Molecular characterization of Salmonella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the federal District and State of Goiás, Brazil.

Listeria monocytogenes and Salmonella spp. are considered important foodborne pathogens that are commonly associated with foods of animal origin. The aim of this study was to perform molecular characterization of L. monocytogenes and Salmonella spp. isolated from biofilms of cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil. Fourteen L. monocytogenes isolates and one Salmonella sp. were detected in poultry slaughterhouses. No isolates were detected in cattle slaughterhouses. All L. monocytogenes isolates belonged to lineage II, and 11 different pulsotypes were detected. Pulsed-field gel electrophoresis analysis revealed the dissemination of two strains within one plant, in addition to the regional dissemination of one of them. The Salmonella isolate was identified via whole genome sequencing as Salmonella enterica serovar Minnesota ST548. In the sequence analysis, no premature stop codons were detected in the inlA gene of Listeria. All isolates demonstrated the ability to adhere to Caco-2 cells, while 50% were capable of invading them. Antimicrobial resistance was detected in 57.1% of the L. monocytogenes isolates, and resistance to sulfonamide was the most common feature. The tetC, ermB, and tetM genes were detected, and four isolates were classified as multidrug-resistant. Salmonella sp. was resistant to nine antimicrobials and was classified as multidrug-resistant. Resistance genes qnrB19, blaCMY-2, aac(6')-Iaa, sul2, and tetA, and a mutation in the parC gene were detected. The majority (78.5%) of the L. monocytogenes isolates were capable of forming biofilms after incubation at 37°C for 24 h, and 64.3% were capable of forming biofilms after incubation at 12°C for 168 h. There was no statistical difference in the biofilm-forming capacity under the different evaluated conditions. Salmonella sp. was capable of forming biofilms at both tested temperatures. Biofilm characterization was confirmed by collecting the samples consistently, at the same sampling points, and by assessing biofilm formation in vitro. These results highlight the potential risk of cross-contamination in poultry slaughterhouses and the importance of surveillance and pathogen control maintenance programs within the meat production industry.

Introduction

The hygienic and sanitary conditions of the industrial environment are essential for ensuring food safety and quality [1-3]. One of the current challenges encountered in slaughtering and meat processing is the prevention of cross-contamination by microorganisms [4, 5]. Cross-contamination can occur via contact with bacterial biofilms due to the performance of improper hygiene and sanitization practices at the slaughter system. This leads to a decrease in food quality, resulting in pathogen transmission and the occurrence of recurring contamination of food [5, 6]. Listeria monocytogenes and Salmonella spp. are deemed important pathogens whose dissemination can be controlled to ensure food quality and safety. Their presence is a criterion for evaluation within the various aspects of quality control of the meat production process [7].

L. monocytogenes is recognized as the main etiological agent of listeriosis in humans [8]. It is a psychrophilic bacterium, that can develop on surfaces of meat production industries [9]. The species is subdivided into 13 serotypes, of which 1/2a, 1/2c, and 4b are the most commonly reported serotypes involved in cases of human listeriosis [10]. Owing to the difficulties and limitations encountered with methods of traditional serology, different subtyping methods have been developed, such as the differentiation of the main lineages assessed via polymerase chain reaction (PCR) [11]. Additionally, molecular typing methods with high discriminatory power, such as pulsed-field gel electrophoresis (PFGE), are widely used to assess clonal dissemination within industries [10, 12, 13]. There is considerable pathogenic potential among the different L. monocytogenes clones. [14]. The role of internalin A in Listeria, encoded by the inlA gene, is exemplary as its functionality is necessary for pathogen internalization [15-17]. The presence of premature stop codons (PMSCs) in this gene has been associated with clones with an attenuated invasion phenotype [18].

The genus Salmonella, which is responsible for salmonellosis, includes the Salmonella enterica species. It is a microorganism that is often identified as an etiological agent of food outbreaks, presenting a complex epidemiology regarding its transmission and distribution, and is therefore important for investigation in the assessment of risks to public health. [19]. The species demonstrates adherence to surfaces such as metals, glass and rubber, and exhibits the ability of biofilm formation [20-22].

Antimicrobial resistance (AMR) is considered a grave concern and risk to human health [23, 24]. To mitigate its risks, the World Health Organization established a global action plan [25]. One of the main strategies outlined in the plan is to monitor the spread of AMR. Considering the importance of monitoring L. monocytogenes and Salmonella spp. dissemination and the necessity of ensuring public health and safety, and owing to the limited investigations related to the presence of biofilms in Brazil, the objectives of this study were to detect biofilm-induced contamination points and the presence of these microorganisms in processing plants of cattle and poultry slaughterhouses, to characterize these strains by performing serotyping, AMR analysis, and to evaluate the in vitro biofilm formation capability of all isolates. Additionally, whole genome sequencing (WGS) of Salmonella spp. was performed in addition to the conduction of PFGE, sequencing of the inlA gene, and cell adhesion and invasion assays in Caco-2 cells for all Listeria strains.

Material and methods

Sample collection

Samples were collected from three poultry slaughterhouses (A, B and C) and two cattle slaughterhouses (D and E) located in the Federal District area (A, B and D) and in the State of Goiás (C and E). All slaughterhouses availed an official inspection service. All slaughterhouses agreed to participate voluntarily in the study. Sterile swabs (Absorve®, Brazil) and 25 cm2 molds were used to examine the surfaces of the installations, equipment, and utensils in cattle and poultry slaughterhouses [26]. The sampling locations were separated into the following two groups: installations (floors, walls, and drains of dirty and clean areas), and equipment (mats, evisceration tables, chutes, and different machinery), and this method was based on protocols described by Barros et al. 2007 [27] and Nicolau and Bolocan 2014 [26]. Sixteen visits (eight in cattle slaughterhouses and eight in poultry slaughterhouses) were conducted between March 2017 and September 2018, for the collection of 287 swabs. Of the swabs collected, 118 were obtained from cattle slaughterhouses and 169 were obtained from poultry slaughterhouses. The swabs were individually added to tubes containing a sterile transport solution (peptone water 0.1%; Himedia®, India) and transported in isothermal boxes to the Food Microbiology Laboratory at the University of Brasília for culturing and microbiological isolation. Sample processing was performed within 24 h of sample collection. Biofilms were characterized within a processing plant by repetitively collecting samples at the same locations within each plant but on different visits, to observe the recurrence of the investigated microorganisms [28], and by assessing their in vitro biofilm-forming capability. Studies have correlated the permanence of microorganisms on surfaces after subjection to cleaning and sanitization practices to the existence of biofilms on such surfaces [29, 30]. Thus, sample collections were conducted at different times, with the surfaces treated hygienically and sanitized between visits.

Isolation of L. monocytogenes and Salmonella spp

For the isolation of L. monocytogenes, swab samples were analyzed according to the methodology described by Ryser and Donnely 2015 [31]. Transport tubes containing swabs were homogenized in a tube shaker, with the subsequent addition of 1 mL of transport solution to 9 mL of UVM broth (Acumedia®, USA). After 24 h of incubation at 35°C, the culture (0.1 mL) was transferred to 9 mL of Fraser broth (Acumedia®, USA). Esculin hydrolysis was performed after incubation at 35°C for 24–48 h. Each sample was plated on Modified Oxoid (MOX) agar (Difco®, France). Presumptive colonies were incubated in Brain Heart Infusion (BHI) broth (Acumedia®, -USA) at 35°C for 24 h and were biochemically analyzed. Isolates with characteristics compatible with the selected genus were examined by PCR to confirm the species using the primers LIP1 [32] and LIP2A [33] for amplification of the prfA gene. PCR was performed as per methods described by Kérouanton et al. 2010 [33]. Positive controls were provided by Dr. Ernesto Hofer of the Oswaldo Cruz Foundation located in Rio de Janeiro.

To identify species of Salmonella, swab samples were analyzed as per protocols described by Ryser and Donnely 2015 [31] and ISO 6579/2002 [34]. After homogenization of transport tubes containing the collected swab samples, each homogenate was individually transferred to tubes containing 1% buffered peptone water (Acumedia®, USA). Samples were incubated at 37°C for 24 h. Aliquots were transferred to tetrathionate broth (Merck®, Germany), selenite cystine broth (Merck®, Germany), and Rappaport-Vassiliadis broth (Merck®, Germany). After incubation in selective media, samples were plated on Brilliant Green Phenol Red Agar (Acumedia®, USA), Xylose Lysine Deoxycholate (Merck®, Germany), and Bismuth Sulfite agars (Acumedia®, USA). Presumptive colonies were cultured on Nutrient agar (Acumedia®, USA) and were biochemically analyzed using appropriate tests [34]. This was followed by serology analysis using polyvalent anti-Salmonella somatic and flagellar sera (Probac®, Brazil). PCR amplification of the ompC gene was performed using the OMPCF and OMPCR primers [35] for confirmation of the genus [36]. Positive controls were provided by the Oswaldo Cruz Foundation.

Molecular serotyping of L. monocytogenes and Salmonella

L. monocytogenes subtyping was performed using multiplex PCR and primers lmo0737, lmo1118, ORF2819 and ORF2110, as per methods described by Doumith et al. [11] for differentiation into the four main lineages.

Salmonella spp. serovars were identified via WGS at the Laboratory of Bacterial Resistance and Therapeutic Alternatives at the Institute of Biomedical Sciences of the University of São Paulo (USP–São Paulo/SP). Genomic DNA extraction was performed using the PureLinkTM Genomic DNA Mini Kit (Life Technologies, CA, USA), and used for library preparation using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA). Subsequently, the DNA quantified by Qubit 2.0 fluorometer (Life Technologies) was sequenced using the Illumina NextSeq PE instrument (Illumina Inc., San Diego, CA) using a paired-end (75bp) library. The short reads were trimmed with TrimGalore v0.6.5 (https://github.com/FelixKrueger/TrimGalore) and de novo assembly was performed using Unicycler v.0.4.8 [37]. Genome annotations were performed using NCBI PGAP v.3.2 (http://www.ncbi.nlm.nih.gov/genome/annotation_prok/), and serovar was predicted via SeqSero2 analysis [38].

Pulsed-field gel electrophoresis of L. monocytogenes

PFGE was performed as per guidelines recommended by the Centers for Disease Control and Prevention [39]. The restriction enzyme AscI (Invitrogen®, Lithuania) was used at a concentration of 10 U/μL. Salmonella ser. Braenderup H9812 subjected to digestion with XbaI (Roche®, Germany) at a concentration of 10 U/μL was used as the standard, and was provided by the Enterobacteria Laboratory of the Oswaldo Cruz Foundation. The BioNumerics 7.7. software (Applied Maths) was used to analyze the fragments, with a Dice similarity coefficient of 1.5%. The dendrogram was constructed by analyzing the unweighted pair group method with arithmetic mean (UPGMA) clusters.

Analysis of the inlA gene sequence of L. monocytogenes

The sequencing of the inlA gene (2400bp) was performed following the protocol described by Poyart et al. 1996 [17]. Two gene fragments of 1157 bp and 760 bp were amplified, using primers O1, O2, O3, and O4 [17]. PCR products were purified using the PureLink kit (Invitrogen®, USA), following which they were quantified by using high mass marker (Invitrogen®, Lithuania) and were sequenced using the ABI3500 sequencer (Applied Biosystems).

Cell adhesion and invasion assays for L. monocytogenes

The Caco-2 human colon adenocarcinoma cell line was used. The cells were provided by Prof. Elaine Cristina Pereira De Martinis, from the Faculty of Pharmaceutical Sciences of Ribeirão Preto, USP. Cells were cultured as per methods described by Gaillard et al. 1987 [40]. Wells in polypropylene plates (Kasvi®) were seeded with cells at a final density of 1.0 × 105 cells per well. Adhesion assays were conducted as per protocols described by Moroni et al. 2006 [41]. The wells seeded with the cells were inoculated with a bacterial suspension using a volume adjusted to obtain a multiplicity of infection (MOI) of 100. After adding the Dulbecco’s modified Eagle medium (DMEM) (Gibco®, USA) supplemented with 10% fetal bovine serum (Gibco®, USA), the plates were incubated at 37°C for 2 h in a 5% CO2 atmosphere. The wells were rinsed three times with 1× phosphate-buffered saline (PBS; Laborclin®, Brazil). The cells were then subjected to treatment with a lysis buffer solution containing 0.1% Triton-X100 (Sigma-Aldrich®, USA), and incubated for 10 min under the aforementioned conditions. Viable bacterial cells were counted by seeding serial dilutions on BHI agar (Difco®, France) incubated at 37°C for 24 h. The counts were expressed as colony forming units (CFU)/mL. All tests were performed in triplicate. Adhesion of bacteria to Caco-2 cells was calculated (%) as (number of adherent cells × 100) / number of cells adhering to the well [41]. Invasion tests were performed as per methods described by Gaillard et al. 1987 [40] and Moroni et al. 2006 [41]. Cells were added to each well at an MOI of 100. Following incubation, the cells were subjected to washing steps with PBS as described above for the adhesion assay. After subjection to washing steps, 1 mg/mL gentamicin (Sigma-Aldrich®, Israel) was added to the wells and incubation was performed at 37°C for 1 h in a 5% CO2 atmosphere. The lysis buffer solution was added to each well, and viable bacterial cells were counted as described above. All tests were performed in triplicate. The percentage of bacterial invasion in Caco-2 cells was determined by using the following formula: % adhesion = (number of internalized recovered cells × 100) / number of cells adhering to the well.

Antibiogram and assessment of antimicrobial resistance genes

The AMR of L. monocytogenes isolates was evaluated by performing the disk diffusion assay using Mueller Hinton agar (Acumedia®, USA), as per methods described by the Clinical and Laboratory Standards Institute [42]. The antibiotics tested were ampicillin (10 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), doxycycline (30 μg), erythromycin (15 μg), gentamicin (10 μg), sulfonamides (300 μg), and tetracycline (30 μg). The interpretation of the zone of inhibition diameters was based on the standards prescribed for Staphylococcus spp. [43] which were defined by CLSI M100 [42], with the exception of standards for erythromycin and ampicillin, for which the standards defined by the European Committee on Antimicrobial Susceptibility Testing [44] were used for L. monocytogenes. The identification of resistance genes in L. monocytogenes isolates was performed using PCR. Genes related to the resistance to tetracycline (tetA, tetB, tetC, tetM), macrolides (ermA, ermB, ermC, ereA), amphenicols (cat1, cmlA), sulfonamides (sull), beta-lactams (ampC, blaSHV), and aminoglycosides (aac (3)-I) were investigated. Reactions were performed in a final volume of 25 μL, according to the conditions described in the studies reported in Table 1 for each pair of primers.

Table 1

Primers used to investigate antimicrobial resistance genes in Listeria monocytogenes isolates.

Gene	Primer	Nucleotide sequence (5’-3’)	Size (pb)	Reference
aac(3)-I	aac(3)-I-F	ACCTACTCCCAACATCAGCC	157	Van et al., 2008 [45]
	aac(3)-I-R	ATATAGATCTCACTACGCGC
ampC	AmpC-For	TTCTATCAAMACTGGCARCC	550	Schwartz et al., 2003 [46]
	AmpC-Rev	CCYTTTTATGTACCCAYGA
bla SHV	blaSHV-F	TCGCCTGTGTATTATCTCCC	768	Van et al., 2008 [45]
	blaSHV-R	CGCAGATAAATCACCACAATG
ermA	ermA-F	TCTAAAAAGCATGTAAAAGAA	645	Sutcliffe et al., 1996 [47]
	ermA-R	CTTCGATAGTTTATTAATATTAGT
ermB	ermB-F	GAAAAGGTACTCAACCAAATA	639	Sutcliffe et al., 1996 [47]
	ermB-R	AGTAACGGTACTTAAATTGTTTAC
ermC	ermC-F	TCAAAACATAATATAGATAAA	642	Sutcliffe et al., 1996 [47]
	ermC-R	GCTAATATTGTTTAAATCGTCAAT
ereA	ere(A)-F	GCCGGTGCTCATGAACTTGAG	419	Van et al., 2008 [45]
	ere(A)-R	CGACTCTATTCGATCAGAGGC
cat1	CATIF	AGTTGCTCAATGTACCTATAACC	547	Van et al., 2008 [45]
	CATIR	TTGTAATTCATTAAGCATTCTGCC
cmlA	cmlA-F	CCGCCACGGTGTTGTTGTTATC	698	Van et al., 2008[45]
	cmlA-R	CACCTTGCCTGCCCATCATTAG
sul	sull-F	TTCGGCATTCTGAATCTCAC	822	Van et al., 2008 [45]
	sulI-R	ATGATCTAACCCTCGGTCTC
tetA	tet(A)-F	GTGAAACCCAACATACCCC	887	Van et al., 2008 [45]
	tet(A)-R	GAAGGCAAGCAGGATGTAG
tetB	tet(B)-F	CCTTATCATGCCAGTCTTGC	773	Van et al., 2008 [45]
	tet(B)-R	ACTGCCGTTTTTTCGCC
tetC	tet(C)-F	ACTTGGAGCCACTATCGAC	880	Van et al., 2008 [45]
	tet(C)-R	CTACAATCCATGCCAACCC
tetM	tet(M)-1	GTTAAATAGTGTTCTTGGAG	700	Aarestrup et al., 2000 [48]
	tet(M)-2	CTAAGATATGGCTCTAACAA

The AMR of Salmonella spp. was evaluated by performing the disk diffusion assay using Mueller Hinton agar (Acumedia®, USA), according to the CLSI protocol [42]. The tested antibiotics were nalidixic acid (30 μg), amoxicillin (10 μg), ampicillin (10 μg), cephalothin (30 μg), cefazolin (30 μg), ceftazidime (30 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), colistin (10 μg), doxycycline (30 μg), gentamicin (10 μg), sulfonamides (300 μg), and tetracycline (30 μg). To interpret the results, the standards prescribed for Enterobacteriaceae defined by the CLSI M100 [42] were used. The presence of resistance genes was evaluated via WGS using the ResFinder v.4.0. The presence of genes related to the resistance to the following antimicrobials was investigated: quinolones, tetracycline, nitroimidazole, sulfonamides, macrolides, rifampicin, glycopeptides, colistin, trimethroprim, fusidic acid, aminoglycosides, beta-lactams, oxazolidinone, and fosfomycin. Chromosomal mutations related to AMR in the gyrA, gyrB, pmrA, pmrB, parC, parE, and 16s_rrsD genes were investigated.

In vitro biofilm formation capacity

In vitro biofilm formation capacity of L. monocytogenes and Salmonella spp. isolates was evaluated by performing incubation at 37°C for 24 h and incubation at 12°C for 168 h (7 days). Tests were performed using polystyrene titration microplates as per methods described by Djordjevic et al. 2002 [49] and modified by Borges et al. 2018 [50]. TSB broth (Kasvi®, Italy) was used to prepare bacterial suspensions at a final density of 3 x 108 CFU/mL. All tests were performed in triplicate. After the performance of preparation, incubation, washing steps, staining procedures, and resuspension of each sample, the optical density (OD) of each well was measured using an ELx800 enzyme-linked immunosorbent assay reader (Biotek Instruments) at 490 nm. The OD value for each isolate was determined as the arithmetic mean of the absorbance readings obtained from the three wells. This value was compared with that of the negative control (ODn). The classification proposed by Stepanović et al. 2000 [51] was used to determine the capacity and intensity of biofilm formation. Statistical analysis of data for comparison of the capacity of biofilm formation in the two conditions tested was performed using the SAS software (SAS Inc.).Normality was analyzed using the Shapiro-Wilk test followed by the paired t-test for means comparison between the two groups.

Results and discussion

Detection of microorganisms in poultry and cattle slaughterhouses

Detection of L. monocytogenes

A total of 14 L. monocytogenes isolates were detected from 287 swabs collected from poultry and cattle slaughterhouses (4.87%). All isolates were detected in poultry slaughterhouses (A, B, and C), which represented 169 swabs (8.28%). L. monocytogenes was not detected in any of the 118 samples collected from the cattle slaughterhouses (D and E). The detection points for the isolates are listed in Table 2. In the Federal District and State of Goiás region, reports have described the presence of L. monocytogenes isolated from different sources [52, 53]. These findings support the results of the present study. The absence of L. monocytogenes in cattle slaughterhouses differs from the findings reported by Palma et al. 2016 [53], who described the presence of L. monocytogenes in samples obtained from cattle slaughterhouses. The difference between the studies may be related to the small number of industries available and the sampling visits that were conducted, which was due to the hesitation of the facilities to participate in the study. The difference may also reflect the adequate hygiene and sanitation conditions prevalent in these establishments.

Table 2

Detection of Listeria monocytogenes in swabs collected from poultry slaughterhouse facilities, equipment and utensils located in the Federal District and State of Goiás, Brazil.

Region and establishment	DF	DF	DF	DF	DF	GO	GO	DF
Identification	A	A	A	A	A	C	C	B
Swab collection points	Collection 1	Collection 2	Collection 3	Collection 4	Collection 5	Collection 6	Collection 7	Collection 8	Total Listeria monocytogenes strains	Total no. of swabs obtained from each collection point	Percentage of positive samples at each collection point (%)	Identification of isolates detected at each collection point
	No. of swabs = 16	No. of swabs = 16	No. of swabs = 16	No. of swabs = 15	No. of swabs = 25	No. of swabs = 25	No. of swabs = 25	No. of swabs = 31
Facilities									4	56	7.14
Floor in clean area	0	0	0	0	0	0	0	0	0	1	0.0
Drains in clean area	0	0	1	0	0	0	1	1	3	38	7.89	63A-1;69A-2; 117A-3
Drains in dirty area	0	0	0	0	0	0	0	0	0	2	0.0
Walls in clean area	0	0	0	0	0	0	1	0	1	13	0.0	76A-2
Walls in dirty area	0	0	0	0	0	0	0	0	0	2	0.0
Equipment and utensils									10	113	8.84
Evisceration table	0	0	0	0	0	0	2	0	2	35	5.71	74A-2; 77A-2
Mats in clean area	0	0	0	0	0	3	0	0	3	33	9,09	45A-2; 52A-2; 59A-2
Chutes of meat	0	0	0	0	0	2	3	0	5	13	38.46	42A-2; 54A-2; 72A-2; 78A-2; 88A-2
Chutes of carcass	0	0	0	0	0	0	0	0	0	14	0.0
Chutes of bones and viscera	0	0	0	0	0	0	0	0	0	5	0.0
Hooks	0	0	0	0	0	0	0	0	0	6	0.0
Machinery	0	0	0	0	0	0	0	0	0	7	0.0
Total no. of L. monocytogenes isolates obtained in each collection	0	0	1	0	0	5	7	1	14
Total no. of swabs obtained in each collection	16	16	16	15	25	25	25	31		169

The detection of L. monocytogenes in poultry slaughterhouses is similar to the findings reported in previous studies described in Brazil [4, 54–56]. The detection of L. monocytogenes at the sampling points described in the present study agrees with previously reported detection on stainless steel tables [4, 55], mats [4], chutes [56], and drains [12, 28]. The usual definition of persistence in the context of foodborne pathogens is the repeated isolation of strains that are identical subtypes identified on different days [2]. In this study, strains were considered persistent when detected at the same sampling location after at least one sanitation process. All collections were performed after the environment was subjected to sanitation procedures at least once, suggesting the persistence of the microorganism, possibly due to the ability to adhere to surfaces and to form biofilms [57-59]. At one collection point (a chute in slaughterhouse C), L. monocytogenes was detected in two samples collected on different days, suggesting the presence of biofilms at the site. In two different studies conducted in the United States, Berrang et al. [28, 60] performed serial collection from the same points within the slaughter plant at different times to characterize the presence of persistent L. monocytogenes isolates in the environments of poultry slaughterhouses. The authors concluded that the persistence of this microorganism in drains was related to the formation of biofilms [60]. Similar to the methods described in the present study, Sereno et al. 2019 [61] performed serial swab collections of walls, drains, tables, mats, and floors in a swine slaughterhouse in the southern region of Brazil. The persistence of L. monocytogenes strains was detected at the same sampling point over time and was related to the presence of biofilms at said location. Areas of bacterial persistence include drains [28, 60] and a mat [61]. The present study also detected the presence of L. monocytogenes at these sites, although there was no detection at the same site more than once, except for the chute.

Detection of Salmonella spp.

One Salmonella sp. was detected in 287 (0.34%) swabs collected from the cattle and poultry slaughterhouses. The isolate originated from a drain sample that was collected from a dirty area of poultry slaughterhouse B. This is the first investigation of Salmonella spp. in a processing plant of a poultry slaughterhouse located in the Federal District. However, other reports have described the occurrence of Salmonella spp. in poultry carcasses/viscera produced and/or sold in this region [36]. The low detection in poultry slaughterhouses and absence in cattle slaughterhouses may reflect the efficiency of self-control, disinfection, and sanitation programs in these industries, the reduced number of visits resulting from the hesitation of industries to allow internal access for sample collection, and the implementation of control programs by the government with the aim of reducing the incidence of Salmonella spp. to protect consumers from considerable risks [62-64].

Serotyping analysis by PCR and evaluation of genetic variability of Listeria monocytogenes by PFGE

All 14 isolates were classified via PCR as 1/2a or 3a serotypes, belonging to lineage II [65-67], with amplification of the lmo0737 gene (691pb). These results corroborate reports available in the literature that highlight serotype 1/2a, along with serotypes 1/2b and 1/2c, as one of the most commonly detected serotypes in food samples and food production environments of animal origin [68]. The polymorphic results obtained via PFGE identified 11 distinct pulsotypes that were grouped into four clusters (I, II, III and IV) with a similarity threshold of 80% [69] (Figs 1 and S1). The sample collection points of origin from each pulsotype are shown in Fig 2. To analyze strain dissemination within industries and in the studied regions, clonal variations were considered only for those isolates that presented 100% identity with each other [70]. Pulsotype 9 was the most frequently detected (3/14 isolates), followed by pulsotype 5 (2/14 isolates). The same pulsotype was detected at different sampling points within the same industry (pulsotype 5, detected in a meat chute (72A-2) and an evisceration table (77A-2); and pulsotype 9, detected on a mat in the clean area (59A-2) and a meat chute (78A-2), both present on slaughterhouse C located in Goiás State; Table 2), suggesting the dissemination of these two clones within this establishment. Pulsotype 9 was detected at different sites and at different visits within this slaughterhouse. Though sanitization was performed between sample collections, the fact that the same strain was detected in different collections within the same establishment indicates the presence of biofilms. This finding corroborates those reported by Berrang et al. 2005 [28], Berrang et al. 2010 [60], Camargo et al. 2015 [13], and Sereno et al. 2019 [61]. Pulsotype 9 was also detected in a drain sample obtained from slaughterhouse B, located in the Federal District, suggesting regional dissemination of the strain. These results highlight the importance of using molecular typing methods with high discriminatory power, such as PFGE, to investigate the dissemination and persistence of strains within food processing plants [12, 13, 71, 72]. These typing methods are valuable when WGS analysis cannot be performed. Similar to the results obtained in the present study in relation to the use of PFGE, Camargo et al. 2015 [13] described the serial collection of samples during different visits from environmental locations, cuts of meat, and the hands of employees working in a cattle slaughterhouse in the state of Minas Gerais. This aided the identification of cross-contamination between these points and helped determine the persistence of specific pulsotypes. The results of the present study confirm the persistence of two pulsotypes (5 and 9) in slaughterhouse C and possible regional strain dissemination (pulsotype 9). However, due to the low number of isolates identified in slaughterhouses A and B, it was not possible to confirm the persistence of isolates within these establishments. However, the detection of isolates before the commencement of operations in the slaughterhouses (pre-sanitization) and after slaughter (post-sanitization) suggests the continuous presence of this microorganism in existing biofilms in these facilities.

Fig 1

Dendrogram and PFGE patterns of 14 isolates of Listeria monocytogenes restricted with AscI.

The data were analyzed using the BioNumerics software. Discrimination of pulsotypes, clusters, origins of isolates (Federal District, DF; or Goiás, GO), establishment of origin (A, B or C), and isolate identification are presented.

Fig 2

Sample collection points of the 11 L. monocytogenes pulsotypes detected in poultry slaughterhouses A, B and C located in Federal District and Goiás. The numbers in parenthesis represent the number of isolates belonging to each pulsotype, totaling 14 isolates.

Salmonella sp. serotyping by WGS analysis

WGS analysis of Salmonella sp. isolate identified it as Salmonella enterica serovar Minnesota belonging to ST548 [73]. This finding differs from those reported in other studies in the investigated regions, which indicated a higher occurrence of serovar Enteritidis [36, 74, 75]. S. Minnesota ST548 derived from chicken carcasses, chicken feet, and mechanically recovered meat have been reported in Brazil (São Paulo and Minas Gerais, São Paulo, and Federal District, respectively) [76]. On the other hand, this is the first report of its presence in a poultry slaughterhouse located in the Federal District.

Sequencing analysis of the inlA gene in L. monocytogenes isolates

PMSCs were not detected in any of the 14 L. monocytogenes isolates investigated. These results are similar to the results reported by Medeiros et al. 2020 [77]. The authors reported the absence of PMSCs in L. monocytogenes isolates in samples collected from poultry slaughterhouse drains in the Federal District. However, results of the present study differ from those reported previously by Manuel et al. 2015 [78] in the United States and by Camargo et al. 2019 [79] in Brazil. Both studies reported a higher occurrence of PMSCs in strains isolated from food samples and food production environments. The occurrence of PMSCs in L. monocytogenes isolates is associated with the occurrence of attenuated invasion phenotypes [18, 80]. Isolates from human listeriosis have less frequent PMSCs in the inlA gene than isolates obtained from food [78, 79, 81]. The present report indicating the absence of PMSCs is an important finding for public health, since the integrity of the inlA gene is necessary to promote the internalization of this pathogen in host cells [18, 82].

Cell invasion and adhesion assays

All 14 L. monocytogenes isolates demonstrated adherence to the Caco-2 cell surface, with an adhesion capacity that varied from 17.38% to 57.14%. Seven of the fourteen isolates (50%) showed ability to invade Caco-2 cells, with an invasion capacity varying from 5.16% to 34.27% (Fig 3). The isolates that exhibited invasion ability belonged to clusters I and III, and pulsotypes 1 (76A-2), 4 (54A-2), 7 (74A-2), 9 (59A-2, 78A-2 and 117A-3), and 10 (88A-2) (Fig 3). The three isolates belonging to pulsotype 9 could invade Caco-2 cells, although presenting with different capacities. The invasion capacity observed in seven of the fourteen isolates, in which the presence of PMSCs was not detected, corroborates with the findings reported by Nightingale et al. 2005 [18]. The latter authors reported that isolates without PMSCs could invade Caco-2 cells with an ability that was significantly more than isolates with PMSCs in the inlA gene. However, the results differed from those reported for the other seven isolates. Despite the absence of PMSCs, these isolates could not invade Caco-2 cells. Several studies have demonstrated the central role of inlA in cell invasion [18, 81, 83]. However, other elements such as internalin B [84] and listeriolysin O [85] may also be important for the internalization of L. monocytogenes in different cell types. Furthermore, differences in invasion capacity among isolates with the complete gene inlA have been described, indicating that other factors may be related to the efficiency of invasion of this pathogen [86].

Fig 3

Results of invasion and cell adhesion tests using Caco-2 cells for 14 Listeria monocytogenes isolates.

The values shown represent the average of the results, and the bars represent the standard deviation.

Antibiograms and detection of resistance genes

L. monocytogenes

Resistance or intermediate sensitivity was detected for seven of the eight antimicrobials tested (Table 3). Six of the fourteen isolates (42.9%) were sensitive to all the tested antibiotics. Eight isolates (57.1%) displayed resistance or intermediate sensitivity. The absence of resistance to ampicillin and chloramphenicol corroborates the results observed by other authors in isolates obtained from food sources and food production environments [53, 87–89]. Surveillance of the occurrence of ampicillin resistance is important for public health, since this drug is a treatment of choice for human listeriosis [90]. The sensitivity to chloramphenicol can be explained by the ban on the use of this antibiotic for the production of food of animal origin in Brazil since 2003 [91]. The results of the present study on the resistance and intermediate sensitivity towards ciprofloxacin, erythromycin, and gentamicin (42.8%, 35.7%, and 35.7% of L. monocytogenes isolates, respectively) contrasted with those observed by other authors, such as Teixeira et al. 2020 [89], who reported the absence of resistance to the three antibiotics in isolates obtained from beef cuts in the state of Mato Grosso, Brazil. The findings of the present study on resistance to gentamicin and erythromycin indicate a public health concern, since these are the drugs of choice for the treatment of listeriosis in specific cases, such as the use of gentamicin associated with penicillin as an alternative to ampicillin, and the use of erythromycin in the treatment of infections in pregnant women [90, 92]. The low occurrence of resistance to doxycycline detected in this study corroborates the findings reported by Vitas et al. 2007 [93], who reported a low occurrence of resistance in isolates of L. monocytogenes obtained from food and human clinical cases in Spain. The low detection of resistance to tetracycline (7.1% of the isolates) is in agreement with the findings reported by Haubert et al. 2016 [88] for isolates obtained from food and food production environments in the southern region of Brazil. However, the findings of the present study differ from those described by Palma et al. 2016 [53] and Camargo et al. 2015 [87], in which resistance to tetracycline was not detected in isolates obtained from samples of beef cuts, cattle slaughterhouse environments, and clinical cases in Brazil. The highest occurrence of AMR detected in this study was in relation to sulfonamides, a characteristic which was found in eight isolates (57.1%). These findings corroborate the results reported by other authors, who also reported a pronounced prevalence of resistance to this class of antimicrobials in isolates obtained from food and food production environments [53, 89, 94, 95]. Sulfonamides associated with trimethoprim are considered as the second-choice of treatment for human listeriosis [90]. Therefore, the detection of resistance to this class of antimicrobials may indicate a risk to human health.

Table 3

Antibiogram constructed for 14 Listeria monocytogenes isolates obtained from poultry slaughterhouses located in the region of the Federal District and State of Goiás, based on the results obtained via disk diffusion assay for antimicrobial resistance (CLSI, 2020).

Antimicrobial and class	No. of resistant isolates (%)	No. of isolates with an intermediate sensitivity (%)	No. of sensitive isolates (%)	Total no. of intermediate resistance-displaying isolates (%)
Sulfonamides (sulfonamide)	8 (57.1)	0 (0.0)	6 (42.9)	8 (57.1)
Erythromycin (macrolide)	4 (28.6)	1 (7.1)	9 (64.3)	5 (35.7)
Ciprofloxacin (quinolone)	3 (21.4)	3 (21.4)	8 (57.2)	6 (42.9)
Gentamicin (aminoglycoside)	4 (28.6)	1 (7.1)	9 (64.3)	5 (35.7)
Chloramphenicol (chloramphenicol)	0 (0.0)	4 (28.6)	10 (71.4)	4 (28.6)
Tetracycline (tetracycline)	1 (7.1)	1 (7.1)	12 (85.8)	2 (14.3)
Doxycycline (tetracycline)	1 (7.1)	0 (0.0)	13 (92.9)	1 (7.1)
Ampicillin (beta-lactamases)	0 (0.0)	0 (0.0)	14 (100)	0 (0.0)

The results of the detection of AMR genes are shown in Table 4. The ermA, ermC, cat1, sulI, aaC (3)-1, cmlA, ereA, SHV, and ampC genes were not detected.

Table 4

Results of antibiogram susceptibility test and antimicrobial resistance genes for the 14 L. monocytogenes isolates.

L. monocytogenes isolate identification	Pulsotype	Region and establishment identification	Swab collection point in the industry	Antibiogram results of resistance or intermediate sensibility	Antimicrobial resistance genes
42A-2	11	GO/C	Chutes of meat	Sensible to all tested bases	No gene targeted in the study detected
45A-2	6	GO/C	Mats in clean area	CIP* ERI GEN* SUL VAN*	tet(M) tet(C)
52A-2	3	GO/C	Mats in clean area	CIP* CLO* ERI GEN SUL TET* VAN	ermB tet(C)
54A-2	4	GO/C	Chutes of meat	CIP CLO* DOX ERI GEN SUL TET VAN*	ermB tet(M) tet(C)
59A-2	9	GO/C	Mats in clean area	Sensible to all tested bases	tet(B) tet(C)
63A-1	2	DF/A	Drains in clean area	Sensible to all tested bases	tet(C)
69A-2	8	GO/C	Drains in clean area	Sensible to all tested bases	tet(B)
72A-2	5	GO/C	Chutes of meat	CIP CLO* ERI* GEN SUL VAN	tet(C)
74A-2	7	GO/C	Evisceration table	SUL	tet(B)
76A-2	1	GO/C	Walls in clean area	Sensible to all tested bases	tet(C)
77A-2	5	GO/C	Evisceration table	SUL	tet(C)
78A-2	9	GO/C	Chutes of meat	Sensible to all tested bases	tet(C)
88A-2	10	GO/C	Chutes of meat	CIP* CLO* ERI GEN SUL VAN*	tet(B) tet(C)
117A-3	9	DF/B	Drains in clean area	CIP SUL TEC*	tet(B) tet(C)

* Antimicrobial agents with intermediate sensitivity.

The detection of the ermB gene was in accordance with the finding reported by Haubert et al. [88], who reported the presence of this gene in an isolate of L. monocytogenes obtained from a poultry slaughterhouse environment in the southern region of Brazil. Only two of the four isolates of L. monocytogenes that presented with an erythromycin resistance phenotype in the disk diffusion assay (Table 3) harbored one of the erythromycin-related resistance genes investigated. It could be possible that the isolates that did not harbor ermA, ermB or ermC genes might have harbored genes related to the development of other mechanisms of resistance to this antimicrobial, such as those pertaining to the presence of msr(A) or mef(A) genes [8]. Alternatively, the resistance of these isolates may be attributable to chromosomal mutations [95].

The presence of the tetM gene in two isolates (14.28%) was similar to the findings reported by Bertrand et al. [96], who reported the presence of this gene in isolates exhibiting phenotypic resistance to tetracycline in strains obtained from human clinical samples and swine and poultry slaughterhouse environments from Belgium and France. Several studies have highlighted the tetM gene as the genotype that is most commonly associated with the development of tetracycline resistance in Listeria isolates [96, 97]. These findings differ from findings of the present study that suggested that tetC was the most prevalent gene related to tetracycline resistance. Despite the detection of tetC in eleven of the fourteen isolates (78.6%), only two isolates displayed resistance or intermediate sensitivity to tetracycline in the disk diffusion assay (Table 3). One of these two isolates harbored two of the four genes related to the development of resistance to this drug (tetC and tetM), and was classified as a resistant isolate based on the antibiogram. The other isolate harbored only the tetC gene and showed intermediate sensitivity to this antimicrobial. The other nine isolates with the tetC gene did not demonstrate resistance to tetracycline in the disk diffusion assay. Therefore, the unique presence of tetC in the isolates did not confer a resistance phenotype to tetracycline, suggesting that the genes did not necessarily trigger the resistance phenotype, which might be related to the presence of mutations that could lead to gene dysfunction [98].

Despite the occurrence of AMR to gentamicin in five of the fourteen isolates in the disk diffusion assay (Table 3), the presence of the aac(3)-1 gene was not detected in any isolate. It could be possible that resistance to gentamicin in these isolates was related to the presence of other genes not investigated in this study, since more than 170 genes related to resistance to aminoglycosides have been described in bacteria [8]. In the present study, resistance to sulfonamides was observed in eight of fourteen isolates in the disk diffusion assay, but no isolates harbored the sulI gene. It could be possible that this resistance was associated with other mechanisms, such as the presence of other genes related to sulfonamide resistance, namely sul2, folP, or thyA genes, with the description of the last two genes reported in L. monocytogenes [99].

Only intermediate sensitivity to chloramphenicol was detected in four of fourteen isolates in the disk diffusion assay. The cmlA and cat1 genes were not detected. The intermediate sensitivity observed in this study could be related to cross-resistance due to the presence of other genes that were not investigated, such as floR [100]. Notably, in Brazil, this antimicrobial has been banned from use in animal production since 2003 [91]. Selection pressure was not a factor. The absence of the ampC and blaSHV genes is consistent with the absence of the ampicillin resistance phenotype in the disk diffusion assay.

Four of the fourteen isolates (28.5%) showed resistance to three or more classes of antimicrobials and were classified as multidrug-resistant isolates [101]. All were isolated from establishment C. Two isolates (54A-2 and 88A-2) showed adherence and invasion in Caco-2 cells. Reports of the presence of L. monocytogenes multidrug-resistant isolates have increased in the literature [88, 97, 102]. All multidrug-resistant isolates detected in the present study showed resistance to antimicrobials used in the treatment of human listeriosis (gentamicin and erythromycin) [90]. There is a possibility of the transfer of genes from multidrug-resistant isolates to others. Further studies are warranted to elucidate the resistance mechanisms observed in these isolates and their potential as a source of transfer of resistance to other microorganisms.

Salmonella enterica Minnesota

Resistance or intermediate sensitivity of Salmonella Minnesota was detected in nine of thirteen antimicrobials tested (Table 5). The resistance to tetracycline and ampicillin, and the sensitivity to ciprofloxacin and gentamicin were similar to the results obtained by Dantas et al. [103]. The authors reported the same pattern of resistance in isolates of Salmonella spp. obtained from a poultry slaughterhouse environment in the state of São Paulo. The detection of resistance to ampicillin, cephalothin, and sulfonamide bases, in addition to sensitivity to ciprofloxacin, is comparable to the findings reported by Cunha-Neto et al. 2018 [104] who investigated isolates of Salmonella spp. derived from chicken carcasses in a slaughterhouse in the state of Mato Grosso. However, these authors reported the detection of resistance to gentamicin and chloramphenicol, and sensitivity to nalidixic acid, which differed from the results of the present study. The detection of resistance to nalidixic acid in Salmonella spp. isolates has been widely reported [105-107]. Meta-analyses of studies published over a period of 20 years in Brazil have revealed the increased occurrence of resistance to quinolone in isolates derived from human samples and chicken meat [108]. Resistance to nalidixic acid may be attributable to the prolonged and widespread use of this antimicrobial in human and veterinary medicine, since this was the first drug in the quinolone class to have clinical use [109]. Similar to nalidixic acid resistance, resistance to tetracycline, sulfonamides, and beta-lactams may be related to the overuse of these antimicrobials in the different stages of the chicken meat production chain in Brazil [110].

Table 5

Antibiogram and detection of antimicrobial resistance genes from the Salmonella enterica serovar Minnesota isolate from a poultry slaughterhouse located in the Federal District, carried out using the disk diffusion assay (CLSI, 2020) and WGS, respectively.

Antibiogram (tested drugs)	Antibiogram result	Antimicrobial resistance genes
Nalidixic acid	R	qnrB19
Amoxicillin	R	bla CMY-2
Ampicillin	R	bla CMY-2
Cephalothin	R	bla CMY-2
Cefazoline	R	bla CMY-2
Ceftazidime	R	bla CMY-2
Ciprofloxacin	S	-
Chloramphenicol	S	-
Colistin	S	-
Doxycycline	I	-
Gentamicin	S	aac(6’)-1aa
Sulfonamides	R	sul2
Tetracycline	R	tetA

S, sensitive; I, intermediate; R, resistant.

The present study detected resistance to three generations of cephalosporins. Cephalosporins, especially those of the third and fourth generations, are important for human and animal health [111]. Resistance to cephalosporins (including third- and fourth-generation drugs) has been reported in recent years [112, 113]. The detection of resistance, especially to ceftazidime, is a public health concern and highlights the need for vigilance and the reduction of the use of antimicrobials in veterinary medicine. In recent years, the Brazilian government has restricted the use of antimicrobials in the production of animal foods, such as via implementation of a ban on the use of chloramphenicol and nitrofurans [91], colistin sulfate [114], and more recently, via the enforcement of a ban on the use of tylosin, lincomycin, and tiamulin [115].

WGS analysis of Salmonella isolate (GenBank accession number JABBEB000000000.1) led to the detection of the tetA, sul2, aac (6’)-Iaa, blaCMY-2, and qnrB19 genes, as well as aided identification of a mutation in the parC gene (T57S, ACC →AGC, causing the mutation T→S). All detected resistance genes have been described in Salmonella spp. isolates in Brazil [76, 116]. The concomitant presence of plasmid-mediated quinolone resistance (PMQR) via the qnrB19 gene, and mutations in the region determining quinolone resistance (QRDR) in the parC gene of topoisomerase IV was also observed. These genetic characteristics were confirmed by ascertaining resistance to nalidixic acid, but resistance to ciprofloxacin was not detected in the antibiograms. Despite this, the presence of the qnrB19 gene and other genes related to PMQR may be responsible for the reduced susceptibility to quinolones, which may facilitate the selection of less susceptible isolates and may lead to consequent failure in the treatment with this class of drugs [117]. The detection of PMQR in this study highlights the need for surveillance of the persistence of quinolone resistance genes in the poultry production chain. The blaCMY-2 gene is a plasmid gene related to the production of beta-lactamases (pAmpC), and is a gene that is most commonly detected globally [118]. The presence of this gene corroborates the results of resistance to beta-lactams observed in the disk diffusion assay (ampicillin, cephalothin, cefazolin, and ceftazidime). Its presence is another public health concern considering the importance of beta-lactams in human and animal health, especially third-generation cephalosporins [111]. The presence of the aac-(6’)-Iaa gene related to the development of resistance to aminoglycosides did not confer resistance to gentamicin, the only drug from this class of antimicrobials evaluated in the disk diffusion assay. This discrepancy between phenotype and genotype was also observed in Salmonella spp. isolates obtained from different samples in the poultry production chain in the states of São Paulo, Bahia, and Minas Gerais [76]. In contrast, the occurrence of resistance to tetracycline and sulfonamides is related to the presence of the tetA and sul2 genes, respectively. The absence of colistin resistance genes corroborates findings reported by Monte et al. [76], who reported the absence of these genes in Salmonella spp. isolates obtained from samples of swine and poultry production chains from different regions of Brazil, including the Federal District.

The resistance profile observed in this Salmonella sp. isolate enabled its classification as a multidrug-resistant isolate [101]. This characteristic, associated with the presence of mobile genetic elements related to resistance development, such as the presence of PMQR and pAmpC, suggests a potential public health risk. Additionally, the occurrence of resistance to quinolones and cephalosporins, associated with the presence of genetic elements related to this phenotype, is of special concern, considering the importance of these drugs for human health [111].

During incubation at 37°C for 24 h, 11 of 14 isolates (78.57%) were capable of biofilm formation and were classified as weak biofilm formers. During incubation at 12°C for 168 h, nine of 14 isolates (64.3%) were capable of biofilm formation. All nine were deemed weak biofilm formers (Fig 4). The biofilm formation capacity of L. monocytogenes isolates corroborated findings reported in other studies indicating their ability to adhere to abiotic surfaces and to form biofilms on such surfaces [119-121]. The poor biofilm formation capacity of most isolates (78.57%) at 37°C corroborated the findings reported by Harvey et al. 2007 [119]. The authors reported that 90% of the tested L. monocytogenes isolates were weak biofilm-forming bacteria. There was no significant difference (p = 0.2450) in the biofilm formation capacity of the isolates when incubated at 37°C for 24 h and at 12°C for 168 h. The finding that nine of the 14 isolates can form biofilms during incubation at 12°C highlights the risks that these isolates can pose to cattle and poultry slaughter facilities in the event of failures of the hygiene and sanitation practices adopted for the environments, since this is a common temperature documented inside the industry.

Fig 4

Results of the in vitro biofilm formation capacity test performed using polystyrene microplates (Djordjevic et al., 2002) and 12 Listeria monocytogenes isolates exhibiting biofilm formation capacity at 37°C and/or 12°C.

The bars represent the average value of the optical density of each test for each isolate (ODi), all performed in triplicate, subtracted from the average of the optical density of the negative control for each repetition (ODn).

There was no association between cluster/pulsotype and in vitro biofilm formation capacity. Pulsotypes 9 and 5, which were the most commonly detected, did not present better in vitro biofilm formation capacity than the other pulsotypes (Table 6). These results are similar to the findings of other studies that reported no difference in the in vitro ability to form biofilms between persistent and non-persistent strains [49, 119], although other studies report persistent strains as better in vitro biofilm formers [57, 58]. The association between adherence capacity and strain persistence in the industry remains unclear.

Table 6

Results of antimicrobial resistance, antimicrobial resistance genes and in vitro biofilm formation capacity of the 14 L. monocytogenes isolates.

L. monocytogenes isolate identification	Pulsotype	Antimicrobial resistance	Antimicrobial resistance genes	In vitro biofilm formation capacity	Classification at 37°C	Classification at 12°C
42A-2	11	Sensible to all tested bases	No gene targeted in the study detected	Yes	Weak	Weak
45A-2	6	CIP* ERI GEN* SUL VAN*	tet(M) tet(C)	Yes	Weak	Non-forming
52A-2	3	CIP* CLO* ERI GEN SUL TET* VAN	ermB tet(C)	Yes	Weak	Non-forming
54A-2	4	CIP CLO* DOX ERI GEN SUL TET VAN*	ermB tet(M) tet(C)	No	Non-forming	Non-forming
59A-2	9	Sensible to all tested bases	tet(B) tet(C)	Yes	Weak	Weak
63A-1	2	Sensible to all tested bases	tet(C)	Yes	Weak	Weak
69A-2	8	Sensible to all tested bases	tet(B)	Yes	Weak	Weak
72A-2	5	CIP CLO* ERI* GEN SUL VAN	tet(C)	Yes	Weak	Non-forming
74A-2	7	SUL	tet(B)	Yes	Weak	Weak
76A-2	1	Sensible to all tested bases	tet(C)	Yes	Weak	Weak
77A-2	5	SUL	tet(C)	Yes	Weak	Weak
78A-2	9	Sensible to all tested bases	tet(C)	Yes	Non-forming	Weak
88A-2	10	CIP* CLO* ERI GEN SUL VAN*	tet(B) tet(C)	Yes	Weak	Non-forming
117A-3	9	CIP SUL TEC*	tet(B) tet(C)	Yes	Weak	Weak

* Antimicrobial agents with intermediate sensitivity.

Three of the four multidrug-resistant isolates (52A-2, 72A-2 and 88A-2) were capable of in vitro biofilm formation at 37°C, and none of them formed biofilm at 12°C. In contrast, 13 out of the 14 isolates that harbored at least one of the resistance genes targeted in this study were capable of biofilm formation in the in vitro assay, at least, at one of the tested temperatures (Table 6). These results highlight the possibility of adherence of these isolates to the surfaces of these industries, posing the risk of acting as resistance gene reservoirs for other strains and species, ultimately posing a threat to public health and causing dissemination of AMR in various strains.

Most isolates investigated in the present study demonstrated the ability to form biofilms under at least one of the conditions tested. These findings, along with the findings of repeated detection of clonal variations within the same industry at different points and different visits, in addition to the identification of the same pulsotype in another slaughterhouse in another region, support the possible existence of L. monocytogenes biofilms in poultry slaughterhouses located in the Federal District and State of Goiás. The detection of the biofilm formation capacity of the isolates, especially the ability documented at 12°C and observed inside slaughterhouses, indicates the possibility that these isolates can adhere to surfaces, including those of equipment and utensils, which suggests the possibility of biofilm formation in the event of failures in appropriate implementation of hygiene procedures. This creates a potential public health risk because of possible food-associated cross-contamination.

Salmonella spp.

The Salmonella sp. isolate was capable of biofilm formation, albeit weakly, under both conditions tested. These results corroborate those reported by Yin et al. 2018 [122]. The authors reported the ability of biofilm formation of Salmonella spp. isolates obtained from beef production environments in China at different temperatures, including 12°C and 37°C. The present results suggest the potential risk to public health by the Salmonella sp. isolate in the slaughterhouse environment, since, in addition to its multidrug-resistance characteristic, this isolate may adhere to abiotic surfaces, and may be considered a potential contaminant of processed foods.

Conclusions

The presence of L. monocytogenes and Salmonella spp. was identified for the first time in poultry slaughterhouses located in the Federal District and in the State of Goiás, Brazil. The bacterial species were detected on equipment and utensils, especially chutes, which were the main routes of contamination by L. monocytogenes within the evaluated plants. Species could not be detected in cattle slaughterhouses. The consistent and repeated collection at the sampling points enabled the characterization of biofilms in the environments of the industries, which was confirmed in 12 of the 14 L. monocytogenes isolates and in Salmonella sp. via the in vitro biofilm formation capacity test that was performed at 12°C and/or at 37°C. The PFGE patterns aided the evaluation of the dissemination of specific pulsotypes both within an industry and in the studied regions. Sequencing of the inlA gene derived from L. monocytogenes isolates demonstrated the absence of PMSCs in all isolates. These results, along with the adhesion and cell invasion assay results, suggest their virulence potential. The detection of resistance to antimicrobials of public health importance in L. monocytogenes and Salmonella sp. isolates, in addition to the detection of multidrug-resistant isolates, also underlines the potential risk for the consumer due to the possibility of food-associated cross-contamination via contact with biofilms formed on abiotic surfaces. The results of this study indicate the importance of conducting research that supports surveillance in slaughterhouse environments for possible adjustments in environmental hygiene and sanitation procedures. Additionally, the detection of isolates with pathogenic potential related to the capability of cell invasion, the ability to form biofilms, and AMR development indicates the necessity of assessing the risk for the population as an instrument of public health protection.

Nucleotide sequence accession number

Information on this Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession number JABBEB000000000 (SRA: SRR12606957). The version described in this paper is version JABBEB000000000.1.

Raw gel images of PFGE performed for the 14 L. monocytogenes isolates.

(PDF)

Click here for additional data file.

1 Jul 2021

PONE-D-21-17398

Molecular characterization of Salmon​ella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil

PLOS ONE

Dear Dr. Agostinho Davanzo,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

There are a number of questions on methodology, data interpretation and conclusions. Please address all comments point by point.

Please submit your revised manuscript by Aug 15 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Iddya Karunasagar

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Additional Editor Comments (if provided):

The reviewers have raised a number of important questions regarding rationale, methodology, data interpretation and conclusions. Please address all the reviewer comments point by point.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors characterized two important food- borne pathogens isolated from cattle and poultry, and the study has provided interesting findings. However, the research findings are not presented in a better shape; hence, a couple of suggestions are given below for its improvement.

1. The entire manuscript has to be thoroughly re-drafted with the help of an English-speaking native researcher to ensure its improved drafting in terms of grammatical mistakes and better readability. Overall, the discussion need to be improved and comparative analysis of the assays need to be performed to draw conclusive findings.

2. Line. 133 mentions the usage of UMV broth, instead of UVM. Expand the mnemonics, while used for the first time.

3. In the antibiogram assay, mention the medium used. The quality control strains used in this assay to be mentioned.

4. The concentration of bacterial inoculum used in the in vitro biofilm assay to be mentioned in the section. How were the test isolates compared or graded for biofilm formation?

5. The expression of antibiogram (Table 3) should be modified. As there exist countable isolates, it is suggested to present an isolate- wise susceptibility pattern in the table to get a better picture. Similarly, a comparative PCR- based antibiotic susceptibility pattern should be included for better representation of data.

6. The in vitro biofilm forming assay needs to be compared with the antibiogram data as well as with the serotypes to derive findings. Overall, the discussion with regard to the biofilm forming ability and its comparison with previous assays shall be improved.

Reviewer #2: PONE-D-21-17398

Molecular characterization of Salmonella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil.

This study aimed to detect biofilm-induced contamination points and the presence of these microorganisms in processing plants of cattle and poultry slaughterhouses, and to characterize them with respect to pathogenicity potential, biofilm formation and antimicrobial resistance.

The study could isolate 14 Listeria monocytogenes and one Salmonella enterica from poultry slaughterhouses. L. monocytogenes puslotypes 5 and 9 were more frequently isolated than others. The authors conclude that these are persistent, biofilm forming strains that might constitute constant sources of contamination of processed meat.

Comments

The number of isolates recovered in this study are limited. The relevance of whole genome sequencing of the only isolate of Salmonella to this study is not clear. Although the isolates exhibited biofilm formation, this together with the frequency of isolation of two pulsotypes does not provide strong evidence to suggest that the isolates are persistent contaminants in these facilities. Further, the sources of contamination are obscure. The manuscript has abundantly used the available literature to support their findings. However, the results available from the study are too limited to make such conclusions.

Major points

• I am not convinced with the concept biofilm-induced contamination points, which is not defined in the manuscript. Past studies have analyzed the presence of Listeria monocytogenes, Salmonella etc from processing plants by swab analysis approach. In lines 303-304, you have cited studies from the same geographical region and similar sampling points. However, this manuscript considers swab isolates form surfaces as biofilm formers. (Lines 286-288: The present study is the first investigation of L. monocytogenes biofilms in poultry and cattle slaughterhouses facilities, equipment, and utensils in the region). Again in L289-290, it is stated that “The prior findings corroborate the present results”. Corroborate what? The presence of L. monocytogenes or the biofilm L. monocytogenes?

• The persistent contaminant from biofilms across different sampling time points and locations should be clearly defined.

• Table 2: Here, the number of swabs from different collection points are different. Please explain why.

• L307-308: Here, it is stated that L. monocytogenes was detected in two samples collected on different days and this could be due to persistent, biofilm-forming strains. How close were these sampling days?. If I am correct, 5 swabs yielded equal number of isolates. How many isolates were obtained from each positive sample? It is unlikely that you got just one isolate from a sample. If you got more than one isolate, did you compare them phenotypically and genetically and then select non-repetitive isolates?.

• Again in L308-309, it is stated that “L. monocytogenes was detected in two samples collected on different days, suggesting the presence of biofilm at the site”. Did you collect samples immediately after sanitization? How do you rule out recontamination after disinfection?

• L313-314: In Berrang et al. (2010), the source of L.monocytogenes was the raw meat. According to this study, a persistent drain subtype was identical with the raw meat subtype, and this clone was recovered frequently in their sampling. However, in your study, it appears that there is no correlation between the source and the recovery of the clonal isolate from the meat chute.

• Which pulsotype was isolated frequently from meat chute? . Since you followed CDC protocol, you should be able to compare your PFGE pattern with those in PulseNet database.

• L440-442: Were L. monocytogenes resistant to chloramphenicol before the ban of the antibiotic? This is important to understand the effect of antibiotic ban on the resistance patterns.

• You have used 12oC to study biofilm formation. Does this simulate the temperature conditions of your sampling locations?

• Pulsotype 9 and 5 were more frequently isolated and probably the persistent strains as suggested in the manuscript. It is important to know if these pulsotypes exhibited higher biofilm formation compared to others which were not isolated frequently. This will strengthen your hypothesis that the persistence of these pulsotypes is due to their ability to form strong biofilms.

• The sections on antimicrobial susceptibility and biofilm formation by Salmonella Minnesota can be combined. The study could isolate a single Salmonella and the significance of this finding is very limited.

• Please avoid claiming “first time” in multiple places in the same manuscript, unless the finding is very significant.

• Materials and methods: Samples were collected from 3 poultry slaughterhouses and 2 cattle slaughterhouses. Eight visits were conducted in two facilities. If I got it correctly, it would be 8x3 =24 and 8x2-16 (40 in total). And in each visit, samples were collected from installations and the equipment. Were the same locations samples each time? If so, how many swabs from each of these? An illustration would be useful for the readers to understand your sampling strategy.

• L120: “…Biofilms were characterized..”. Biofilms can be formed on any of the above sampling locations (installations/equipment). Did you look at this possibility? Of did you select a few locations for biofilm bacteria?.

Minor points

• The abstract is too long, and you might consider shortening it.

• A Venn diagram can help understand the distribution of pulsotypes from different locations.

• I have indicated few minor corrections in the manuscript itself.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Manuscript_tracked changes.rtf

Click here for additional data file.

Submitted filename: PONE-D-21-17398_review.docx

Click here for additional data file.

12 Aug 2021

Review Comments to the Author

Reviewer #1: The authors characterized two important food- borne pathogens isolated from cattle and poultry, and the study has provided interesting findings. However, the research findings are not presented in a better shape; hence, a couple of suggestions are given below for its improvement.

1. The entire manuscript has to be thoroughly re-drafted with the help of an English-speaking native researcher to ensure its improved drafting in terms of grammatical mistakes and better readability. Overall, the discussion need to be improved and comparative analysis of the assays need to be performed to draw conclusive findings.

The manuscript was initially translated by Editage, which offered us a certificate of translation.. A new revision was made throughout the whole manuscript by the same group and we hope the readability has improved. We included the certificate of revision for consultation.

2. Line. 133 mentions the usage of UMV broth, instead of UVM. Expand the mnemonics, while used for the first time.

The mistake was corrected, and the abbreviation was expanded as indicated. (L154)

3. In the antibiogram assay, mention the medium used. The quality control strains used in this assay to be mentioned.

The medium used was mentioned as indicated (L 257/277). We did not use control strains for the antibiogram assay.

4. The concentration of bacterial inoculum used in the in vitro biofilm assay to be mentioned in the section. How were the test isolates compared or graded for biofilm formation?

The concentration of bacterial inoculum was added as indicated (L 297). The grading for biofilm formation was performed according to the classification proposed by Stepanovic et al. (2000), as stated in lines 303-305.

5. The expression of antibiogram (Table 3) should be modified. As there exist countable isolates, it is suggested to present an isolate- wise susceptibility pattern in the table to get a better picture. Similarly, a comparative PCR- based antibiotic susceptibility pattern should be included for better representation of data.

We agree with the observation and a new table comprising antimicrobial resistance and gene detection results was included, indicating as well the origin and identification of the strains (Table 4 – L437).

6. The in vitro biofilm forming assay needs to be compared with the antibiogram data as well as with the serotypes to derive findings. Overall, the discussion with regard to the biofilm forming ability and its comparison with previous assays shall be improved.

A new table (Table 6 – L 723) comprising these data was added, and the discussion was altered as well (L 708-722).

Reviewer #2: PONE-D-21-17398

Molecular characterization of Salmonella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil.

This study aimed to detect biofilm-induced contamination points and the presence of these microorganisms in processing plants of cattle and poultry slaughterhouses, and to characterize them with respect to pathogenicity potential, biofilm formation and antimicrobial resistance.

The study could isolate 14 Listeria monocytogenes and one Salmonella enterica from poultry slaughterhouses. L. monocytogenes puslotypes 5 and 9 were more frequently isolated than others. The authors conclude that these are persistent, biofilm forming strains that might constitute constant sources of contamination of processed meat.

Comments

The number of isolates recovered in this study are limited. The relevance of whole genome sequencing of the only isolate of Salmonella to this study is not clear. Although the isolates exhibited biofilm formation, this together with the frequency of isolation of two pulsotypes does not provide strong evidence to suggest that the isolates are persistent contaminants in these facilities. Further, the sources of contamination are obscure. The manuscript has abundantly used the available literature to support their findings. However, the results available from the study are too limited to make such conclusions.

The number of isolates were products of the permissions of the industries. It was a limiting factor.

For the WGS we had an opportunity to perform this technique in association with Universidade de São Paulo, and we considered relevant to know all the resistome and virulome of the Salmonella strain detected in this study.

All the strains were detected after rigorous process of surface sanitization in the industries, so the repeated isolation in the same place and the in vitro biofilm forming capacity must be considered.

The purpose of this study was not to search for the sources of the contamination initially, but to detect evidence of the biofilms in industries. We’ve made some changes to the text and we hope it has improved the comprehension regarding strain persistence (L342-346).

Major points

• I am not convinced with the concept biofilm-induced contamination points, which is not defined in the manuscript. Past studies have analyzed the presence of Listeria monocytogenes, Salmonella etc from processing plants by swab analysis approach. In lines 303-304, you have cited studies from the same geographical region and similar sampling points. However, this manuscript considers swab isolates form surfaces as biofilm formers. (Lines 286-288: The present study is the first investigation of L. monocytogenes biofilms in poultry and cattle slaughterhouses facilities, equipment, and utensils in the region). Again in L289-290, it is stated that “The prior findings corroborate the present results”. Corroborate what? The presence of L. monocytogenes or the biofilm L. monocytogenes?

The biofilm characterization is defined in L140-143. A modification was made to clarify this point. We aimed to characterize these biofilm points by sampling the same points at different visits, after sanitization procedures and by performing the in vitro biofilm formation assay to draw the conclusion that they might be present in these sampling points.

In lines 293-294 we meant that the other studies corroborate the presence of the microorganism in the region. We believe the previous sentence (The present study is the first investigation of L. monocytogenes biofilms in poultry and cattle slaughterhouses facilities, equipment, and utensils in the region of the Federal District in Brazil) led to the confusing phrasing. We excluded this sentence hoping to clarify the confusion (L322-324).

• The persistent contaminant from biofilms across different sampling time points and locations should be clearly defined.

We’ve modified some sentences (L 395-399) and we hope it has improved the text. Also, the addition of the Venn diagram (Fig 2) will hopefully clarify this point.

• Table 2: Here, the number of swabs from different collection points are different. Please explain why.

The main limitation for conducting this research was the difficulty posed by the industries for participating and allowing the researchers inside their premises to perform sample collection. The different number of swabs in each visit reflects this difficulty. Sometimes we would have access to different parts of the industry, and at the next visit, that part would be out of reach. So, we aimed to collect as many points as we could in each visit, because we could not know how the next one would be. Even through this difficulty, only the points of the last visit (visit 8) could not be repeated. In all the other visits, exactly the same collection points were used, and some other points were sampled as well in order to compensate for the restriction imposed by the industries. That’s why in visits performed in abattoir A, the two last visits showed a different number of swabs than the first ones.

• L307-308: Here, it is stated that L. monocytogenes was detected in two samples collected on different days and this could be due to persistent, biofilm-forming strains. How close were these sampling days?. If I am correct, 5 swabs yielded equal number of isolates. How many isolates were obtained from each positive sample? It is unlikely that you got just one isolate from a sample. If you got more than one isolate, did you compare them phenotypically and genetically and then select non-repetitive isolates?.

As stated in line 346-348, we assured there was at least one sanitation process between sampling collection. In the case cited, the visits were one day apart, nevertheless there was cleaning and disinfection of the areas between sample collection. That is why we suggest the presence of a protective structure like biofilm that allows the microorganism to persist on the surface, even after disinfection. Yes, we had more than one isolate from each swab, but we did not perform the phenotypic and genotypic comparison between them because we had limited financial resources. We selected only one isolate per sample to perform the study.

• Again in L308-309, it is stated that “L. monocytogenes was detected in two samples collected on different days, suggesting the presence of biofilm at the site”. Did you collect samples immediately after sanitization? How do you rule out recontamination after disinfection?

Yes, the collection was made right after sanitization, as soon as the technical manger would allow us to enter the premises. The recontamination after disinfection was ruled out by collecting samples before the beginning of a new work shift. Therefore, nothing and no one would have touched theses surfaces before sample collection.

• L313-314: In Berrang et al. (2010), the source of L. monocytogenes was the raw meat. According to this study, a persistent drain subtype was identical with the raw meat subtype, and this clone was recovered frequently in their sampling. However, in your study, it appears that there is no correlation between the source and the recovery of the clonal isolate from the meat chute.

We did not intend to detect potential sources inside the industries since we did not test meat and poultry samples, only environmental samples, but it could be our next investigation.

• Which pulsotype was isolated frequently from meat chute? . Since you followed CDC protocol, you should be able to compare your PFGE pattern with those in PulseNet database.

The PFGE analysis was conducted in partnership with the Enterobacteriaceae Laboratory / FIOCRUZ, which is the reference lab for enterobacteria in Brazil. Unfortunately, due to circumstances beyond our reach, it was not possible to access Pulsenet in order to compare our pulsotypes with the database, even though that was our initial aim. Instead, we decided to compare them amongst themselves to draw conclusions regarding pulsotype spread inside the industries and/or in the region.

• L440-442: Were L. monocytogenes resistant to chloramphenicol before the ban of the antibiotic? This is important to understand the effect of antibiotic ban on the resistance patterns.

The use of chloramphenicol was banned by the Brazilian Ministry of Agriculture in 2003. Around that time, research on the isolation and characterization of Listeria was rare and there were no reports of detection of chloramphenicol resistance in Listeria monocytogenes in the country. Since there’s a lack of research at the time, we cannot affirm that they were resistant of not before the ban. Nevertheless, we believe that the result of the sensibility is due to the long banishment period.

• You have used 12oC to study biofilm formation. Does this simulate the temperature conditions of your sampling locations?

Yes, this is cited in line 733. We added this information in L699-700 as well.

• Pulsotype 9 and 5 were more frequently isolated and probably the persistent strains as suggested in the manuscript. It is important to know if these pulsotypes exhibited higher biofilm formation compared to others which were not isolated frequently. This will strengthen your hypothesis that the persistence of these pulsotypes is due to their ability to form strong biofilms.

The discussion regarding these results was expanded (L708-722) and a new table was added as well (Table 6, L723).

• The sections on antimicrobial susceptibility and biofilm formation by Salmonella Minnesota can be combined. The study could isolate a single Salmonella and the significance of this finding is very limited.

In order to combine these sections, we would have to alter the whole structure of the results and discussion, that was structured by essay, and not by microorganism. We tried to make this change but the structure became confusing, so we kept the way it was.

• Please avoid claiming “first time” in multiple places in the same manuscript, unless the finding is very significant.

Some of the places with these claims were excluded (L322-324; L363-365).

• Materials and methods: Samples were collected from 3 poultry slaughterhouses and 2 cattle slaughterhouses. Eight visits were conducted in two facilities. If I got it correctly, it would be 8x3 =24 and 8x2-16 (40 in total). And in each visit, samples were collected from installations and the equipment. Were the same locations samples each time? If so, how many swabs from each of these? An illustration would be useful for the readers to understand your sampling strategy.

There were 16 visits in total, eight in poultry slaughterhouses and eight in cattle slaughterhouses. The visits in each poultry slaughterhouse are depicted in Table 1 (Collection 1-8 in the ‘swab collection points’ line). The same locations were sampled each time, but some locations were sampled only once. It was always one swab per collection point. That happened because of restrictions that the industries would pose during visits. This resistance was the main limiting factor for performing this study.

Since the layout for each industry is very different from each other, we could not create an illustration that would help understand the sampling strategy.

• L120: “…Biofilms were characterized..”. Biofilms can be formed on any of the above sampling locations (installations/equipment). Did you look at this possibility? Of did you select a few locations for biofilm bacteria?.

We selected locations based on the available literature and on the structure and sampling availability for each industry. Points that could provide a suitable environment for microorganism adherence were chosen (crevices, corners, etc).

Minor points

• The abstract is too long, and you might consider shortening it.

A few alterations were made to shorten the abstract.

• A Venn diagram can help understand the distribution of pulsotypes from different locations.

A Venn diagram was added (Fig2).

• I have indicated few minor corrections in the manuscript itself.

We appreciate the corrections. They were all accepted.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

25 Oct 2021

Molecular characterization of Salmon​ella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil

PONE-D-21-17398R1

Dear Dr. Agostinho Davanzo,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Iddya Karunasagar

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

All reviewer comments have been addressed.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have modified the manuscript. My concerns have been addressed. I do not have further comments.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

27 Oct 2021

PONE-D-21-17398R1

Molecular characterization of Salmonella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil

Dear Dr. Agostinho Davanzo:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Iddya Karunasagar

Academic Editor

PLOS ONE