Many tissue-specific stem cells maintain the ability to produce multiple cell types during long periods of non-division, or quiescence. FOXO transcription factors promote quiescence and stem cell maintenance, but the mechanisms by which FOXO proteins promote multipotency during quiescence are still emerging. The single FOXO ortholog in C. elegans, daf-16, promotes entry into a quiescent and stress-resistant larval stage called dauer in response to adverse environmental cues. During dauer, stem and progenitor cells maintain or re-establish multipotency to allow normal development to resume after dauer. We find that during dauer, daf-16/FOXO prevents epidermal stem cells (seam cells) from prematurely adopting differentiated, adult characteristics. In particular, dauer larvae that lack daf-16 misexpress collagens that are normally adult-enriched. Using col-19p::gfp as an adult cell fate marker, we find that all major daf-16 isoforms contribute to opposing col-19p::gfp expression during dauer. By contrast, daf-16(0) larvae that undergo non-dauer development do not misexpress col-19p::gfp. Adult cell fate and the timing of col-19p::gfp expression are regulated by the heterochronic gene network, including lin-41 and lin-29. lin-41 encodes an RNA-binding protein orthologous to LIN41/TRIM71 in mammals, and lin-29 encodes a conserved zinc finger transcription factor. In non-dauer development, lin-41 opposes adult cell fate by inhibiting the translation of lin-29, which directly activates col-19 transcription and promotes adult cell fate. We find that during dauer, lin-41 blocks col-19p::gfp expression, but surprisingly, lin-29 is not required in this context. Additionally, daf-16 promotes the expression of lin-41 in dauer larvae. The col-19p::gfp misexpression phenotype observed in dauer larvae with reduced daf-16 requires the downregulation of lin-41, but does not require lin-29. Taken together, this work demonstrates a novel role for daf-16/FOXO as a heterochronic gene that promotes expression of lin-41/TRIM71 to contribute to multipotent cell fate in a quiescent stem cell model.
Many tissue-specific stem cells maintain the ability to produce multiple cell types during long periods of non-division, or quiescence. FOXO transcription factors promote quiescence and stem cell maintenance, but the mechanisms by which FOXO proteins promote multipotency during quiescence are still emerging. The single FOXO ortholog in C. elegans, daf-16, promotes entry into a quiescent and stress-resistant larval stage called dauer in response to adverse environmental cues. During dauer, stem and progenitor cells maintain or re-establish multipotency to allow normal development to resume after dauer. We find that during dauer, daf-16/FOXO prevents epidermal stem cells (seam cells) from prematurely adopting differentiated, adult characteristics. In particular, dauer larvae that lack daf-16 misexpress collagens that are normally adult-enriched. Using col-19p::gfp as an adult cell fate marker, we find that all major daf-16 isoforms contribute to opposing col-19p::gfp expression during dauer. By contrast, daf-16(0) larvae that undergo non-dauer development do not misexpress col-19p::gfp. Adult cell fate and the timing of col-19p::gfp expression are regulated by the heterochronic gene network, including lin-41 and lin-29. lin-41 encodes an RNA-binding protein orthologous to LIN41/TRIM71 in mammals, and lin-29 encodes a conserved zinc finger transcription factor. In non-dauer development, lin-41 opposes adult cell fate by inhibiting the translation of lin-29, which directly activates col-19 transcription and promotes adult cell fate. We find that during dauer, lin-41 blocks col-19p::gfp expression, but surprisingly, lin-29 is not required in this context. Additionally, daf-16 promotes the expression of lin-41 in dauer larvae. The col-19p::gfp misexpression phenotype observed in dauer larvae with reduced daf-16 requires the downregulation of lin-41, but does not require lin-29. Taken together, this work demonstrates a novel role for daf-16/FOXO as a heterochronic gene that promotes expression of lin-41/TRIM71 to contribute to multipotent cell fate in a quiescent stem cell model.
Tissue-specific stem cells divide as needed to replenish cells lost due to injury or normal wear and tear. Many stem cell types retain the capacity to produce multiple cell types during lengthy periods of quiescence, or non-division, and increased cell division can lead to compromised multipotency and stem cell maintenance [1]. However, the connections between quiescence and multipotency are incompletely understood. Caenorhabditis elegans (C. elegans) development can be interrupted by a quiescent and stress-resistant stage called dauer in response to adverse environmental conditions [2]. Stem cell-like progenitor cells maintain or re-establish multipotency during dauer, a situation analogous to mammalian stem cells [3-5].Dauer formation is regulated by three major signaling pathways [6,7]. One of these pathways is insulin/IGF signaling, where favorable environmental cues lead to the production of multiple insulin-like peptides in sensory neurons. [8-13]. These signals are released and then received in multiple tissues where insulin signaling blocks the activity of the downstream DAF-16/FOXO transcription factor [14-16]. In adverse environments, DAF-16 is active and regulates the expression of genes that promote dauer formation [6,10].The role of the DAF-16/FOXO transcription factor in promoting dauer formation is analogous to the role of the FOXO proteins in promoting quiescence in mammalian stem cells [17]. In addition, DAF-16/FOXO is required for stem cell maintenance and the ability of stem/progenitor cells to differentiate into the correct cell types in both systems [5,10,18-22]. For example, in C. elegans dauer larvae, daf-16 is required in a set of multipotent vulval precursor cells to block EGFR/Ras and LIN-12/Notch signaling from prematurely specifying vulval cell fates [5].Another group of progenitor cells that must remain quiescent and multipotent during dauer is the lateral hypodermal seam cells that make up part of the worm skin. Seam cells undergo self-renewing divisions at each larval stage and then terminally differentiate at adulthood [23]. Larval vs. adult seam cell fate is regulated by a network of heterochronic genes [24]. In general, heterochronic transcription factors and RNA-binding proteins that specify early cell fates are expressed early in development. These early cell fate-promoting factors are then downregulated by microRNAs in order to allow progression to later cell fates [25]. This pathway culminates with the expression of the LIN-29 transcription factor. LIN-29 is the most downstream regulator of adult cell fate and directly activates the expression of adult-specific collagens such as col-19 [26-29]. LIN-29 protein is not expressed in the hypodermis until late in larval development due to the combined action of the early-promoting heterochronic genes lin-41 and hbl-1 [27,30,31]. lin-41 encodes an RNA-binding protein that binds to the lin-29 mRNA and blocks translation of the lin-29a isoform [30,32]. lin-29 is also required for adult cell fate in post-dauer animals. However, many genes that act earlier in the heterochronic pathway are dispensable for post-dauer development, suggesting that the regulation of adult cell fate differs in continuous and dauer life histories [3].Here, we examine the role of daf-16/FOXO in maintaining multipotent seam cell fate during dauer. We find that daf-16 is required to block the expression of multiple adult-enriched collagens during dauer, including col-19, defining a novel role for daf-16 as a dauer-specific heterochronic gene. Using the adult cell fate marker col-19p::gfp as a readout, we find that daf-16 acts via lin-41 to regulate adult cell fate. Surprisingly, lin-29 plays at most a minor role in the regulation of col-19p::gfp during dauer. mRNA-seq experiments identified 3603 genes that are regulated by daf-16 during dauer, including 112 transcription factors that may mediate repression of adult-enriched collagens during dauer downstream of daf-16.
Results
daf-16 blocks adult-specific collagen expression in dauer larvae
Progenitor cells remain multipotent throughout dauer diapause, and daf-16 is required to maintain or re-establish multipotency in the vulval precursor cells (VPCs) of dauer larvae [5]. We asked whether daf-16/FOXO might also promote multipotency in lateral hypodermal seam cells, another multipotent progenitor cell type. The well-characterized adult cell-fate marker col-19p::gfp, where GFP expression is driven by the adult-specific col-19 promoter, is expressed in differentiated seam cells and the hyp7 syncytium in adult worms but is not expressed in multipotent seam cells or hyp7 in larvae [28,33]. To determine if daf-16/FOXO promotes multipotent, larval seam cell fate during dauer, we assayed larvae with reduced or absent daf-16, termed “daf-16(-)”, for precocious expression of col-19p::gfp. Specifically, we tested two daf-16 null alleles, daf-16(mu86) and daf-16(mgDf50), as well as daf-16(RNAi) dauer larvae. As daf-16(-) larvae are normally unable to enter dauer even in dauer-inducing environmental conditions (i.e., dauer defective), we took advantage of the temperature-sensitive dauer-constitutive allele daf-7(e1372) to enable dauer formation in daf-16(-) larvae. When grown at restrictive temperatures, both daf-16(-); daf-7(-) and control daf-7(-) larvae enter dauer even in favorable environments [34,35]. For simplicity, daf-7(e1372) is not always mentioned, but this allele was present in all daf-16(-) and control dauer larvae (see S1 Table for a complete list of strains used in this study). We found that daf-16(-) dauer larvae displayed penetrant col-19p::gfp expression in seam cells and hyp7 (Fig 1A). col-19p::gfp was expressed throughout the hypodermis, but was consistently brighter in the posterior third of the worm, gradually dimming toward the anterior. These findings indicate that daf-16 is necessary to block col-19p::gfp expression during dauer. For the remainder of the paper, “daf-16(0)” is used to indicate the daf-16(mgDf50) null allele, a large deletion that removes most of the daf-16 coding sequence, including the DNA-binding domain [15].
Fig 1
daf-16 is required to prevent precocious adoption of adult cell fate during dauer.
(A) Merged DIC and fluorescence images taken with a 63x objective displaying a portion of the lateral hypodermis in dauer larvae. Unless otherwise specified, the background for all strains in this and subsequent figures was daf-7(e1372); col-19p::gfp. (See S1 Table for full genotypes). Compromised daf-16 activity due to either of two null alleles (left) or RNAi (right) resulted in col-19p::gfp expression. Numbers indicate larvae expressing col-19p::gfp over the total number of dauer larvae scored. (B) Percent of daf-7 (control) and daf-16(0); daf-7 larvae that expressed col-19p::gfp before dauer formation and over time in dauer. GFP expression began during the molt, peaked soon after entry into dauer, and declined thereafter. (C) Percent of wild-type (control) and daf-16(0) animals that expressed col-19p::gfp at different stages. These worms were wild-type for daf-7 and therefore did not enter L2d or dauer. Larvae at L1 arrest were hatched in the absence of food and were monitored for GFP expression over seven days. (D) Percent of dauer larvae lacking some or all daf-16 isoforms that expressed any hypodermal col-19p::gfp (see S1 Table for full genotypes). Note that daf-16(a,f) displayed decreased expressivity compared to daf-16(0); the dauer larvae expressing col-19p::gfp were noticeably dimmer than in the null allele (S2 Fig). NS: p = 0.55, Fisher Exact Test. (E) Heat maps depicting relative expression of adult-enriched collagens (left) or dauer-enriched collagens (right) in daf-16(0); daf-7 dauer larvae or daf-7 (control) dauer larvae from mRNA-seq data. The row-normalized reads for each of two biological replicates per strain are depicted. These collagens were expressed at significantly different levels (FDR ≤ 0.05) in daf-16(0) vs control dauer larvae in all cases except those collagens indicated by †. Adult and dauer-enriched collagens were identified using modENCODE data (S3 Table). Adult-enriched collagens were upregulated in daf-16(0) dauer larvae whereas dauer-enriched collagens were downregulated.
daf-16 is required to prevent precocious adoption of adult cell fate during dauer.
(A) Merged DIC and fluorescence images taken with a 63x objective displaying a portion of the lateral hypodermis in dauer larvae. Unless otherwise specified, the background for all strains in this and subsequent figures was daf-7(e1372); col-19p::gfp. (See S1 Table for full genotypes). Compromised daf-16 activity due to either of two null alleles (left) or RNAi (right) resulted in col-19p::gfp expression. Numbers indicate larvae expressing col-19p::gfp over the total number of dauer larvae scored. (B) Percent of daf-7 (control) and daf-16(0); daf-7 larvae that expressed col-19p::gfp before dauer formation and over time in dauer. GFP expression began during the molt, peaked soon after entry into dauer, and declined thereafter. (C) Percent of wild-type (control) and daf-16(0) animals that expressed col-19p::gfp at different stages. These worms were wild-type for daf-7 and therefore did not enter L2d or dauer. Larvae at L1 arrest were hatched in the absence of food and were monitored for GFP expression over seven days. (D) Percent of dauer larvae lacking some or all daf-16 isoforms that expressed any hypodermal col-19p::gfp (see S1 Table for full genotypes). Note that daf-16(a,f) displayed decreased expressivity compared to daf-16(0); the dauer larvae expressing col-19p::gfp were noticeably dimmer than in the null allele (S2 Fig). NS: p = 0.55, Fisher Exact Test. (E) Heat maps depicting relative expression of adult-enriched collagens (left) or dauer-enriched collagens (right) in daf-16(0); daf-7 dauer larvae or daf-7 (control) dauer larvae from mRNA-seq data. The row-normalized reads for each of two biological replicates per strain are depicted. These collagens were expressed at significantly different levels (FDR ≤ 0.05) in daf-16(0) vs control dauer larvae in all cases except those collagens indicated by †. Adult and dauer-enriched collagens were identified using modENCODE data (S3 Table). Adult-enriched collagens were upregulated in daf-16(0) dauer larvae whereas dauer-enriched collagens were downregulated.Wild type daf-16/FOXO promotes dauer formation largely in parallel to the DAF-3/SMAD-DAF-5/Ski complex [6,7]. To test whether this complex is also required to block col-19p::gfp expression during dauer, we examined daf-5(0) dauer larvae. Similar to daf-16(-) larvae, daf-5(0) larvae do not normally develop through dauer. To obtain daf-5(0) dauers, we used the daf-2(e1370) allele to drive dauer formation in the daf-5(0) background. [34,35]. We found that daf-5(0); daf-2(e1370) dauer larvae never expressed col-19p::gfp (S1 Fig). Therefore, while daf-16 and daf-5 act in parallel to promote dauer formation, the regulation of adult cell fate is specific to daf-16.We next asked whether daf-16/FOXO regulates col-19p::gfp expression during stages other than dauer. First, we examined the timing of col-19p::gfp expression in larvae before, during, and after their entry into dauer. In wild-type animals, col-19p::gfp expression begins during the L4 molt, peaks soon after molting to adulthood, and then declines over time. Similarly, in daf-16(0) mutants, col-19p::gfp expression begins during the L2d-to-dauer molt, peaks soon after larvae enter dauer, and then declines over time in dauer (Fig 1B). Next, we asked whether larvae that develop continuously express precocious col-19p::gfp. For this experiment, we used larvae that were wild-type for daf-7. col-19p::gfp expression was never observed in daf-16(0) larvae during continuous development, and col-19p::gfp was expressed normally in adults (Fig 1C). Finally, we asked whether daf-16(0) larvae in L1 arrest express col-19p::gfp. Dauer shares some similarities with L1 arrest, which is a developmentally arrested and quiescent stage occurring when L1 larvae hatch in the absence of food [36]. daf-16/FOXO is important for L1 arrest; arrested daf-16(0) mutant larvae precociously initiate post-embryonic development including V lineage seam cell divisions [21]. However, we saw no precocious col-19p::gfp expression in these larvae (Fig 1C).We next wondered which daf-16 isoforms block col-19p::gfp expression during dauer. There are three major isoforms of daf-16: a, b, and f [15,16,37]. The a and f isoforms together are the major players with respect to the role of daf-16 in longevity, dauer formation, and stress resistance [38]. Isoform a plays a larger role than f, but the f isoform still contributes because mutants lacking isoforms a and f display a stronger phenotype than mutants lacking either single isoform. By contrast, the b isoform is dispensable because animals lacking a and f isoforms were indistinguishable from null mutants for the phenotypes tested [38]. In contrast, the b isoform regulates neuronal morphology and function [39,40]. To determine which daf-16 isoforms contribute to maintaining seam cell multipotency during dauer, we used the same isoform-specific alleles used by Chen et al. (2015) [38] to assess col-19p::gfp expression during dauer. Loss of only daf-16a produced a stronger phenotype than loss of only daf-16f, and loss of both daf-16a and f produced an even stronger phenotype than loss of either individual isoform examined, indicating that both isoforms contribute (Figs 1D and S2). Loss of a and f together caused expression of col-19p::gfp at high penetrance (Fig 1D), however this expression was dimmer and in fewer cells than the expression observed with in the null background (S2 Fig). Therefore, since loss of daf-16a/f did not produce a phenotype as strong as that of the complete null, the b isoform must also play a role. Taken together, we conclude that all three isoforms of daf-16 contribute to blocking col-19p::gfp expression during dauer.To extend these findings beyond col-19p::gfp reporter expression, we performed mRNA-seq and differential gene expression analysis on daf-16(0) vs. control dauer larvae. Consistent with the data from col-19p::gfp experiments, we found that endogenous col-19 was highly and significantly upregulated in daf-16 mutants. Furthermore, 19/22 other adult-enriched collagens were also upregulated (Fig 1E and S3 Table). Similar to col-19p::gfp, most of these adult-enriched collagens appear to be expressed in seam cells and in hyp7 (S4 Table). Consistent with the upregulation of adult-enriched collagens, 23/24 dauer-enriched collagens were downregulated in daf-16(0) dauer larvae (Fig 1E), indicating an overall shift to genes required for adult cuticle formation in daf-16(0) dauer larvae.In wild-type animals, the onset of col-19p::gfp expression coincides with several other characteristics of adult seam cell fate, including the production of adult alae, cell-cycle exit, and seam-cell fusion [23,24,41]. Although daf-16(0) dauer larvae express adult collagens, they do not display these other adult characteristics. Consistent with previous reports, we observed that daf-16(0) dauer larvae display dauer alae, which are distinct from adult alae [15,34]. Using the wIs78 transgenic strain that expresses GFP in both seam cell nuclei (scm::gfp) and apical junctions (ajm-1::gfp) [42], we found that seam cells in daf-16(0) dauer larvae remained unfused (S3 Fig). Additionally, seam cells in daf-16(0) dauer larvae failed to maintain quiescence and underwent cell divisions (S3 Fig). These cell divisions were similar to the asymmetric divisions that normally occur during the L1, L3, and L4 stages (S3 Fig). Seam cell division does not occur during either adult or dauer stages in wild-type animals, however daf-16/FOXO is required for cell-cycle arrest in other contexts [21,22]. Therefore, during dauer, daf-16/FOXO both promotes seam cell quiescence and blocks adult cell fate, where its role in regulating seam cell fate is predominantly to control stage-specific collagen expression.
daf-16 promotes expression of lin-41 during dauer
During continuous development, the timing of col-19p::gfp expression is regulated by the heterochronic gene network [24,28,33,43]. To determine how daf-16 interacts with heterochronic genes, we began by asking whether heterochronic genes that oppose adult cell fate during continuous development might also be required to block col-19p::gfp expression during dauer. We focused on the three most downstream of these heterochronic genes, lin-14, hbl-1, and lin-41 (Fig 2A). We found that knockdown of lin-14 and hbl-1 resulted in little to no col-19p::gfp expression in hypodermal cells whereas lin-41 RNAi resulted in penetrant col-19p::gfp expression in lateral hypodermal cells during dauer (Fig 2B). Similar to daf-16(RNAi), col-19p::gfp expression in lin-41(RNAi) dauer larvae was brightest in the posterior of the worm, and dim or absent in the anterior. However, overall col-19p::gfp expression was dimmer in lin-41(RNAi) dauer larvae compared to daf-16(RNAi) (S4 Fig). In addition, some col-19p::gfp expression was observed in non-hypodermal cell types in hbl-1(RNAi) and lin-41(RNAi) dauer larvae (S5 Fig).
Fig 2
lin-41 is required to prevent precocious adoption of adult cell fate during dauer.
(A) A simplified diagram of the network of heterochronic genes that regulates stage-specific seam cell fate during continuous development. “3 let-7s” indicates the let-7 family members, mir-48, mir-84, and mir-241. Genes in red are the most downstream positive regulators of larval cell fates [25]. (B) Precocious hypodermal expression of col-19p::gfp in dauer larvae in response to RNAi of heterochronic genes compared to the lacZ and daf-16 RNAi controls. Images were taken with a 63x objective. Numbers indicate the number of larvae expressing any hypodermal col-19p::gfp over the total number of dauer larvae scored. lin-14 RNAi induced only dim expression of col-19p::gfp, at low penetrance. hbl-1 RNAi did not induce hypodermal expression of col-19p::gfp. lin-41 RNAi caused highly penetrant expression of col-19p::gfp during dauer.
lin-41 is required to prevent precocious adoption of adult cell fate during dauer.
(A) A simplified diagram of the network of heterochronic genes that regulates stage-specific seam cell fate during continuous development. “3 let-7s” indicates the let-7 family members, mir-48, mir-84, and mir-241. Genes in red are the most downstream positive regulators of larval cell fates [25]. (B) Precocious hypodermal expression of col-19p::gfp in dauer larvae in response to RNAi of heterochronic genes compared to the lacZ and daf-16 RNAi controls. Images were taken with a 63x objective. Numbers indicate the number of larvae expressing any hypodermal col-19p::gfp over the total number of dauer larvae scored. lin-14 RNAi induced only dim expression of col-19p::gfp, at low penetrance. hbl-1 RNAi did not induce hypodermal expression of col-19p::gfp. lin-41 RNAi caused highly penetrant expression of col-19p::gfp during dauer.Since both daf-16 and lin-41 block col-19p::gfp expression in dauer larvae, we asked whether daf-16 regulates lin-41 expression. We examined our mRNA-seq data and also performed qPCR on daf-16(0) and control dauer larvae. In these experiments, lin-41 was downregulated approximately 2-fold in daf-16(0) dauers compared to control dauer larvae (Fig 3A). In contrast, there was no significant change in mRNA levels of the other core heterochronic genes (S6 Fig). Together, these data suggest that during dauer, daf-16 specifically promotes lin-41 expression to block col-19p::gfp and adult cell fate, and that in daf-16(-) dauers, lower levels of lin-41 lead to precocious col-19p::gfp expression.
Fig 3
daf-16 promotes lin-41 expression during dauer to regulate col-19p::gfp.
(A) lin-41 was downregulated in daf-16(0); daf-7 dauer larvae compared to daf-7 (control) dauers, as measured by mRNA-seq (FDR < 0.05) and qPCR (p = 0.2, two-tailed Mann-Whitney test). At least two biological replicates per strain were used (see Methods). Raw qPCR data are shown in S5 Table. (B) Misexpression of lin-41 caused by lin-41(xe8[Δ3’UTR]) suppressed the col-19p::gfp phenotype in daf-16(RNAi) dauer larvae. Fluorescence levels were determined as described in S7 Fig. Each point represents an individual worm; horizontal lines indicate the mean fluorescence level. ****p<0.0001 (Two-tailed Mann-Whitney Test). n = 39–80; see S6 Table for complete underlying numerical data.
daf-16 promotes lin-41 expression during dauer to regulate col-19p::gfp.
(A) lin-41 was downregulated in daf-16(0); daf-7 dauer larvae compared to daf-7 (control) dauers, as measured by mRNA-seq (FDR < 0.05) and qPCR (p = 0.2, two-tailed Mann-Whitney test). At least two biological replicates per strain were used (see Methods). Raw qPCR data are shown in S5 Table. (B) Misexpression of lin-41 caused by lin-41(xe8[Δ3’UTR]) suppressed the col-19p::gfp phenotype in daf-16(RNAi) dauer larvae. Fluorescence levels were determined as described in S7 Fig. Each point represents an individual worm; horizontal lines indicate the mean fluorescence level. ****p<0.0001 (Two-tailed Mann-Whitney Test). n = 39–80; see S6 Table for complete underlying numerical data.To test whether reduced lin-41 levels are required for precocious col-19p::gfp expression in daf-16(0) dauers, we performed daf-16 RNAi on a strain in which lin-41 is misexpressed. To do this, we took advantage of the lin-41(xe8[Δ3’UTR]) allele which prevents the normal downregulation of lin-41 in late larval stages and causes a strong gain-of-function phenotype [44,45]. We found the col-19p::gfp phenotype produced by daf-16(RNAi) was markedly suppressed in lin-41(xe8) dauer larvae, consistent with the hypothesis that daf-16 works through lin-41 to block col-19p::gfp expression during dauer (Fig 3B). To ensure that the observed suppression was not due to the lin-41(xe8) strain being less sensitive to RNAi, we tested the response of lin-41(xe8) and control strains to unc-22 RNAi and found a similar response in both strains (S8 Fig).
lin-29 is not required for col-19p::gfp expression in lin-41(-) dauer larvae
During continuous development, lin-41 opposes col-19p::gfp and adult cell fate by directly repressing the translation of the LIN-29 transcription factor [30,32]. LIN-29 is in turn a direct activator of col-19 transcription and is thought to be the most downstream regulator of other aspects of adult cell fate [26,27,31]. If the col-19p::gfp expression observed in lin-41(RNAi) dauer larvae is due to misexpression of LIN-29, then loss of lin-29 should prevent col-19p::gfp expression. To ask this question, we used the lin-29(xe37) deletion allele that removes all but 27 amino acids of LIN-29 [45]. Surprisingly, we saw no effect of the loss of lin-29 on the expression of col-19p::gfp in lin-41(RNAi) dauer larvae (Fig 4A). As a control, we established that our strain produced the expected lin-29(0) phenotypes in adults: a drastic reduction of col-19p::gfp and a complete lack of adult alae formation (S9 Fig).
Fig 4
lin-41 regulates col-19p::gfp independently of lin-29 in dauer larvae.
(A) lin-29 is not required for col-19p::gfp expression in lin-41(RNAi) dauers. Fluorescence levels were determined as described in S7 Fig. ns = not significant (p = 0.4856, two-tailed Mann-Whitney Test). n = 33–41; see S7 Table for complete underlying numerical data. (B) lin-41(0); lin-29(0) dauer larvae expressed col-19p::gfp. nIs408 is a transgene used to balance lin-41(0) (see text). lin-41(0) larvae are dauer-defective [47]. Numbers indicate the number of dauers expressing col-19p::gfp over total dauers scored. (C, D) lin-29::gfp expression imaged on a compound microscope (C) or a confocal microscope (D). Images were taken with a 63x objective. Arrowheads indicate hypodermal nuclei with visible lin-29::gfp expression. Numbers indicate the number of larvae expressing any detectable lin-29::gfp over total number of larvae. lin-41(RNAi) produced substantial precocious expression of lin-29::gfp in continuously developing L3 staged larvae, easily discernable under the compound microscope. However, lin-41(RNAi) produced only very dim expression in dauer larvae. Dauer larvae produce substantial autofluorescence at the microscope settings required to visualize lin-29::gfp.
lin-41 regulates col-19p::gfp independently of lin-29 in dauer larvae.
(A) lin-29 is not required for col-19p::gfp expression in lin-41(RNAi) dauers. Fluorescence levels were determined as described in S7 Fig. ns = not significant (p = 0.4856, two-tailed Mann-Whitney Test). n = 33–41; see S7 Table for complete underlying numerical data. (B) lin-41(0); lin-29(0) dauer larvae expressed col-19p::gfp. nIs408 is a transgene used to balance lin-41(0) (see text). lin-41(0) larvae are dauer-defective [47]. Numbers indicate the number of dauers expressing col-19p::gfp over total dauers scored. (C, D) lin-29::gfp expression imaged on a compound microscope (C) or a confocal microscope (D). Images were taken with a 63x objective. Arrowheads indicate hypodermal nuclei with visible lin-29::gfp expression. Numbers indicate the number of larvae expressing any detectable lin-29::gfp over total number of larvae. lin-41(RNAi) produced substantial precocious expression of lin-29::gfp in continuously developing L3 staged larvae, easily discernable under the compound microscope. However, lin-41(RNAi) produced only very dim expression in dauer larvae. Dauer larvae produce substantial autofluorescence at the microscope settings required to visualize lin-29::gfp.We next confirmed the lin-41 RNAi results using the null allele lin-41(n2914). Since lin-41(0) hermaphrodites are sterile [30], we used an available transgene that is integrated close to the lin-41 locus as a balancer: nIs408[lin-29::mCherry, ttx-3p::gfp] [46]. This transgene had the added advantage of rescuing some of the lin-29(0) defects, making the strain easier to maintain (see Methods). When we induced dauer formation in the progeny of lin-41(0)/nIs408 and lin-41(0)/nIs408; lin-29(0) mothers, we found that lin-41(0); lin-29(+) homozygous larvae, recognized by the lack of ttx-3p::gfp expression, were largely dauer defective (see [47]). Of the two lin-41(0) dauer larvae we recovered, one expressed col-19p::gfp (Fig 4B). Interestingly, 62% of larvae expressing ttx-3p::gfp displayed col-19p::gfp expression. This percentage is close to the 2/3 of transgene-containing larvae segregating from the heterozygous parent that would be predicted to be lin-41(0)/nIs408 heterozygotes, suggesting that lin-41 is haploinsufficient in its role in blocking col-19p::gfp during dauer. To bolster this supposition, we confirmed that dauer larvae homozygous for nIs408 do not express col-19p::gfp (Fig 4B).Although lin-41(0) homozygous larvae display a dauer-defective phenotype, lin-41(0); lin-29(0) larvae do not [47]. We were therefore able to test lin-41(0); lin-29(0) dauer larvae for col-19p::gfp expression. Approximately half of these larvae expressed col-19p::gfp (Fig 4B). Although the dauer-defective phenotype of lin-41(0) single mutants prevented us from determining the extent to which loss of lin-29 suppresses the col-19p::gfp phenotype in lin-41(0) homozygous mutant dauer larvae, these results do confirm that col-19p::gfp can be misexpressed in lin-41(0) dauer larvae even in the absence of lin-29.To better understand the relationship between lin-41 and lin-29 during dauer, we asked whether lin-41 is required to block LIN-29 expression in dauer larvae. During continuous development, lin-41 mutants display precocious hypodermal expression of LIN-29 [30,32]. We used lin-29(xe61[lin-29::gfp]), which tags both isoforms of lin-29 [32] to assess the effect of lin-41 RNAi during dauer. Using settings that allow unambiguous visualization of hypodermal lin-29::gfp during L4 and adult stages, we saw only extremely dim lin-29::gfp expression in lin-41(RNAi) dauer larvae, just at the edge of detection (Fig 4C). We used confocal microscopy as a more sensitive assay to confirm that lin-29::gfp is expressed, albeit at very low levels in lin-41(RNAi) but not control dauer larvae (Fig 4D). In control RNAi experiments run in parallel, lin-41(RNAi) was able to cause strong col-19p::gfp expression in dauer larvae (24/27 larvae examined), demonstrating that there were no technical problems in the RNAi experiment that would lead to such low expression. Finally, we confirmed that lin-41(RNAi) produces the expected precocious lin-29::gfp expression in L3 staged larvae that developed continuously (Fig 4C). Taken together, contrary to the role of lin-29 during continuous development, our data indicate that lin-41 regulates col-19p::gfp expression in dauer larvae and that lin-29 does not play a significant role in this regulation.
daf-16 acts at least partially independently of lin-29 to regulate col-19p::gfp during dauer
As described above, daf-16 promotes lin-41 expression during dauer, and misexpression of lin-41 suppresses the precocious col-19p::gfp expression observed in daf-16(0) dauer larvae. Since lin-29 was not required for misexpression of col-19p::gfp in lin-41(-) dauer larvae, we hypothesized that lin-29 would also be dispensable for col-19p::gfp expression in daf-16(-) dauer larvae. We found that neither of two lin-29 null alleles affected the penetrance of col-19p::gfp expression in daf-16(0) mutant dauers, demonstrating that the misexpression of col-19p::gfp in daf-16(0) dauer larvae does not depend on lin-29 (Fig 5A). However, when we compared levels of expression between the strains, we found a small but statistically significant decrease in expression in dauer larvae that lack lin-29, indicating that the presence of lin-29 bolsters col-19p::gfp expression slightly (Fig 5B). We next asked whether loss of daf-16 affects expression of lin-29. Examining our mRNA-seq data, no significant difference in lin-29 mRNA levels were observed in daf-16(0) vs. control dauer larvae (S6 Fig). However, during continuous development, regulation of lin-29a by lin-41 occurs translationally and may not be evident from mRNA levels [32,48]. We next examined lin-29::gfp expression in daf-16(0) dauer larvae. Unlike the dim lin-29::gfp expression we observed in lin-41(RNAi) dauer larvae, lin-29::gfp expression in the hypodermis was completely undetectable in daf-16(0) dauer larvae. Using confocal microscopy, 0/24 daf-16(0) dauer larvae displayed detectable lin-29::gfp. Taken together, these experiments demonstrate that daf-16 regulates col-19p::gfp expression largely independently of lin-29.
Fig 5
daf-16 acts at least partially independently of lin-29 to block adult cell fate during dauer.
(A) daf-16(0); lin-29(0) dauers expressed col-19p::gfp at a similar penetrance to daf-16(0) dauers. n546 is a nonsense mutation and xe37 is a deletion of all but 27 amino acids. Images were taken with a 63x objective. Numbers indicate the number of dauers expressing hypodermal col-19p::gfp over the total number of dauers. (B) Levels of col-19p::gfp are slightly reduced in daf-16(0); lin-29(xe37) dauer larvae compared to daf-16(0) dauers. Fluorescence levels were determined as described in S7 Fig. ****p<0.0001 (Two-tailed Mann-Whitney Test). n = 34–50; see S8 Table for complete underlying numerical data.
daf-16 acts at least partially independently of lin-29 to block adult cell fate during dauer.
(A) daf-16(0); lin-29(0) dauers expressed col-19p::gfp at a similar penetrance to daf-16(0) dauers. n546 is a nonsense mutation and xe37 is a deletion of all but 27 amino acids. Images were taken with a 63x objective. Numbers indicate the number of dauers expressing hypodermal col-19p::gfp over the total number of dauers. (B) Levels of col-19p::gfp are slightly reduced in daf-16(0); lin-29(xe37) dauer larvae compared to daf-16(0) dauers. Fluorescence levels were determined as described in S7 Fig. ****p<0.0001 (Two-tailed Mann-Whitney Test). n = 34–50; see S8 Table for complete underlying numerical data.
daf-16/FOXO regulates the expression of many genes during dauer
Since the key downstream regulator of col-19 expression is not required for the misexpression of col-19p::gfp in daf-16(0) dauer larvae, one or more different regulators must activate or derepress col-19p::gfp expression in this context. One possibility is that DAF-16 itself is a direct activator. Two pieces of indirect evidence initially argued against this possibility. First, the promoter sequence used in the col-19p::gfp transgene does not contain a canonical DAF-16/FOXO binding element (TGTTTAC) (S10 Fig) [49]. Furthermore, ChIP-seq experiments performed as part of modENCODE and displayed on WormBase did not show binding of DAF-16 to the col-19 promoter [50]. However, this evidence is not conclusive. The consensus sequence for DAF-16/FOXO binding elements is very broad, leaving open the possibility that DAF-16 could recognize a non-canonical site [51]. In addition, the ChIP-seq experiments were carried out during the L4/young adult stage, whereas the only time that we see aberrant col-19p::gfp expression in daf-16(0) mutant larvae is during dauer. To more definitively test DAF-16 binding at the col-19 promoter during the dauer stage, we used an endogenously tagged daf-16::zf1::wrmScarlet::3xFLAG strain to perform ChIP-qPCR during dauer. As expected, the promoter for a confirmed DAF-16 target, mtl-1 [52,53] showed 18–30 fold enrichment in the daf-16::3xflag ChIP sample compared to wild type. By contrast, the promoter for col-19 showed only 2-4-fold enrichment in the daf-16::3xflag ChIP sample compared to wild type (Figs 6A and S11). This lower level of DAF-16 enrichment at the col-19 promoter was comparable to the DAF-16 enrichment at the coding region of the heterochromatinized gene bath-45, suggesting that the DAF-16 ChIP-qPCR experiments were inherently noisy. These data indicate that daf-16 blocks col-19p::gfp expression indirectly.
Fig 6
Gene expression changes in daf-16(0) dauer larvae.
(A) DAF-16 is not enriched at the col-19 promoter. ChIP-qPCR experiments were performed on N2 or daf-16(ar620[daf-16::zf1-wrmScarlet-3xFLAG]) dauer larvae. Binding of DAF-16-3xFLAG was first normalized to input, and then to the average of the respective wild-type value (mean +/- SD for two technical replicates) is shown. Binding to the col-19 promoter was not observed, whereas there was substantial binding to the promoter of the known DAF-16 target mtl-1 [52,53]. The coding region of the heterochromatinized gene bath-45 was used as negative control. A second biological replicate is shown in S11 Fig, and raw data are shown in S9 Table. (B) Volcano plot showing gene expression changes observed in daf-16(0) dauer larvae compared to control dauer larvae. Full mRNA-seq data can be found in NCBI under GEO accession number GSE179166. mtl-1 and sod-3 are known transcriptional targets of DAF-16 [52,53,74,75]. (C) Genetic model of the regulation of col-19p::gfp and adult cell fate during dauer, based on data presented in the text.
Gene expression changes in daf-16(0) dauer larvae.
(A) DAF-16 is not enriched at the col-19 promoter. ChIP-qPCR experiments were performed on N2 or daf-16(ar620[daf-16::zf1-wrmScarlet-3xFLAG]) dauer larvae. Binding of DAF-16-3xFLAG was first normalized to input, and then to the average of the respective wild-type value (mean +/- SD for two technical replicates) is shown. Binding to the col-19 promoter was not observed, whereas there was substantial binding to the promoter of the known DAF-16 target mtl-1 [52,53]. The coding region of the heterochromatinized gene bath-45 was used as negative control. A second biological replicate is shown in S11 Fig, and raw data are shown in S9 Table. (B) Volcano plot showing gene expression changes observed in daf-16(0) dauer larvae compared to control dauer larvae. Full mRNA-seq data can be found in NCBI under GEO accession number GSE179166. mtl-1 and sod-3 are known transcriptional targets of DAF-16 [52,53,74,75]. (C) Genetic model of the regulation of col-19p::gfp and adult cell fate during dauer, based on data presented in the text.To identify candidate regulators of col-19p::gfp and endogenous adult collagen expression during dauer, we looked more broadly at the changes in gene expression that occur downstream of daf-16/FOXO using our mRNA-seq data comparing daf-16(0) vs. control dauer larvae. We found that 2027 genes were downregulated ≥2-fold in daf-16(0) dauers, and 1576 genes were upregulated ≥2-fold in daf-16(0) dauers (FDR ≤ 0.05) (Fig 6B). Interestingly, when we performed functional annotation clustering on these differentially expressed genes using the Database for Annotation, Visualization, and Integrated Discovery (http://david.abcc.ncifcrf.gov/), terms related to collagens and cuticle structure were highly enriched among both downregulated and upregulated genes (S12 and S13 Figs). Signaling-related terms were also highly enriched, including terms related to ion transport associated with the downregulated genes and terms related to protein kinases and phosphatases associated with the upregulated genes (S12 and S13 Figs). Of the genes whose expression was affected, 112 encode transcription factors (91 downregulated and 21 upregulated) and are candidate genes to directly regulate col-19p::gfp expression and adult cell fate during dauer (S14 Fig).
Discussion
Heterochronic genes specify stage-specific seam cell fate at each larval stage and at adulthood [24]. During continuous development, heterochronic genes function as a cascade where successive microRNAs act as molecular switches to downregulate early cell fate-promoting transcription factors and RNA-binding proteins, allowing progression to the next cell fate [25,54]. The decision to enter dauer drastically alters the timing of developmental progression [2]. Perhaps for this reason, extensive modulation of the heterochronic pathway has been identified in pre- and post-dauer stages [3,55-57]. For example, many heterochronic genes that are essential for stage-specific cell fate specification during continuous development are dispensable after dauer [3,42,43,55]. However, the mechanisms that act to prevent precocious specification within the dauer stage itself have not been addressed. Here, we find a novel role for daf-16/FOXO as a dauer-specific heterochronic gene. daf-16 opposes adult cell fate during dauer via a modified heterochronic pathway involving lin-41 but not lin-29.The heterochronic gene lin-41 encodes an RNA-binding protein that promotes larval cell fate and opposes adult cell fate during continuous development [30,58]. We found that lin-41 acts downstream of daf-16 to block adult cell fate during dauer. Specifically, both daf-16 and lin-41 are required to prevent precocious expression of the col-19p::gfp adult cell fate marker during dauer, and lin-41 expression is downregulated in daf-16(0) dauer larvae (Figs 1A, 2B and 3A). In contrast, the other early-promoting heterochronic genes tested, lin-14 and hbl-1, do not appear to play a role in regulating col-19p::gfp hypodermal expression during dauer, and their expression was not significantly affected in daf-16(0) dauer larvae (Figs 2B and S6). Finally, a lin-41 gain-of-function allele partially blocked the misexpression of col-19p::gfp caused by daf-16 RNAi (Fig 3B). All together, these data are consistent with a linear pathway whereby daf-16 positively regulates lin-41 during dauer to oppose col-19p::gfp and adult cell fate (Fig 6D). These findings do not exclude the possibility that daf-16 also regulates col-19p::gfp and adult cell fate in parallel to lin-41.The mechanism by which daf-16 promotes lin-41 expression is currently unknown. One possibility is that daf-16 regulates expression of lin-41 via the let-7 microRNA. During continuous development, lin-41 is expressed in early stages but is downregulated by the let-7 microRNA during the L4 stage to allow progression to adult cell fate. let-7 opposes lin-41 expression by binding to the lin-41 3’UTR and mediating silencing [30,58]. The ability of the lin-41(xe8[Δ3’UTR]) allele to interfere with the daf-16(-) phenotype suggests the possibility that let-7 is involved in this regulatory pathway.During continuous development lin-41 blocks adult cell fate by directly repressing the translation of the most downstream component in the heterochronic pathway, the LIN-29 transcription factor that promotes all aspects of adult cell fate [24,26,27,31,32]. LIN-29 expression remains low in the lateral hypodermis during early larval development due to the combined action of lin-41 and hbl-1 which regulate distinct lin-29 isoforms [30-32]. Surprisingly, we found that daf-16 and lin-41 regulate adult cell fate mostly independently of lin-29 (Fig 6D). During continuous development, the precocious phenotypes observed in lin-41(-) larvae are completely suppressed by compromising lin-29 activity [30]. Indeed, the phenotypes of every precocious heterochronic mutant tested during continuous development are suppressed by lin-29(-) alleles [26,30,42,43,59]. In contrast, loss of lin-29 had little to no effect on the precocious col-19p::gfp phenotype observed in daf-16(-) or lin-41(-) dauer larvae (Figs 4A, 4B, 5A and 5B). Therefore, whereas lin-29 is a direct transcriptional activator of col-19 and other adult-enriched collagens in the context of adults [27-29], our work demonstrates that during dauer, daf-16 blocks adult collagen expression through factor(s) other than lin-29. We found over 3600 genes whose expression changed in daf-16(0) dauer larvae, including 112 transcription factors. One or more of these factors may control the expression of the col-19p::gfp transcriptional reporter.In addition to regulating col-19p::gfp, we found that daf-16 is required during dauer to block expression of nearly all adult-enriched collagens. The expression of adult-enriched collagens in daf-16(0) dauer larvae is accompanied by a concomitant decrease in the expression of dauer-enriched collagens (Fig 1E). The effect of daf-16 mutations on the dauer cuticle may explain some of the previously observed defects in daf-16(0) dauer larvae. Two defining features of dauer larvae are the presence of dauer alae on the cuticle and resistance to treatment with detergents such as SDS. SDS-resistance depends in part on the specialized dauer cuticle [2]. daf-16(0) dauer larvae possess dauer alae that are slightly less defined than wild-type, and daf-16(0) dauers are only partially SDS-resistant [15,34,60,61]. It is possible that the shift from dauer-enriched collagens to adult-enriched collagens in daf-16(0) dauer larvae is responsible for these phenotypes. Notably, our functional annotation clustering analysis found that collagen-related terms were highly enriched among both upregulated and downregulated genes. This finding suggests that regulation of stage-specific collagen expression is a key role of daf-16/FOXO during dauer.Dauer interrupts development midway through the larval stages [2]. During dauer, progenitor cells that have not yet completed development must maintain or re-establish multipotent fate, neither differentiating prematurely nor losing their previously acquired tissue identity. The role we identified for daf-16 in blocking adult cell fate in lateral hypodermal cells during dauer appears to contribute to the maintenance of multipotency in lateral hypodermal seam cells. We have previously described an analogous role for daf-16 in promoting multipotent VPC fate [5]. In both contexts, daf-16 activity is important to prevent precocious adoption of cell fates that normally occur later in development, after recovery from dauer. However, the mechanisms by which these cell fates are adopted differ in each cell type. Adult seam cell fate is regulated by the heterochronic genes, whereas VPC fate specification is regulated primarily by EGFR/Ras and LIN-12/Notch signaling [24,25,62]. The ability of daf-16/FOXO to influence these distinct developmental pathways suggests that daf-16/FOXO has a broad role in promoting multipotent cell fate during dauer. As one of the major regulators of dauer formation, daf-16 is well-positioned to coordinate the decision to enter dauer with the necessary alterations to developmental pathways that are paused during dauer.daf-16 is the sole C. elegans ortholog of the genes encoding the FOXO proteins [15,16]. FOXO transcription factors regulate both stem cell quiescence and stem cell plasticity across species, from Hydra to mammals [20,63]. However, the mechanisms by which FOXO promotes multipotency in stem cells are still emerging. The protein encoded by the lin-41 ortholog, LIN41/TRIM71 also promotes cell fate plasticity in mammalian stem cells [64]. Our work provides the first connection between daf-16/FOXO and lin-41/TRIM71 and may be relevant to mammalian stem cells.
Methods
Strains and maintenance
A full list of strains and their genotypes used in this study is located in S1 Table. Balanced strains are described in more detail here. Homozygous lin-41(0) hermaphrodites are sterile, therefore for experiments involving the null allele lin-41(n2914), lin-41 was balanced with transgene nIs408[ttx-3p::gfp, lin-29::mCherry] [46], which we found to be closely linked to lin-41. At each generation, larvae that expressed ttx-3p::gfp were singled out and their progeny were monitored for segregation of lin-41(0) homozygotes that were Dpy, Ste, and lacked ttx-3p::gfp. The rescuing lin-29::mCherry enabled more robust growth in the lin-41(0)/nIs408; lin-29(0) strain than typical strains homozygous for lin-29(0). Although lin-29(0) mutants are homozygous viable, they are Egl, Pvl, and have reduced brood size [24]. For experiments, lin-41(n2914) homozygous larvae were identified based on the lack of ttx-3p::gfp expression. For more details about experiments involving these strains see Cale & Karp (2020) [47].Animals homozygous for the lin-41(xe8[Δ3’UTR]) allele burst at young adulthood [44]. This gain-of-function allele was balanced over the lin-41(bch28 xe70) allele, where bch28 is a complex insertion of eft-3p::gfp that disrupts the lin-41 locus, and xe70 is a deletion of the lin-41 3’UTR [45,65]. For experiments, lin-41(xe8) larvae were identified based on the lack of eft-3p::gfp expression.All strains were grown according to standard procedures on Nematode Growth Medium (NGM) plates seeded with the E. coli strain OP50 [66]. Strains were maintained at 15°C or 20°C.
Dauer induction
All strains used for experiments involving dauer larvae contained daf-7(e1372), which is a temperature-sensitive, hypomorphic allele that induces dauer entry at 24°C or 25°C [34,67]. Unless otherwise specified, dauer larvae were obtained by allowing 10–20 gravid adult hermaphrodites to lay embryos for 2–8 hours at 24°C, then removing the parents and allowing the embryos to incubate at 24°C. For all experiments except those in Fig 1B, dauer larvae were scored approximately 48–52 hours after egg-laying, a time soon after dauer formation (”early dauer” or 0-day dauer larvae). In Fig 1B when different stages were examined, L2d larvae were scored at 24 hours after egg-laying; L2d-dauer molt larvae were scored at 39 hours after egg-laying; 1-day dauer larvae were scored at 72 hours after egg-laying. Dauer formation was verified by looking for crisp, defined dauer alae and radial constriction [67].For experiments involving homozygous egg-laying-defective strains, including those with lin-29(0) or lin-29(xe61), embryos were obtained by sodium hypochlorite treatment consisting of two 2-minute incubations in 1M NaOH, 10% Clorox bleach. For experiments with XV254 daf-16(mgDf50); lin-29(xe37); daf-7(e1372); maIs105[col-19p::gfp] and controls, embryos were obtained by dissecting gravid adult hermaphrodites.
Nondauer stages
Continuous development (Fig 1C)
Strains XV33 maIs105[col-19p::gfp] and VT1750 daf-16(mgDf50); maIs105 were synchronized by allowing gravid adult hermaphrodites to lay embryos at 24°C or 25°C and then incubating the progeny until the desired stage was reached. Developmental stage was evaluated by the extent of gonad and/or vulval development and scored for col-19p::gfp or lin-29::gfp expression.
L1 arrest (Fig 1C)
To induce L1 arrest, embryos from strains XV33 and VT1750 were obtained by sodium hypochlorite treatment and then incubated at 20°C in M9 in a shaking incubator. L1 larvae were removed each day for 7 days and scored for col-19p::gfp expression.
Adults (S9 Fig)
Strains VT1777 daf-7(e1372); maIs105 and XV253 lin-29(xe37); daf-7(e1372); maIs105 were synchronized by sodium hypochlorite treatment. Embryos were placed on seeded NGM plates and grown at 20°C for 72–75 hours. Adults were scored for the presence of stage-specific alae and col-19p::gfp expression.
RNAi
RNAi bacteria were from the Ahringer library (Source Bioscience), except the lacZ RNAi clone was pXK10 [68]. RNAi plates were prepared by adding 300μL of an overnight culture of RNAi bacteria to 60mm NGM plates containing 50μg/mL carbenicillin and 200μg/mL IPTG. Embryos obtained from sodium hypochlorite treatment were plated onto seeded RNAi plates and incubated at 24°C to allow daf-7(e1372) larvae to enter dauer or daf-7(+) larvae to develop continuously.
Compound microscopy
Animals were picked onto slides made with 2% agarose pads and paralyzed with 0.1 M levamisole. A Zeiss AxioImager D2 compound microscope with HPC 200 C fluorescent optics was used to image worms. DIC and fluorescence images were obtained using a AxioCam MRm Rev 3 camera and ZEN 3.2 software. GFP was visualized with a high efficiency GFP shift free filter.
Confocal microscopy
Animals were picked onto slides made with 2% agarose pads and paralyzed with 0.1 M levamisole. A Nikon A1R scanning laser confocal light microscope was used to image worms using an excitation laser set to at wavelength of 488 nm. To visualize lin-29::gfp, the laser power was set to 70%.
Phenotypic data collection and analysis
All phenotypic data presented are from at least two independent experiments, typically performed by independent researchers. Any experiments that involved subjective decisions were blinded by having a lab member not involved in the experiment code the strains and/or images before scoring. Statistical analyses were performed on Graphpad Prism (version 9.1) and specific tests are described in individual figure legends. P-values < 0.05 were deemed statistically significant.
Sample collection for qPCR and RNA sequencing
Synchronized populations of VT2317 daf-16(mgDf50); daf-7(e1372) and control CB1372 daf-7(e1372) dauer larvae were obtained by incubating embryos isolated by sodium-hypochlorite treatment at 24°C for 52 hours. Because some daf-16; daf-7 animals grown under these conditions fail to enter dauer [60], dauer larvae from both strains were handpicked into M9 solution, washed twice, and then pelleted to a volume of 100μl packed worms. TRIzol reagent (Invitrogen) was added to the samples at a 10:1 ratio of TRIzol to worm pellet. The samples were then frozen in dry-ice/ethanol. Two biological replicates were obtained for each strain for mRNA-seq. For qPCR, we obtained two biological replicates of the wild-type sample and three biological replicates of the daf-16(0) mutant sample.
RNA isolation
Total RNA isolation from dauer sample was conducted using TriReagent (Ambion) protocol with the following modifications: pelleted C. elegans in TRI-Reagent were subjected to three freeze/thaw/vortex cycles prior to BCP addition to improve extraction efficiency, isopropanol precipitation was conducted in the presence of glycogen for 1hr at -80°C, RNA was pelleted by centrifugation at 4°C for 30 minutes at 20,000 x g; the pellet was washed three times in 70% ethanol and resuspended in water. BioAnalyzer assay (Agilent Technologies) was used for quality control of the RNA sequencing samples prior to library creation, with a minimum RIN of 8.5. NanoDrop2000 (Thermo Scientific) was used to quantify and assess the RNA quality of samples analyzed by qPCR.
RT-qPCR
cDNA was synthesized from 250ng total RNA using SuperScript III Reverse Transcriptase (Invitrogen) and analyzed with a CFX96 Real-Time System (BioRad) using Absolute Blue SYBR Green PCR MasterMix (Life Technologies). Relative lin-41 mRNA levels were calculated based on the ΔΔ2Ct method [69] using eft-2 for normalization. Results presented are the average values of independent calculations from biological replicates.
RT-qPCR primers
eft-2 F ACGCTCGTGATGAGTTCAAGeft-2 R ATTTGGTCCAGTTCCGTCTGlin-41 F GGTTCCAAATGCCACAAGAGlin-41 R AGGTCCAACTGCCAAATCAG
mRNA-seq library preparation and sequencing
Libraries were constructed using the TruSeq RNA Library Prep Kit v2 (Illumina). The DNA concentration and fragment size of sequencing libraries were analyzed using the BioAnalyzer assay (Agilent Technologies). High-throughput sequencing was performed on the Illumina HiSeq 2500 platform to generate paired-end reads of 100 bp.
mRNA-seq analysis
Basecalling and base call quality were performed using Illumina’s Real-Time Analysis (RTA) software, and CIDRSeqSuite 7.1.0 was used to convert compressed bcl files into compressed fastq files. Using Trimmomatic v. 0.39, Illumina adapters were clipped from raw mRNA-seq reads, followed by quality trimming (LEADING: 5; TRAILING: 5; SLIDINGWINDOW:4:15) [70]. Reads with a minimum length of 36 bases were retained (MINLEN: 36). Processed reads were aligned to C. elegans reference genome WBcel235 using STAR v. 2.4.2a with default parameters and—twopassMode Basic [71]. RSEM v. 2.1 was used to quantify gene abundance based on mapped reads [72]. Outlier samples were identified by assessing the quality of raw and processed reads with FastQC v. 0.11.7 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and by Principal Component Analysis (PCA) on log2-transformed normalized gene expression counts generated using DESeq2 v. 1.30.0 [73]. Differential gene expression analysis was performed using DESeq2 with a significance threshold of FDR ≤ 0.05 and absolute value of log2-transformed fold changes of at least 2.
DAVID analysis
Differentially upregulated and downregulated genes with at least a log2-transformed fold change of 2 and FDR ≤ 0.05 were individually analyzed using DAVID Functional Annotation Clustering (https://david.ncifcrf.gov/summary.jsp. Accessed 20210507). Terms from InterPro and Gene Ontology sub-ontologies cellular component (CC), biological process (BP), and molecular function (MF) were plotted by -log10(FDR) and ranked by fold enrichment.
ChIP-qPCR
GS8924 (daf-16(ar620[daf-16::zf1-wrmScarlet-3xFLAG)), a gift from Katherine Luo and Iva Greenwald (Columbia University) and control N2 embryos obtained after sodium-hypochlorite treatment were hatched overnight in M9 buffer. The L1 arrested worms were grown on NGM plates seeded with HB101 at 25°C. After 5 days, the starved worm population was collected in M9 buffer and nutated in 1% SDS solution for 30 minutes to isolate dauers. The worm pellet was washed 4x with autoclaved DI water and the worms were plated on an NGM plate with no food. The live dauers crawled out and were collected as a ~500μL packed pellet in M9 buffer.The animals were nutated for 30min at room temperature in 12mL of 2.6% formaldehyde in autoclaved DI water for live crosslinking. The crosslinking was quenched with 600μL of 2.5M glycine for 5min at room temperature. The worms were washed 3x in water before flash freezing and storing at -80°C. Frozen pellets were ground twice for 1min in the Retsch MM400 cryomill at a frequency of 30/s. The worm powder was lysed in 2mL of 1xRIPA (1x PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) with 1xHALT Protease and phosphatase inhibitor (Thermo Scientific 78443) for 10min at 4°C. The crosslinked chromatin was sonicated in the Diagenode BioruptorPico for 3 3min cycles, 30s ON/OFF at 4°C. The chromatin was diluted to a concentration of 20-30ng/uL. 10% of the volume was processed as the input sample. 10ug of chromatin was incubated with 2ug of Monoclonal Anti-Flag M2 antibody (Sigma-Aldrich F3165) overnight at 4°C and then for 2 hours with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen 11201D). After 3 800uL washes in LiCl buffer (100mM Tris HCl pH 7.5, 500mM LiCl, 1% NP40, 1% sodium deoxycholate), the samples were de-crosslinked by incubating with 80ug of Proteinase K (Thermo Scientific 25530015) in Worm Lysis buffer (100mM Tris HCl pH 7.5, 100mM NaCl, 50mM EDTA, 1% SDS) at 65°C for 4 hours. The samples were subjected to phenol-chloroform extraction and the DNA pellet was resupended in TE buffer. RNase A (Thermo Scientific 12091021) treatment was performed for 1 hour at 37°C.Quantitative PCR for promoter regions of interest was performed with Absolute Blue SYBR Green (Thermo Scientific AB4166B) on the CFX96 Real Time System Thermocyclers (Biorad) using custom primers. The cycle numbers in the ChIP samples were normalized to respective input values. The log 2 transformed fold change values in the daf-16::3xFLAG::wrmScarlet samples were normalized to the respective N2 samples. 2 biological replicates with 2 technical replicates each were done for the promoter regions of mtl-1 and col-19. Each biological replicate was analyzed separately.
ChIP-qPCR primers
mtl-1p F TGAGCACTCTAATCCTTTGCACmtl-1p R ACGTGAATGTTGCAAACACCTcol-19p F TCCATCTCTCTTGGAAACACATcol-19p R ACACCTTCAAACCTAACCAGTGTbath-45 F ATTTAATTTGTTTTCAGAAGGCAGCbath-45 R GTGCTTTCTGCATCAGAGCC
daf-5 is not required to block col-19::gfp expression during dauer.
The daf-7/TGFβ pathway regulates dauer formation in parallel to the insulin-like pathway [6,7]. daf-5 encodes a Sno/Ski protein that works in a complex with DAF-3/SMAD to regulate transcription downstream of DAF-7/TGFβ signaling [76]. daf-5(0) mutants are dauer-defective, but can be induced to enter dauer when combined with the daf-2(e1370) allele [34,35]. (A) daf-2(e1370) mutants develop slowly and acquire dauer characteristics approximately one day later than wild-type or daf-7(e1372) larvae [60,77]. Since daf-16; daf-7 dauer larvae express col-19p::gfp most penetrantly within one day of dauer entry, we used SDS-resistance to determine a time that might correspond to “early dauer” in this strain. SDS-resistance is acquired at the end of the L2d-to-dauer molt and continues throughout dauer [2]. Gravid adult hermaphrodites of the indicated strains were allowed to lay eggs for 3 hours and then removed. Embryos were incubated at 24°C for the indicated times and then incubated in 1% SDS for 10 minutes. The percent of larvae alive after this treatment is shown; data were aggregated from four independent experiments. (B) Percent of dauer larvae expressing col-19p::gfp. This expression was never observed in either control or daf-5(0) dauer larvae at times when many early dauer larvae should have been present. Data shown were aggregated from 3–4 independent experiments.(TIF)Click here for additional data file.
Dauer larvae lacking 1–2 isoforms of daf-16 display col-19p::gfp more dimly and in fewer cells than daf-16(0).
(A) Representative micrographs of dauer larvae scored in Fig 1D. In Fig 1D, any col-19p::gfp expression in the lateral hypodermis was considered “on”, however there are qualitative differences in that expression in the different strains. Dashed lines in the control indicate the boundaries of the dauer larva, as determined by DIC optics. (B) Loss of 1–2 isoforms of daf-16 results in fewer cells expressing col-19p::gfp compared to daf-16(0) dauer larvae. Quantification of the number of cells expressing col-19p::gfp along one side of the lateral hypodermis between the pharynx and rectum. Each dot represents a dauer larva. *p = 0.0460 (Two-tailed Mann-Whitney Test). (C) Loss of 1–2 isoforms of daf-16 results in dimmer expression of col-19p::gfp throughout the hypodermis compared to the daf-16(0) dauer larvae. Fluorescence levels were determined as described in S7 Fig. ****p<0.0001 (Two-tailed Mann-Whitney Test). Larvae shown in panels B-C were from an independent set of experiments from those in Fig 1D. n = 28–31; see S2 Table for complete underlying numerical data.(TIF)Click here for additional data file.
Seam cells divide and remain unfused in daf-16(0) dauer larvae.
(A) Micrographs showing apical junctions between seam cells in daf-7 (control) and daf-16(0); daf-7 (daf-16(0)) dauer larva, and seam cell divisions in daf-16(0) dauer larvae. The worms are oriented with anterior to the left and ventral down. Apical junctions were visualized by ajm-1::gfp as part of the wIs78 transgene [42,78]. Junctions were present between all seam cells in both daf-7 control and daf-16(0); daf-7 dauer larvae. Several seam cells in the daf-16(0); daf-7 dauer shown have recently divided. An example of one dividing seam cell is bracketed. The region bounded by junctions is smaller and rounder in the anterior daughter that will fuse with hyp7 (h). The posterior daughter (s) will remain a seam cell. Seam cells that were not dividing are indicated with an arrow. These photos were taken soon after dauer formation (“early dauers”). (B) Percent of dauer larvae with one or more seam cells actively dividing at the time of scoring. Seam cell divisions were identified based on ajm-1::gfp expression. Cell divisions were only seen in daf-16(0) dauer larvae.(TIF)Click here for additional data file.
daf-16(RNAi) dauer larvae express col-19p::gfp more strongly than lin-41(RNAi) dauer larvae.
Larvae assessed for col-19p::gfp expression in Fig 2 were analyzed for fluorescence intensity using ImageJ. GFP-positive nuclei were outlined using the freehand tool and the mean pixel intensity for all of such nuclei were averaged together for each individual worm. These averages are underestimates for the expression of col-19p::gfp in daf-16(RNAi) dauer larvae because many nuclei had fully saturated pixels. ****p<0.0001 (Two-tailed Mann-Whitney Test). (n = 30).(TIF)Click here for additional data file.
RNAi of lin-41 and hbl-1 induces col-19p::gfp expression in non-hypodermal tissues.
Numbers indicate larvae expressing col-19p::gfp in at least one cell in the relevant tissue over the total number of dauer larvae scored. Dauer larvae are oriented with anterior to the left and ventral down. (Top) lin-41 RNAi induces col-19p::gfp expression in vulva precursor cells (VPCs) during dauer at high penetrance. The larva shown expressed col-19p::gfp in P5.p and P7.p, but overall which VPCs expressed col-19p::gfp varied from worm to worm and did not correlate with the predicted cell fate they will adopt. The exposure time in the fluorescence channel was 200ms. (Bottom) hbl-1 RNAi induces col-19p::gfp expression in occasional ventral neurons during dauer at lower penetrance. As col-19p::gfp includes a nuclear localization sequence, expression is typically restricted to the nucleus. However, in the larva shown a neuronal process could be seen extending posteriorly to the cell body (arrow). The exposure time in the fluorescence channel was 50ms.(TIF)Click here for additional data file.
Levels of most core heterochronic genes are essentially unaffected by daf-16 during dauer.
(A) A diagram of the network of heterochronic genes that regulates stage-specific seam cell fate during continuous development. “3 let-7s” indicates the let-7 family members, mir-48, mir-84, and mir-241. mir-48 is also downregulated by lin-42 (not depicted) [79]. All protein-coding genes except lin-41 are indicated in blue. (B) Log2 fold change of the protein-coding heterochronic genes other than lin-41, comparing daf-16(0) to control dauer larvae. Log2 fold change was calculated by DESeq2 from mRNA-seq data. Dashed lines indicate 2x fold upregulation or downregulation. False discovery rates (FDR) are indicated for each gene.(TIF)Click here for additional data file.
Fluorescence scale used to determine relative fluorescence intensity of col-19p::gfp.
Fluorescence images of col-19p::gfp in dauer larvae were taken from a strain we found to produce a wide range of expression levels, XV160, daf-7(e1372); maIs105; unk-1(xk6). These images were taken using compound microscopy and identical settings, including an exposure time of 125ms. The images were then exported as 8-bit tiffs for ImageJ analysis. We identified six representative images distributed across the range of ImageJ values (0–250). We assigned numbers (0.5–5) to these images that reflect their distribution. A value of 0.25 was used if expression was visible, but less than that in the 0.5 panel. The fluorescence scale values with ImageJ values in parenthesizes were as follows: 0.5 (22), 1 (45), 2 (104), 3 (149), 4 (200), and 5 (250). These six images were then used as a scorecard to compare to experimental images for Figs 3B, 4A, and 5B. For these experiments, a 63x objective was used to take 2–3 images along the length of the dauer larva, using identical settings for all strains being compared. Each image was then subjectively compared to the fluorescence scale and assigned a value 0–5, with 0.5 values being used if an image was between two whole-number images. The values for each worm were averaged together to create an overall score for the worm.(TIF)Click here for additional data file.
The lin-41(xe8) strain is not defective for RNAi.
Unc phenotypes produced by unc-22(RNAi) were assessed during forward locomotion and binned into categories Mild: occasional twitching that did not interrupt movement. Intermediate: occasional twitching that did interrupt movement. Severe: constant twitching but still capable of forward locomotion. Paralyzed: worms whose twitching was so severe that they were not able to move forward. unc-22 RNAi experiments were carried out in parallel to the experiments shown in Fig 3B. However, because dauer larvae did not display strong Unc phenotypes, dauer larvae were moved to new RNAi plates at 20°C and allowed to recover to the post-dauer L4 (PDL4) stage. Numbers indicate the total number of PDL4 larvae assessed.(TIF)Click here for additional data file.
The lin-29(xe37) strain displays reiterative phenotypes in adults.
(A-B) The background for all strains was daf-7(e1372); maIs105[col-19p::gfp]. (A) lin-29(xe37) mutant adults do not have adult alae. Numbers indicate the number of worms with alae defects over the total number of adults. (B) lin-29(xe37) mutant adults express very low levels of col-19p::gfp. The two images were taken with identical settings (10ms exposure). Representative images are shown (n = 37–38).(TIF)Click here for additional data file.
DAF-16 is unlikely to bind the col-19 promoter to regulate transcription.
(A) Genetic region upstream of mtl-1, a confirmed transcriptional target of DAF-16 [52,53]. DNA sequence beginning immediately 3’ to W02F12.8, the gene upstream of mtl-1 is shown. This sequence likely contains promoter elements that regulate mtl-1 expression. A canonical DAF-16-Binding Element (DBE, red) is located 76bp upstream of the mtl-1 ATG. (B) The 846bp upstream of the col-19 ATG which comprises the regulatory sequence driving col-19p::gfp expression [28]. No canonical DBEs (GTAAACA or TGTTTAC) [49] were found in this sequence. Sequences were taken from WormBase (WS280).(TIF)Click here for additional data file.
DAF-16 is not enriched at the col-19 promoter.
ChIP-qPCR experiments were performed on N2 or daf-16(ar620[daf-16::zf1-wrmScarlet-3xFLAG]) dauer larvae. Binding of DAF-16-3xFLAG was first normalized to input, and then to the average of the respective wild-type value (mean +/- SD for two technical replicates) is shown. Binding to the col-19 promoter was not observed, whereas there was substantial binding to the promoter of the known DAF-16 target mtl-1 (Barsyte et al. 2001; Li et al. 2008). The coding region of the heterochromatinized gene bath-45 was used as negative control. This figure shows the second of two biological replicates; the first replicate is shown in Fig 6A.(TIF)Click here for additional data file.
Functional annotation clustering for genes upregulated in daf-16 mutants.
DAVID analysis showing gene ontology (GO) and InterPro terms that were significantly enriched (p ≤ 0.05, Bonferroni corrected) in genes whose expression was upregulated ≥2x (FDR ≤ 0.05) in daf-16(0); daf-7 dauer larvae vs. daf-7 (control) dauer larvae. GO BP = GO term biological process; GO CC = GO term cellular compartment; GO MF = GO term molecular function, INTERPRO = InterPro protein classification.(TIF)Click here for additional data file.
Functional annotation clustering for genes downregulated in daf-16 mutants.
DAVID analysis showing gene ontology (GO) and InterPro terms that were significantly enriched (p ≤ 0.05, Bonferroni corrected) in genes whose expression was downregulated ≥2x (FDR ≤ 0.05) in daf-16(0); daf-7 dauer larvae vs. daf-7 (control) dauer larvae. GO BP = GO term biological process; GO CC = GO term cellular compartment; GO MF = GO term molecular function, INTERPRO = InterPro protein classification.(TIF)Click here for additional data file.
Transcription factors differentially expressed in daf-16(0) dauer larvae compared to control dauer larvae.
Genes encoding transcription factors were defined based on their WormBase annotation (WS279). Although annotated as transcription factors, we noticed that the WormBase list also contained genes encoding RNA-binding proteins [80,81]. We therefore subtracted genes identified as encoding RNA-binding proteins from the transcription factor list. From among these genes, we searched our mRNA-seq data to find those whose expression changed ≥2x (FDR ≤ 0.05) by DESeq2 analysis. This analysis produced 112 genes that fit our criteria. Those genes are shown here as heat maps depicting relative expression of these genes in daf-16(0); daf-7 dauer larvae or daf-7 (control) dauer larvae from mRNA-seq data. The row-normalized reads for each of two biological replicates per strain are depicted.(TIF)Click here for additional data file.
List of strains used in this study.
(DOCX)Click here for additional data file.
Underlying numerical data for S2C Fig, fluorescence levels of col-19p::gfp in daf-16 isoform mutant dauers.
(XLSX)Click here for additional data file.
Collagen expression during development.
(XLSX)Click here for additional data file.
Adult-enriched collagen expression in seam cells and hyp7.
(XLSX)Click here for additional data file.
Raw lin-41 qPCR data for Fig 3A.
(XLSX)Click here for additional data file.
Underlying numerical data for Fig 3B, fluorescence levels of col-19p::gfp in lin-41(xe8) mutant dauers.
(XLSX)Click here for additional data file.
Underlying numerical data for Fig 4A, fluorescence levels of col-19p::gfp in lin-41(RNAi); lin-29(0) dauers.
(XLSX)Click here for additional data file.
Underlying numerical data for Fig 5B, fluorescence levels of col-19p::gfp in daf-16(0); lin-29(0) dauers.
(XLSX)Click here for additional data file.
Raw ChIP-qPCR data for Fig 6A.
(XLSX)Click here for additional data file.23 Aug 2021Dear Dr Karp,Thank you very much for submitting your Research Article entitled 'daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscriptWe therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.In addition we ask that you:1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]Please let us know if you have any questions while making these revisions.Yours sincerely,Coleen T. MurphyAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsThe reviewers find the work to be interesting and based on solid experimental results, and only request a few modifications.Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: Wiric et al present novel and impactful findings about roles for the evolutionarily conserved transcription factor DAF-16/FOXO and the evolutionarily conserved RNA binding protein LIN-41/TRIM71 in maintaining multipotency during developmental arrest in C. elegans dauer larvae. Upon sensing conditions adverse for reproduction, worm second stage larvae can elect to follow an alternative developmental trajectory – the so-called ‘L2D’ followed by formation of the morphologically specialized and developmentally arrested dauer larva. Dauer larvae are non-feeding, stress resistant, and can maintain a state of developmental arrest and full developmental multipotency for months. Upon encountering favorable conditions, dauer larvae resume development and complete ‘post-dauer L3’ and ‘post-dauer L4’ stages, followed by the reproductively competent adult. The dauer larva developmental trajectory (consisting of the L2d, dauer, and post-dauer L3-L4-Adult) has been a fascinating subject of investigation for decades, and genetic and molecular studies of this pathway have revealed many fundamental genes, mechanisms, and principles underlying metabolic and environmental signaling, stress resistance, longevity, and the regulation of developmental progression. This Wiric et al manuscript reports findings that reveal fundamental novel understanding of one of the most compelling properties of dauer larvae, which is the maintenance of stem cell multipotency during extended developmental arrest. The management of stem cell developmental potential during periods of quiescence is a fundamental property of all multicellular systems and is also a phenomenon that is poorly understood. This manuscript represents a major advance in the field, by identifying a gene regulatory pathway in which DAF-16/FOXO functions to maintain expression of the RNA binding protein LIN-41/TRIM71 in dauer larvae, and LIN-41 functions to prevent the inappropriate expression of adult fates during developmental arrest. The authors discovered that daf-16 loss-of-function (lf) dauer larvae dramatically up regulate numerous genes that are ordinarily adult-specific, including whole sets of adult-specific collagens. This finding places daf-16, for the first time, within the heterochronic pathway, which is a gene regulatory network (previously known to include lin-41) that controls the timing of diverse stage-specific cell fate progression events during larval development. Interestingly, the role for daf-16 in the heterochronic pathway is restricted to the dauer life history trajectory; daf-16(lf) has no detectable effect on adult cell fate timing during continuous (non-dauer) development. The author’s epistasis data showing the daf-16 functions upstream of lin-41, which functions in both continuous development and dauer development to prevent precocious expression of adult fates. However, Wiric et al show that lin-41 prevents adult gene expression in dauer larvae independently of the transcription factor, LIN-29, which is essential for adult-specific gene expression during non-dauer development. The author’s transcriptional profiling of daf-16(lf) dauer larvae reveals that daf-16 controls the expression of thousands of genes, in addition to adult-specific collagens, including many transcription factors that could substitute for lin-29 dauer-specifically. These Wiric et al findings, by identifying a daf-16-lin-41 axis for maintaining multipotency in dauer larvae, significantly expand our understanding of the rewiring of developmental gene regulatory networks that occurs in association with development arrest in this system. I particular the authors show that lin-41 represents a major node of this rewiring, wherein daf-16 functions dauer-specifically to promote lin-41 activity (and to thereby maintain larval developmental potency) and lin-29 functions downstream of lin-41 specifically during non-dauer development. The evolutionary conservation of DAF-16/FOXO and LIN-41/TRIM71, and the apparent conservation of their functions in stem cell fate and developmental progression, underscores the impact of these Wiric et al findings to the broader understanding of developmental and tissue homeostatic mechanisms in animals.I did not note any major issues with the manuscript. I think that it is suitable for publication in PloS Genetics in its present form.I have just one minor critique: The pathway model shown in Figure 2A shows a positive role for lin-14 in promoting lin-28 activity and shows the let-7family ‘sister’ microRNAs as regulating only hbl-1. However, an alternative depiction of the network would place the let-7family microRNAs downstream of lin-14 (which appears to regulate their transcription (Tsialikas et al (2017) Genetics 205: 251-262)), and upstream of both lin-28 and hbl-1.Reviewer #2: The investigation of interactions between dauer regulatory and heterochronic pathways in C. elegans has revealed important insights into general mechanisms through which animals maintain developmental plasticity in response to environmental stress. In this manuscript the authors elucidate a new function for the FoxO transcription factor DAF-16 in the maintenance of epidermal stem cell fate and quiescence during dauer diapause. Building on prior work showing that DAF-16 is required for the re-establishment of multipotency in the vulval precursor cells during dauer arrest, the authors use a col-19p::GFP reporter, a marker of adult epidermal seam cell fate, to show that dauers with reduced daf-16 activity exhibit precocious col-19p::GFP expression. Using genetic and transcriptomic approaches, they demonstrate that daf-16 inhibits the expression of col-19p::GFP through the canonical heterochronic gene lin-41. While lin-41 is also required for col-19p::GFP repression in reproductively developing larvae, this work reveals that lin-41 acts through a distinct mechanism to inhibit col-19p::GFP expression in dauers, doing so in a manner that is independent of the downstream heterochronic gene lin-29.This is a rigorously executed and convincing study that establishes DAF-16 as a dauer-specific heterochronic gene, uncovers a new role for DAF-16 in the execution stage of dauer morphogenesis, and reveals another example of the plasticity of developmental pathways in the context of environmental stress. This work will be of general interest to investigators interested in the molecular underpinnings of developmental plasticity.There are several points that should be addressed in a revised manuscript:1. Please include line numbers.2. Introduction, second paragraph, second-to-last line: delete the Pierce et al. reference.3. Throughout the manuscript, "DAF-16/FOXO" should be used to improve clarity for readers not familiar with C. elegans.4. Introduction, second paragraph, last line: the two references listed address the regulation of DAF-16 subcellular localization, not target genes. I would consider citing a dauer review (e.g., Fielenbach and Antebi).5. Results, first paragraph line 12 and second paragraph lines 3-4: Stating that daf-16 and daf-5 mutant larvae are "dauer-defective" could be confusing to non-mavens. I would consider being more specific to enhance clarity, e.g., "As larvae with reduced daf-16 activity bypass dauer arrest in the context of reduced DAF-2 insulin signaling,..." and an analogous sentence for daf-5.6. Figures 1D and S2: Since the col-19p::GFP expression phenotypes of daf-16(0) and daf-16a/f mutants do not differ in terms of penetrance (1D) but do appear to differ in terms of GFP expression levels per cell and number of cells/animal, both expression levels and number of GFP+ cells in these two mutant backgrounds should be quantified.7. Paragraph entitled "daf-16 promotes expression of lin-41 during dauer," lines 10-11: Similar to 6., GFP expression in lin-41(RNAi) and daf-16(RNAi) should be quantified.8. Figure 1E: what do "1" and "2" denote?9. Figure 2, legend: consider changing "sisters" to "family members."10. Figure 2B: it would be nice to include a daf-16 RNAi sample in this experiment so that the relative effects of daf-16 RNAi and lin-41 RNAi on col-19p::GFP expression could be visualized (differences in RNAi efficiency notwithstanding).11. Figure S1, legend, line 4: "da Graca et al."12. Figure S7: typo: "paralyzed"13. Figure S8B: I don't think the 250ms exposure adds anything.14. Table 1: allele names for the daf-16a mutants are "tm5030" and "tm5032."Reviewer #3: Comments on PGENETICS-D-21-00989Wirick and colleagues describe that daf-7(e1372); daf-16(null) dauers misexpress adult-specific collagen col-19 and RNA-binding protein lin-41 is required for this. Using RNA-sequencing comparing daf-7(e1372); daf-16(null) vs daf-7(e1372) dauers, they found an upregulation of about 20 collagens normally expressed in adulthood and a downregulation of about 20 collagens normally expressed during dauers. From this they conclude a loss of multipotency of the epidermal stem cells (seam cells) in these daf-7(e1372); daf-16(null) dauers potentially explaining this misexpression of adult-specific collagens.Overall, the study is well designed and experiments were done with the highest standards. In general, I like the study and have only a few questions and minor issues that could be addressed.I have several questions of things that were unclear to me and should be clairified:1. Are these adult-specific collagens expressed in seam cells or hypodermis? If not in seam cells, how does this relate to loss of multipotency?2. Is col-19 also misexpressed in daf-16(null) dauers induced by starvation? Or is this specific to the tgf beta pathway?3.Minor issues:1. Manuscript could be more concise and less repetitive across sections (intro, results, discussion)2. Compared to PMID: 9649524, how do the findings add conceptional novel insights? Also other genes like lin-42, lin-28, mir-41 etc that are upstream of lin-29 and regulate Pcol-19::GFP were not discussed or investigated.3. The transcription factor lin-29 is not required. The authors mention 112 transcription factors from their RNA seq and suggest that they in the absense of daf-16 regulate misexpression of adult collagens or loss of mulitpotency. This could be easily tested by a small RNAi screen using Pcol-19::GFP as a read out. I am not saying they need to do this, but it would be nice to get some insight of a potential mechanism here.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: Patrick HuReviewer #3: No8 Oct 2021Submitted filename: Response to Reviewers.docxClick here for additional data file.15 Oct 2021Dear Dr Karp,We are pleased to inform you that your manuscript entitled "daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71" has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Coleen T. MurphyAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):The reviewers are in agreement that the authors have addressed all of their critiques.Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: The revised manuscript admirably addresses all the reviewer critiques; publication of the paper in its current form in PLOS Genetics is recommended.Reviewer #2: The authors have adequately addressed my critique of the original submission.Reviewer #3: The authors have addressed all my previous comments.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: Patrick HuReviewer #3: No----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00989R1More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.4 Nov 2021PGENETICS-D-21-00989R1daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71Dear Dr Karp,We are pleased to inform you that your manuscript entitled "daf-16/FOXO blocks adult cell fate in Caenorhabditis elegans dauer larvae via lin-41/TRIM71" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Zita BartaPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: Zuzana Tothova; Ramya Kollipara; Brian J Huntly; Benjamin H Lee; Diego H Castrillon; Dana E Cullen; Elizabeth P McDowell; Suzan Lazo-Kallanian; Ifor R Williams; Christopher Sears; Scott A Armstrong; Emmanuelle Passegué; Ronald A DePinho; D Gary Gilliland Journal: Cell Date: 2007-01-26 Impact factor: 41.582