Literature DB >> 34778004

Is there any relationship between serum zinc levels and angiotensin-converting enzyme 2 gene expression in patients with coronavirus disease 2019?

Zahra Bagheri-Hosseinabadi1,2, Ali Pirsadeghi3, Amir Rahnama4, Fatemeh Bahrehmand2, Mitra Abbasifard1,5.   

Abstract

BACKGROUND: The level of angiotensin-converting enzyme 2 (ACE2) expression in different tissues is essential in the sensitivity, symptoms and consequences of COVID-19 infection. It seems that zinc is involved in the structure of the ACE2 enzyme has been identified; nonetheless, the relationship between ACE2 expression and zinc serum levels in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-infected patients is still unclear. This study aimed to evaluate the expression of ACE2 in peripheral blood-derived immune cells of COVID-19 patients and its relationship with serum zinc levels.
METHODS: Thirty healthy subjects and thirty patients with COVID-19 were enrolled in this study. The COVID-19 infection was confirmed by positive real-time polymerase chain reaction (RT-PCR) and radiological data. Peripheral blood samples were taken from healthy subjects and COVID-19 patients. Whole blood samples were also used to measure ACE2 gene expression by RT-PCR technique. The correlation matrix evaluated the relationship between ACE2 expression, serum zinc levels, and other related variables.
RESULTS: The outcomes showed no considerable alteration in serum zinc levels between patients and the control group. Likewise, the ACE2 gene expression results showed a significant decrease in this receptor's expression in COVID-19 patients compared with the healthy subjects. A significant positive correlation was observed between serum zinc level and ACE2 gene expression in patients with COVID-19.
CONCLUSION: The immune system seems to reduce the mRNA expression of the ACE2 in the peripheral blood leukocytes following SARS-CoV-2 infection. Moreover, zinc deficiency can make patients more susceptible to SARS-CoV-2 infection.
© 2021 Elsevier B.V. All rights reserved.

Entities:  

Keywords:  ACE2; COVID-19; Zinc

Year:  2021        PMID: 34778004      PMCID: PMC8572017          DOI: 10.1016/j.mgene.2021.100991

Source DB:  PubMed          Journal:  Meta Gene        ISSN: 2214-5400


Introduction

Coronaviruses (CoV) are considered a large family of viruses responsible for various disorders, from the common cold to the more severe respiratory disorders and even death (Perlman, 2020). The new coronavirus, SARS-CoV-2, is emerging not previously reported in humans (Novel, 2020). The virus is transmitted between people through droplets or direct contact, and the average incubation period is reported as 6.4 days (Lai et al., 2020). During a preliminary period in an infected patient, the virus is replicated in the upper respiratory tract. After this period, the lower respiratory tract cells' infection leads to infiltration of immune cells, the formation of an inflammatory milieu and lesions, as well as lung tissue injury (Abbasifard and Khorramdelazad, 2020). Evidence showed that the main symptoms of COVID-19 patients are fever, sore throat, dry cough, runny nose, headaches, body aches, fatigue, diarrhea and vomiting, as well as discoloration of fingers or toes and skin rash (Khorramdelazad et al., 2020). It has been reported that severe symptoms including pneumonia and shortness of breath were observed in 14% of patients; however, only in 5% of patients, the condition was severe, which is associated with acute respiratory distress syndrome (ARDS), infectious shock, multi-organ failure, and even death (Zaim et al., 2020). The ACE2 gene encodes the ACE2, an enzyme located on the outer surface of epithelial cells in the lungs, blood vessels, heart, kidneys, and intestines (Hamming et al., 2004; Donoghue et al., 2000). ACE2 is a receptor for the SARS-CoV-2 to enter the target cells (Devaux et al., 2020). The spike (S) surface glycoprotein of SARS-CoV-2 can bind to the ACE2 receptor, allowing the virus to enter the target cells, particularly epithelial type1 and 2 in the respiratory tract tissue (Xu et al., 2020). Therefore, this receptor plays a crucial role in tissue infection susceptibility, clinical symptoms, and consequence of SARS-CoV-2 infection (Cao et al., 2020). Previous studies reported a positive and significant association between ACE2 expression and SARS-CoV-2 infection in vitro (Hofmann et al., 2004; Li et al., 2007). Moreover, the ACE2 enzyme, as a metalloprotein, can chelate and retain zinc due to its reduced zinc levels favor the interaction of the angiotensin-converting motif (Vickers et al., 2002). Zinc is considered one of the essential trace elements in the human body. Since there is no zinc storage system in the body, zinc's daily consumption is essential to maintain a stable body condition (Tapiero and Tew, 2003). Studies have shown that zinc is essential for the optimum of several enzyme activities, cellular processes, including growth, DNA synthesis, and RNA transcription (Prasad, 1979). Fluctuations in the intracellular concentration of zinc are essential to inhibit virus transcription (Read et al., 2019). In this context, studies have shown that the binding and elongation pattern of RNA-dependent RNA polymerase (RdRP, RDR) or RNA replicase in SARS is inhibited by zinc (Te Velthuis et al., 2010). In vitro studies also showed that high concentrations of zinc and the addition of complexes that induce zinc entry into the cell could inhibit the proliferation of RNA-positive viruses (Te Velthuis et al., 2010). Protease activity was also inhibited by zinc in rhinovirus and poliovirus (Baum et al., 1991; Cordingley et al., 1989). Further details on the effect of zinc on SARS-CoV-2 infection are currently mysterious. Based on the latest studies, zinc's role in the ACE2 structure has been identified; nonetheless, the relationship between ACE2 expression and serum zinc level in COVID-19 patients is still unclear. Therefore, this study aimed to measure the serum level of zinc and gene expression of ACE2 in peripheral blood-derived immune cells of COVID-19 patients compared to healthy subjects, as well as the association between gene expression of ACE2 with zinc levels and other related variables.

Materials and methods

Subjects

In this investigation, thirty patients with COVID-19 and thirty healthy age and sex-matched subjects were enrolled. Inclusion criteria for COVID-19 patients were hospitalization in Ali Ibn Abitaleb Hospital (Rafsanjan, Iran), positive RT-PCR test and radiological data, and inflammation signs. Subjects with other viruses' infection, respiratory system-related disorders, immune-based diseases such as autoimmunity, allergies, cancer, and immunocompromised patients were excluded from the study. The subjects' demographic and clinical data, including age, sex, hospitalization duration, type of medication before and during the infection, disease outcome (discharge, death), underlying diseases, duration symptom onset, the severity of patients' symptoms (CT scan result, chest x-ray data), and vital signs of patients, were recorded. Additionally, laboratory parameters such as leukocyte count, C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), platelet (PLT) count were also collected. Informed consent has been received from each patient and control group based on the Declaration of Helsinki (DoH). Furthermore, this study has been approved by the Ethics Committee of Rafsanjan University of Medical Sciences, Rafsanjan, Iran (IR.RUMS.REC.1399.025).

Blood analysis

Blood samples were collected from both patients and healthy subjects and divided into two fractions for serum separation, cell blood count, and RNA extraction. After collection, the sample was transferred to the laboratory, and isolated serums were kept at −20 °C until further experiments. The blood indexes, CRP, and ESR levels were measured using appropriate methods and laboratory instruments. In addition, serum zinc level was measured with a Hitachi 912 biochemistry autoanalyzer (Roche, Germany), and absorption was measured at 530–570 nm based on a calorimetric method.

Gene expression assay

Total RNA was extracted from fresh blood samples using an RNA extraction kit (Karmania pars gene, Iran). Extracted RNAs were evaluated for purity and integrity by spectrophotometry (260/280 nm) and agarose gel electrophoresis. Next, cDNAs were synthesized using a cDNA synthesis kit (Karmania pars gene, Iran) with a 15 μL cDNA master mix and a 5 μL RNA template (1 ng to 5 μg). The cDNA synthesize procedure was performed regarding the one-step protocol suggested by the mentioned manufacturer: 42–50 °C for 30 min, followed by 90 °C for 5 min for reverse transcriptase (RT) enzyme inactivation, and finally, the microtubes were cooled on the ice for 2 min, and 1/5 ratio (1 for cDNA and 5 for total volume) for PCR amplification was used for next step. Also, specific forward and reverse primers (concentration of the primers: 0.5 μM), 2× qPCRBIO SYGreen Mix Hi-ROX (PCRBiosystem, England), and nuclease-free water were prepared for RT-PCR and amplification using a Rotor-Gene Q 2plex System (Qiagen) regarding the recommended program: 1 cycle of 95 °C for 2 min; 40 cycles of 95 °C for 5 s, and 60–65 °C (annealing) for 20 to 30 s. Additionally, the melting curve step was used later by 10 s at 95 °C and then 10 s each at 0.2 °C enhancements between 62 and 95 °C. The designed sequence primers of the studied genes are shown in Table 1 . The RT-PCR was completed in triplicate, and U6 was employed as the reference gene to standardize the acquired signals. Furthermore, the relative expression of the amplified products was correspondingly calculated by the 2-ΔΔCt formula.
Table 1

The sequences of primers used in the study.

GeneForwardReverse
U6CACCATTGGCAATGAGCGGTTCAGGTCTTTGCGGATGTCCACGT
ACE2TCCATTGGTCTTCTGTCACCCGAGACCATCCACCTCCACTTCTC

ACE2; Angiotensin-converting enzyme 2 (ACE2).

The sequences of primers used in the study. ACE2; Angiotensin-converting enzyme 2 (ACE2).

Statistical analyses

GraphPad Prism 8 (GraphPad Software, San Diego, CA) was employed to perform statistical analysis. The one-sample Kolmogorov–Smirnov (KS) and Shapiro–Wilk tests were used for the variable's normality evaluation. Differences between the groups in the study were also assessed using independent sample t-test, Mann–Whitney U, and Chi-square statistic tests. Furthermore, the correlation matrix test was used to estimate the association between targeted variables. All data are presented as mean ± SEM. A p-value<0.05 was considered statistically significant.

Results

Thirty patients with COVID-19, including 17 women and 13 men with a mean age of 60 ± 3.39 years and thirty healthy individuals, including 19 women and 11 men with a mean age of 57 ± 1.98 years, enrolled in the study. The statistical analysis results showed no significant difference between the patient and control groups regarding age and sex (P > 0.05). The demographic and clinical data of the study groups are shown in Table 2 . The results showed that in the patient group, the expression of the ACE2 gene had a significant decrease compared to the control group (P < 0.0001) (Fig. 1 ). Furthermore, serum zinc levels were not significantly different in patients and controls (P = 0.06) (Fig. 2 ). Statistical analysis and correlation matrix test also showed a positive and significant correlation between serum zinc level and ACE2 gene expression (r = 0.44, p = 0.02). Also, a significant negative correlation was observed between the number of neutrophils and lymphocytes, which shows that in patients with COVID-19, the severity of the disease increases, and the progression of the infection increases active neutrophils and decreases lymphocytes (r = −0.66, p < 0.0001) (Fig. 3 ).
Table 2

Clinical and laboratory data of studied patients with COVID-19.

COVID-19 patient (n = 30)WBC/(μL)PLT/(μL)Neutrophil count /(μL)Lymphocyte count /(μL)CRP (mg/mL)O2 (mm Hg)Fever (C°)Zinc (mg/mL)Medication usedAge (Years)Duration of hospitalization (Days)
13900176653355803855Hydroxychloroquine sulfate, interferon beta, Tamiflu-oseltamivir, methylprednisolone9115
25900166691998438.949Hydroxychloroquine sulfate, interferon beta, Tamiflu-oseltamivir, methylprednisolone6531
365002297134508638.545Lopinavir & ritonavir (Kaletra ®)619
4730034277208943878Hydroxychloroquine sulfate656
5700021165336933745Hydroxychloroquine sulfate388
641001656037539237.562Lopinavir & ritonavir (Kaletra ®), Tamiflu-oseltamivir, hydroxychloroquine sulfate7911
741001525239329636.640Lopinavir & ritonavir (Kaletra ®), Tamiflu-oseltamivir, hydroxychloroquine sulfate706
85300140722130923761Interferon beta, hydroxychloroquine sulfate, methylprednisolone508
93800342465055953745Hydroxychloroquine sulfate563
10`45001576325109337.247Hydroxychloroquine sulfate605
11450022170286983740Hydroxychloroquine sulfate883
1223002106131509736.452Interferon beta, hydroxychloroquine sulfate, methylprednisolone588
135100205652924893880Hydroxychloroquine sulfate, methylprednisolone563
142300195673168537.239Interferon beta, hydroxychloroquine sulfate, methylprednisolone7015
15540095751916923784interferon beta, lopinavir & ritonavir (Kaletra ®), selenium, methylprednisolone, dexamethasone5626
164200215703035953868Interferon beta, selenium, methylprednisolone6115
173100242643088736.240Lopinavir & ritonavir (Kaletra ®)636
185000181554098837.562Lopinavir & ritonavir (Kaletra ®), Tamiflu-oseltamivir, hydroxychloroquine sulfate636
197300225792024903768Interferon beta, hydroxychloroquine sulfate, methylprednisolone598
208300190702525903835Hydroxychloroquine sulfate525
211380259871116894095Tamiflu-oseltamivir, hydroxychloroquine sulfate, lopinavir & ritonavir (Kaletra ®)657
22190067782220943771Interferon beta, methylprednisolone8811
2311802886525127923764Interferon beta, dexamethasone774
2446002207525158038.955Interferon beta708
2561001508513429537.570Dexamethasone, interferon beta617
2670001748612219237.968Interferon beta, methylprednisolone678
2735001837030147537.254Interferon beta, dexamethasone969
285300215603751993721Interferon beta, methylprednisolone459
2966002227916208737.557Interferon beta, hydroxychloroquine sulfate, methylprednisolone7515
305300105821620663766Interferon beta, lopinavir & ritonavir (Kaletra ®), hydroxychloroquine sulfate, dexamethasone7311
All (mean ± SEM)4768 ± 347.8198.1 ± 11.269.43 ± 1.826.70 ± 1.6728.57 ± 4.5389.5 ± 1.337.5 ± 0.1457.2 ± 2.9765.93 ± 2.449.533 ± 1.14
Fig. 1

Relative expression of ACE2 in control group and patient with COVID-19. All the tests were performed in triplicate. Data are presented as mean ± SEM, * significant (P ˂ 0.05).

Fig. 2

The differences between serum levels of zinc in healthy subjects (control) and patients with COVID-19. Data are presented as mean ± SEM; A p-value<0.05 was considered statistically significant.

Fig. 3

The correlations between the expression of ACE2, zinc serum level, and other related variables in patients with COVID-19. The confidence interval of r is shown in the right rectangle (between −1 and 1). * Significant (P ˂ 0.05).

Clinical and laboratory data of studied patients with COVID-19. Relative expression of ACE2 in control group and patient with COVID-19. All the tests were performed in triplicate. Data are presented as mean ± SEM, * significant (P ˂ 0.05). The differences between serum levels of zinc in healthy subjects (control) and patients with COVID-19. Data are presented as mean ± SEM; A p-value<0.05 was considered statistically significant. The correlations between the expression of ACE2, zinc serum level, and other related variables in patients with COVID-19. The confidence interval of r is shown in the right rectangle (between −1 and 1). * Significant (P ˂ 0.05).

Discussion

This study investigated the expression of the ACE2 gene and its relationship with serum zinc levels. The results of this study showed that there was no significant difference in serum zinc levels between patients with COVID-19 and healthy individuals. However, ACE2 gene expression was significantly reduced in the patient group compared to the control. The correlation results showed a positive and significant relationship between serum zinc levels and ACE2 gene expression. Recent studies reported that SARS-CoV-2 might infect ACE2+ dendritic cells (DCs), macrophages, and monocytes. However, infection of these immune system cells can also occur in an ACE2-independent pathway through ligation with CD147 and CD209/CD209L (Abbasifard and Khorramdelazad, 2020; Jafarzadeh et al., 2020). Furthermore, SARS-CoV-2 can directly infect B cells and T cells, impairing their specific function in immune responses. This could elucidate the effect of SARS-CoV-2 infection on lymphoid tissues such as lymph nodes and the spleen (Feng et al., 2020). Following the infection of macrophages, DCs, and monocytes, the viruses can repress interferon-mediated antiviral responses by these cells. Infected monocytes can also infect resident macrophages after migrating to various tissues in the body, such as the lungs, spreading the viruses along with infection progression. However, there are still several controversies about whether ACE2 restrains or activates the immune system. Additionally, pro-inflammatory mediators could be produced by infected macrophages and monocytes, resulting in local and systemic inflammation and cytokine storm, which play a pivotal role in expanding COVID-19-associated disorders, such as ARDS in infected patients with infected patients SARS-CoV-2 (Jafarzadeh et al., 2020). Evidence proposes that ACE2 is regulated by several pathways (Gallagher et al., 2008; Clarke et al., 2014). In line with this study's results, it has been shown that ACE2 is significantly down-regulated in COVID-19 (Du et al., 2020). Although few studies have been done in this area, there is evidence that zinc can affect virus-induced alterations in B and T cells (Wessels et al., 2020). It has also been argued that zinc can reduce ACE2 expression (Skalny et al., 2020). This study showed that despite the lack of significant differences between the patient and control groups in the serum level of zinc, the amount of this trace element in both groups was less than normal, and both groups were zinc deficient. Due to this zinc deficiency, reduced ACE2 expression in patients with COVID-19 may have other unknown mechanisms. Consistent with our data, another study also reported that a large number of patients with COVID-19 had zinc deficiency, developing more complications, and the deficiency was associated with an extended hospital stay and enlarged mortality rates (Jothimani et al., 2020). An experimental investigation reported that zinc with a concentration of 100 μM could decrease recombinant human ACE2 activity in rat lungs (Speth et al., 2014). However, the modulation of SARS-CoV-2 infection by administration of high doses of zinc is still hypothetical and needs further study (Chilvers et al., 2001). Interestingly, zinc as an immune regulator can participate in both the inflammatory and anti-inflammatory responses in viral infections. Studies have shown that zinc can increase IFN-α production on the one hand and reduce the pathological inflammation leading to cytokine storm by inhibiting the nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling pathway. Zinc can also activate regulatory T cells (Tregs), supporting the homeostasis process (Zhang et al., 2020). However, the association between zinc levels and ACE2 gene expression in patients' peripheral blood cells with COVID-19 has not yet been determined. In contrast with this study's findings, a flow cytometric investigation demonstrated slight to no ACE2 expression by peripheral blood-derived immune cells and platelets while alveolar macrophages can significantly express ACE2 (Song et al., 2020). Furthermore, in vitro investigations have revealed that decreased zinc levels support the interaction of ACE2 with SARS-CoV-2S protein and elevated zinc levels hinder ACE2 expression, reducing viral interaction, while the statistical analysis in this study showed that there was a positive and significant association between serum level of zinc and ACE2 expression by peripheral blood-derived immune cells in patients with COVID-19 (Devaux et al., 2020; Li et al., 2020). These discrepancies in outcomes may be due to patients' conditions, treatment protocol, and other unknowns. The finding of an investigation demonstrated that zinc supplementation increased the suppressive impacts of emetine and triclabendazole on the expression of ACE2 in Calu-3 and H322M cells (lung cancer cell lines) (Lee et al., 2021). These findings indicated that the ACE2 expression could be modulated by the reactive oxygen species (ROS) and NF-κB signaling in human lung cells, and the combination of triclabendazole or emetine with zinc may have acceptable clinical outcomes for the treatment of patients with COVID-19 by regulating of ACE2 expression (Lee et al., 2021). Regarding the findings of our study conducted on leukocytes of patients with COVID-19, there was a positive and significant association between serum levels of zinc and the expression of ACE2. In this context, studies showed that targeted cell subsets by COVID-19 in host tissues and the regulators of ACE2 expression remain unidentified. It has been revealed that ACE2 might regulate immune response through activation of immunological signaling pathways such as the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) in the SARS-Cov-2 infection, resulting in the activation of helper T cells 1 (Th1 cells), B cells, macrophages and the inhibition of CD8+ T cells and Foxp3+ Tregs (Luo et al., 2021). Therefore, in patients under study, factors other than zinc may have played a role in increasing ACE2 expression, as ACE2 expression has been shown to increase significantly 72 h after SARS-CoV-2 infection, which can occur in both zinc-deficient patients and patients with sufficient zinc levels (Luo et al., 2021). Regrettably, due to the invasiveness of the biopsy method from the damaged lung tissue and the dissatisfaction of patients and their families, the measurement of ACE2 tissue expression was limited. Collectively, this study's results showed that zinc plays an essential role in modulating immune responses in people with COVID-19 and can also play a protective role against viral infections such as SARS-CoV-2 because serum levels in most studied patients are lower than normal. This zinc deficiency can make patients more susceptible to the infection. On the other hand, gene expression of ACE2 was reduced, although this decrease in mRNA expression was detected in peripheral blood cells and required further studies on the ACE2 protein level in various tissues such as the lung epithelium.

Credit author statement

Zahra Bagheri-Hosseinabadi: data collection, writing original draft preparation, Mitra Abbasifard: writing, reviewing and editing, supervision, Ali Pirsadeghi: data analysis and molecular tests, Fatemeh Bahrehmand: sample collection, laboratory and molecular tests, Amir Rahnama; data collection and troubleshooting.

Declaration of Competing Interest

None.
  32 in total

1.  The effects of coronavirus on human nasal ciliated respiratory epithelium.

Authors:  M A Chilvers; M McKean; A Rutman; B S Myint; M Silverman; C O'Callaghan
Journal:  Eur Respir J       Date:  2001-12       Impact factor: 16.671

2.  A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9.

Authors:  M Donoghue; F Hsieh; E Baronas; K Godbout; M Gosselin; N Stagliano; M Donovan; B Woolf; K Robison; R Jeyaseelan; R E Breitbart; S Acton
Journal:  Circ Res       Date:  2000-09-01       Impact factor: 17.367

Review 3.  Trace elements in human physiology and pathology: zinc and metallothioneins.

Authors:  Haim Tapiero; Kenneth D Tew
Journal:  Biomed Pharmacother       Date:  2003-11       Impact factor: 6.529

4.  Regulation of ACE2 in cardiac myocytes and fibroblasts.

Authors:  Patricia E Gallagher; Carlos M Ferrario; E Ann Tallant
Journal:  Am J Physiol Heart Circ Physiol       Date:  2008-10-10       Impact factor: 4.733

Review 5.  COVID-19 and Multiorgan Response.

Authors:  Sevim Zaim; Jun Heng Chong; Vissagan Sankaranarayanan; Amer Harky
Journal:  Curr Probl Cardiol       Date:  2020-04-28       Impact factor: 5.200

6.  Zinc supplementation augments the suppressive effects of repurposed NF-κB inhibitors on ACE2 expression in human lung cell lines.

Authors:  Ming-Cheng Lee; Yin-Kai Chen; Jyy-Jih Tsai-Wu; Yih-Jen Hsu; Bor-Ru Lin
Journal:  Life Sci       Date:  2021-06-23       Impact factor: 6.780

Review 7.  The Potential Impact of Zinc Supplementation on COVID-19 Pathogenesis.

Authors:  Inga Wessels; Benjamin Rolles; Lothar Rink
Journal:  Front Immunol       Date:  2020-07-10       Impact factor: 7.561

8.  Another Decade, Another Coronavirus.

Authors:  Stanley Perlman
Journal:  N Engl J Med       Date:  2020-01-24       Impact factor: 91.245

9.  Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and coronavirus disease-2019 (COVID-19): The epidemic and the challenges.

Authors:  Chih-Cheng Lai; Tzu-Ping Shih; Wen-Chien Ko; Hung-Jen Tang; Po-Ren Hsueh
Journal:  Int J Antimicrob Agents       Date:  2020-02-17       Impact factor: 5.283

10.  Susceptibility to SARS coronavirus S protein-driven infection correlates with expression of angiotensin converting enzyme 2 and infection can be blocked by soluble receptor.

Authors:  Heike Hofmann; Martina Geier; Andrea Marzi; Mandy Krumbiegel; Matthias Peipp; Georg H Fey; Thomas Gramberg; Stefan Pöhlmann
Journal:  Biochem Biophys Res Commun       Date:  2004-07-09       Impact factor: 3.575

View more
  3 in total

1.  The prognostic value of S100A calcium binding protein family members in predicting severe forms of COVID-19.

Authors:  Zahra Bagheri-Hosseinabadi; Mohadese Abbasi; Mahmood Kahnooji; Zainab Ghorbani; Mitra Abbasifard
Journal:  Inflamm Res       Date:  2022-02-26       Impact factor: 4.575

Review 2.  Effects of nutrients on immunomodulation in patients with severe COVID-19: Current knowledge.

Authors:  Bruna Teixeira da Costa; Glauber Rocha Lima Araújo; Ronaldo Teixeira da Silva Júnior; Luana Kauany de Sá Santos; Vinícius Lima de Souza Gonçalves; Daniel Bastos Alves Lima; Beatriz Rocha Cuzzuol; Jonathan Santos Apolonio; Lorena Sousa de Carvalho; Hanna Santos Marques; Camilo Santana Silva; Isadora de Souza Barcelos; Márcio Vasconcelos Oliveira; Fabrício Freire de Melo
Journal:  World J Crit Care Med       Date:  2022-07-09

Review 3.  Gustatory and Saliva Secretory Dysfunctions in COVID-19 Patients with Zinc Deficiency.

Authors:  Hironori Tsuchiya
Journal:  Life (Basel)       Date:  2022-02-28
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.