421312 is wrongly written rs141312.

Many thanks for this point. The SNP is now corrected as rs1421312 and highlighted in yellow.

7. Genotype frequencies of the two SNPs in the study population differed widely from the global and all regional populations including Asian populations in the 1000 Genomes project. I recommend that the authors review their genotyping method to ensure that there were no errors.

Many thanks and the genotype frequencies of the two SNPs in the study population was reviewed and there was no error.

8. In the section “Genotype distribution of TMPRSS6 rs1421312 and BMP2 rs235756 according to clinical parameters”, the description of the haematology and biochemical parameters using “normal” and “abnormal” should be high and low levels respectively.

Many thanks and the description of the haematology and biochemical parameters were changed and highlighted in yellow.

9. In page 9, the sentence “Although the exact mechanism is unclear, compelling evidence emphasizes the role of TMPRSS6 polymorphisms in causing IDA”, needs to be reviewed. TMPRSS6 SNPs have been associated with IDA but causality has is not established. Similarly, the grammar in the first sentence of the last paragraph in page 9 needs to be reviewed.

Many thanks for this important point. The sentence was reviewed and corrected according to the reviewer advise and highlighted in yellow.

10. In the last sentence on page 9, “TMPRSS6 rs141312” the SNP ID is incorrect.

Many thanks and the SNP has been corrected as rs1421312 and highlighted in yellow.

11. The information about the location of BMP2 mentioned in the second sentence of page 10 needs to be reviewed. BMP2 is located in chromosome 20, see Here, but not Chr 2 as mentioned by the authors.

Many thanks for this important point, the zero was removed by mistake during the proofreading. Currently, it has been corrected to chromosome 20 and highlighted in yellow.

12. The last paragraph in page 10 needs to be reviewed. The sentence “we observed no significant association between increased risk for IDA and SNP rs235756 on BMP2” may be written as ….risk of IDA and BMP2 rs236756….

Many thanks for this important point and the sentence has been corrected accordingly.

13. The conclusion that the results of this study “can be used as a predictive marker of IDA is Sauda Arabia” is premature. Further research on more genetic markers is needed to verify the clinical usability of this findings. These two SNPs are not sufficient to make this conclusion.

This is a valid point and we totally agree with the reviewer and therefore the statement has been removed.

Many thanks for your fairly and timely peer review along with valuable comments. We addressed all the highlighted reviewers' comments with a hope that, the revised manuscript will be considered for publication in your decent journal.

Looking forward to hearing from you soon.

Best regards

Yousef Hawsawi

Submitted filename: Response to reviewer 17-05-2021.docx

Click here for additional data file.

2 Sep 2021

PONE-D-21-07480R1

Association of SNPs within TMPRSS6 and BMP2 genes with iron deficiency status in Saudi Arabia

PLOS ONE

Dear Dr. Hawsawi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Please, revise the manuscript taking into account  the Reviewer 2 comments.

==============================

Please submit your revised manuscript by Oct 17 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Cinzia Ciccacci

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thanks for addressing all concerns. Refrain dual publication of article. try to meet the criteria of sample size

Reviewer #2: The authors have made significant improvements on the manuscript, and they have responded to the comments raised during the review.

However, there are minor issues that needs to be addressed to improve the quality of the article as follows:

1. Abstract

a. 3 – 5 cc in the methods section could be changes to 3 – 5mL.

2. Introduction section:

a. The sentence “….developing and low-income countries” could be change to “low- and middle-income countries”.

b. In line 3 of the third paragraph, the T in TMPRSS6 is not italised.

3. Results

a. In the last sentence of the last paragraph, it is not clear what the authors meant by … “associated with recessive genotypes”. The phrase may be removed.

4. Discussion section

a. The beginning of paragraph 3: “McLaren and his colleagues studied SNP in gene TMPRSS6 in four different ethnic groups…” should be revised. Also, the authors may consider removing the pronoun “his” when referring to other authors. Such sentences may be written as e.g. McLaren and colleagues studies.

b. In paragraph 4, line 4, the “H” in HFE should be italised.

c. Millet and his colleagues, see above comments

d. In line 6, it is not necessary to include the P value 0.002 in discussion here and in other places.

e. In paragraph 5, lines 4 – 5, the sentence “… direct association between TMPRSS6 and increase risk of IDA” should be revised. The association reported by these authors is between specific TMPRSS6 SNPs and IDA but not TMPRSS6 only.

Additional general comments

1. Table 5 need reformatting. In the Odd ration column, there should be a space between the OR and the confidence interval e.g 3.74(0.19-73.05) should be written as 3.74 (0.19-73.05).

2. There should be a footnote to explain what “ref.” means

3. Table 6 should be on one page. And see the above comments regarding footnotes and brakets.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Momodou W. Jallow, PhD.

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

5 Sep 2021

Letter of Response to Reviewer’s Comments

Dear chief editor for PLOS ONE Journal

Many thanks for your distinguish peer review. With great pleasure, we would like to inform you that, the manuscript has been revised for the second round comprehensively and we address all the reviewers' comments. We hope our manuscript satisfied the editor and reviewers and be considered for publication in your decent journal. Our updated response to the reviewers as following:

1- Response to Reviewer #1:

Reviewer #1: Thanks for addressing all concerns. Refrain dual publication of article. try to meet the criteria of sample size

Many thanks for the positive comments and recommendations. We will try to meet the criteria of samples size in our next publication. We highly appreciate your valuable comments.

2- Response to Reviewer #2:

Reviewer #2: The authors have made significant improvements on the manuscript, and they have responded to the comments raised during the review.

Many thanks for the important comments and recommendations. It is highly appreciated.

However, there are minor issues that need to be addressed to improve the quality of the article as follows:

1. Abstract

a. 3 – 5 cc in the methods section could be changes to 3 – 5mL.

Many thanks for this important point. The “3-5 cc” in the methods section has been changed to 3-5 mL.

2. Introduction section:

a. The sentence “….developing and low-income countries” could be change to “low- and middle-income countries”.

Many thanks for this important comments, the sentence has been changed to low- and middle-income countries.

b. In line 3 of the third paragraph, the T in TMPRSS6 is not italised..

Many thanks for this precise comment and the T has been changed into italised.

3. Results

a. In the last sentence of the last paragraph, it is not clear what the authors meant by … “associated with recessive genotypes”. The phrase may be removed.

Many thanks for this essential comment. The phrase has been removed and the sentence changed to “associated with increased risk for IDA in the female students in the study”.

4. Discussion section

a. The beginning of paragraph 3: “McLaren and his colleagues studied SNP in gene TMPRSS6 in four different ethnic groups…” should be revised. Also, the authors may consider removing the pronoun “his” when referring to other authors. Such sentences may be written as e.g. McLaren and colleagues studies.

Many thanks for this important comment and the “McLaren and his colleagues studied SNP in gene TMPRSS6 in four different ethnic groups…” has been be revised and changed. The sentence McLaren and his colleagues has been corrected to McLaren and colleagues studies.

b. In paragraph 4, line 4, the “H” in HFE should be italised.

Many thanks for this precise comment and the H has been changed into italised and highlighted in yellow

c. Millet and his colleagues, see above comments

Many thanks for this important comment. The Millet and his colleagues has been changed to Millet and colleagues and highlighted in yellow.

d. In line 6, it is not necessary to include the P value 0.002 in discussion here and in other places.

Many thanks for this important comment, the P values were removed.

e. In paragraph 5, lines 4 – 5, the sentence “… direct association between TMPRSS6 and increase risk of IDA” should be revised. The association reported by these authors is between specific TMPRSS6 SNPs and IDA but not TMPRSS6 only..

Many thanks for this important comment, the sentence has been corrected and the SNPS were included.

5. Additional general comments

1. Table 5 need reformatting. In the Odd ration column, there should be a space between the OR and the confidence interval e.g 3.74(0.19-73.05) should be written as 3.74 (0.19-73.05).

The table has been space was added and the column was updated.

2. There should be a footnote to explain what “ref.” means

The footnote was added.

3. Table 6 should be on one page. And see the above comments regarding footnotes and brakets.

The footnote was added and the space also was added.

Many thanks for the fairly and timely peer review along with valuable comments. We addressed all the highlighted reviewers' comments with a hope that, the revised manuscript will be considered for publication in your decent journal.

Looking forward to hearing from you soon.

Best regards

Yousef Hawsawi

Submitted filename: Response second to reviewer 05-09-2021.docx

Click here for additional data file.

14 Sep 2021

Association of SNPs within TMPRSS6 and BMP2 genes with iron deficiency status in Saudi Arabia

PONE-D-21-07480R2

Dear Dr. Hawsawi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Cinzia Ciccacci

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

5 Nov 2021

PONE-D-21-07480R2

Association of SNPs within TMPRSS6 and BMP2 genes with iron deficiency status in Saudi Arabia

Dear Dr. Hawasawi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Cinzia Ciccacci

Academic Editor

PLOS ONE