Saumil Sethna1, Wadih M Zein2, Sehar Riaz1,3, Arnaud Pj Giese1, Julie M Schultz4, Todd Duncan5, Robert B Hufnagel2, Carmen C Brewer6, Andrew J Griffith6, T Michael Redmond5, Saima Riazuddin1, Thomas B Friedman4, Zubair M Ahmed1,7,8. 1. Department of Otorhinolaryngology - Head & Neck Surgery, University of Maryland School of Medicine, Baltimore, United States. 2. Ophthalmic Genetics and Visual Function Branch, National Eye Institute, National Institutes of Health, Bethesda, United States. 3. National Center of Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan. 4. Laboratory of Molecular Genetics, National Institute of Deafness and Other Communication Disorders, National Institutes of Health, Bethesda, United States. 5. Laboratory of Retinal Cell and Molecular Biology, National Eye Institute, National Institutes of Health, Bethesda, United States. 6. Otolaryngology Branch, National Institute of Deafness and Other Communication Disorders, Bethesda, United States. 7. Departments of Ophthalmology and Visual Sciences, University of Maryland School of Medicine, Baltimore, United States. 8. Departments of Molecular Biology and Biochemistry, University of Maryland School of Medicine, Baltimore, United States.
Abstract
Usher syndrome type I (USH1) is characterized by deafness, vestibular areflexia, and progressive retinal degeneration. The protein-truncating p.Arg245* founder variant of PCDH15 (USH1F) has an ~2% carrier frequency amongst Ashkenazi Jews accounts for ~60% of their USH1 cases. Here, longitudinal phenotyping in 13 USH1F individuals revealed progressive retinal degeneration, leading to severe vision loss with macular atrophy by the sixth decade. Half of the affected individuals were legally blind by their mid-50s. The mouse Pcdh15R250X variant is equivalent to human p.Arg245*. Homozygous Pcdh15R250X mice also have visual deficits and aberrant light-dependent translocation of the phototransduction cascade proteins, arrestin, and transducin. Retinal pigment epithelium (RPE)-specific retinoid cycle proteins, RPE65 and CRALBP, were also reduced in Pcdh15R250X mice, indicating a dual role for protocadherin-15 in photoreceptors and RPE. Exogenous 9-cis retinal improved ERG amplitudes in Pcdh15R250X mice, suggesting a basis for a clinical trial of FDA-approved retinoids to preserve vision in USH1F patients.
Usher syndrome type I (USH1) is characterized by deafness, vestibular areflexia, and progressive retinal degeneration. The protein-truncating p.Arg245* founder variant of PCDH15 (USH1F) has an ~2% carrier frequency amongst Ashkenazi Jews accounts for ~60% of their USH1 cases. Here, longitudinal phenotyping in 13 USH1F individuals revealed progressive retinal degeneration, leading to severe vision loss with macular atrophy by the sixth decade. Half of the affected individuals were legally blind by their mid-50s. The mouse Pcdh15R250X variant is equivalent to human p.Arg245*. Homozygous Pcdh15R250X mice also have visual deficits and aberrant light-dependent translocation of the phototransduction cascade proteins, arrestin, and transducin. Retinal pigment epithelium (RPE)-specific retinoid cycle proteins, RPE65 and CRALBP, were also reduced in Pcdh15R250X mice, indicating a dual role for protocadherin-15 in photoreceptors and RPE. Exogenous 9-cis retinal improved ERG amplitudes in Pcdh15R250X mice, suggesting a basis for a clinical trial of FDA-approved retinoids to preserve vision in USH1F patients.
Usher syndrome (USH) is estimated to be responsible for more than 50% of deaf-blind cases, 8–33% of patients with retinitis pigmentosa (RP), and 3–6% of congenitally deaf individuals (Boughman et al., 1983; Brownstein et al., 2004; Vernon, 1969). Clinical data review studies estimated a prevalence of 3.2–6.2 per 100,000 for USH cases (Boughman and Fishman, 1983; Koenekoop et al., 1993). However, a molecular diagnosis study in children with hearing loss found variants in USH-associated genes in 11% and estimated a frequency of 1/6000 individuals afflicted with USH in the United States (Kimberling et al., 2010). Assuming similar prevalence, this would translate into 255,000–1.34 million USH cases worldwide. However, this estimate varies considerably in specific population substructures. For instance, the p.Arg245* founder variant of PCDH15 (USH1F) has an ~2% carrier frequency amongst Ashkenazi Jews accounts for nearly 60% of their Usher syndrome type I (USH1) cases (Ben-Yosef et al., 2003). Thus, we speculate that a comprehensive understanding of the pathophysiology and disease mechanisms is a prelude for developing therapeutic interventions for USH after clinical trials.Loss of vision in individuals with USH1, an autosomal recessive disorder, begins towards the end of their first decade of life due to RP, eventually leading to near total blindness. Night blindness is an early sign in USH1 subjects followed by constriction of the visual field (tunnel vision) and finally clinical blindness (Vernon, 1969). Characteristic fundus features include pigmentary retinopathy, narrowing of the retinal vessels, and a pale appearance of the optic disk (Toms et al., 2020). Vestibular dysfunction in USH1 manifests as a delay in development of independent ambulation while hearing loss is usually severe to profound, congenital, and sensorineural (Ahmed et al., 2003b; Smith et al., 1994). Cochlear implants can restore auditory perception in USH1 patients (Brownstein et al., 2004; Pennings et al., 2006), but presently there is no effective treatment for vision loss due to RP. Moreover, there is a lack of longitudinal data for the natural history of ocular abnormalities associated with variants of PCDH15 in humans. Only anecdotal clinical data has been reported thus far (Ahmed et al., 2001; Ben-Yosef et al., 2003; Brownstein et al., 2004; Jacobson et al., 2008). Here, we describe the natural history of retinopathy in 13 individuals followed for up to 30 years with an Ashkenazi Jewish recessive founder variant of PCDH15. Eleven patients from nine families were homozygous for the p.Arg245*, leading to truncation of the encoded protein, protocadherin-15. Two additional patients had compound heterozygous genotypes that included one p.Arg245* allele.Protocadherin-15 is a member of a large cadherin superfamily of calcium-dependent cell–cell adhesion molecules (Ahmed et al., 2001; van Roy, 2014). Within the vertebrate inner ear, protocadherin-15 is required for the structural maintenance and the mechanotransduction function of the sensory hair cells (Ahmed et al., 2006; Kazmierczak et al., 2007). In the retina, protocadherin-15 is localized to the outer limiting membrane of photoreceptors (PRs) and in Müller glia (Reiners et al., 2005b; van Wijk et al., 2006). We previously reported a reduction of electroretinogram (ERG) a- and b-waves amplitudes (~40%) at 5 weeks of age in at least two Pcdh15 alleles in mice (Pcdh15) (Haywood-Watson et al., 2006). However, the exact molecular function of protocadherin-15 in the retina remains elusive. Here, we describe the pathophysiology and function of protocadherin-15 in the retina of a novel murine model. Finally, ERG data show significant improvement after treatment of this USH mouse model with 9-cis retinal, raising the possibility that exogenous retinoids could preserve vision in USH1F patients.
Results and discussion
Spectrum and longitudinal ocular phenotypic data revealed early onset rod-cone dystrophy in USH1 subjects
We reviewed the medical records of 13 patients enrolled in an Institutional Review Board-approved protocol to study USH. Subsequent to congenital profound deafness, the first reported symptom was difficulty with vision at night. Ophthalmic manifestations depended on the age of the patient and the stage of retinal degeneration (Table 1). Electroretinography (ERG) recordings were at noise-level for both scotopic and photopic responses, suggesting dysfunctional PRs (Figure 1—figure supplement 1). In young patients with early stages of the retinal degeneration, findings included mottling of the retinal pigment epithelium (RPE) with early pigment redistribution, and mild to moderate vascular attenuation with typically preserved macular reflexes (Figure 1a). As RP progressed, more extensive pigment abnormalities were observed with deposition of bone spicules, severe attenuation of the retinal vasculature, macular atrophic changes, and waxy pallor of the optic nerve head (Figure 1b). In advanced stages, these changes became more prominent and widely distributed throughout the fundus (Figure 1c, Figure 1—figure supplement 1). Cataracts were common, especially posterior subcapsular opacities. The panels in Figure 1d show the progression of macular atrophic changes over a 12-year period in a patient with compound heterozygous p.Arg245*/p.Arg929* variants. Both of these alleles of PCDH15 are predicted to cause truncation of the protocadherin-15 protein. Kinetic visual field testing (Table 1) showed early loss of the ability to detect the smaller and dimmer target (I1e) in all but one patient (LMG268 #1722 at age 37 years). Early midperipheral scotomas and severe constriction were noted while testing the I4e isopter (target is equal in size to I1e but brighter). Progressive constriction of the V4e visual field isopter (largest and brightest target) is seen in Figure 1e where the horizontal diameter is binned by the decade of life. Figure 1f shows an increase in logMAR visual acuity, corresponding to a decline in Snellen best-corrected visual acuity (BCVA), starting at the fourth decade of life. Kaplan-Meier survival curves (Figure 1g) with parameters corresponding to legal blindness (acuity at 20/200 and visual field limited to 20°) demonstrate severe visual function loss by the fifth decade.
Table 1.
Ophthalmic clinical manifestations of patients with biallelic PCDH15 mutations.
Eleven patients in this study are homozygous for the p.Arg245* variants while two siblings carry compound heterozygous variants, ¥p.Arg245*/p.Arg929*. Visual acuity assessments consistently show a decline between the third and fourth decade of life. Visual field loss in these subjects, shown in Table 1, further support severe retinitis pigmentosa. Macular atrophy and PSC cataract appear early and may contribute to the observed reduction in visual acuity. Optic nerve head pallor is also frequent and advanced. Normal Goldmann Visual Field Perimetry horizontal diameters are in the range of: V4e—150–160°, I4e—130–140°, and I1e—20–30°. BCVA: Best-Corrected Visual Acuity, OD: right eye, OS: left eye, HM: Hand Motion visual acuity, LP: Light Perception, HVF: Humphrey Visual Field, PSC: Posterior Subcapsular Cataract, NS: Nuclear Sclerosis Cataract, IOL: Intraocular lens, CME: Cystoid Macular Edema, ERM: Epiretinal Membrane, RPE: Retinal Pigment Epithelium, ONH: Optic Nerve Head, ND: Not Done, N/A: Not Available.
Age (years)
BCVA OD; OS
Visual field OD
Visual field OS
Lens
Macula
Spicules/mottling
Optic nerve
LMG210 #1563
12
20/25; 20/30
90, ND, ND
90, ND, ND
Clear
Normal
N/A
N/A
22
20/40; 20/50
30, 0, 0
28, 0, 0
Mild PSC
Pigment
Spicules
Pale
35
HM; HM
20, 0, 0
15, 0, 0
PSC
Atrophy
Spicules
Pale +3
LMG279 #1795
19
20/25; 20/32
50, 15, 0
65, 18, 0
PSC
Normal
Spicules
Pale
LMG268 #1722
37
20/30; 20/30
23, 14, 10
20, 12, 10
PSC
Normal
Spicules
Pale
50
20/160; 20/50
12, 1, 0
15, 2, 0
PSC
Atrophy OD
Spicules
Pale
59
LP; 20/500
0, 0, 0
6, 0, 0
PSC+NS
Atrophy
Spicules
Pale
67
LP; HM
ND
ND
PSC+NS OD;
Atrophy
Spicules
Pale
IOL OS
LMG178 #1463
25
20/100; 20/30
ND
ND
Mild PSC
CME
Spicules
ONH swelling
26
20/50; 20/40
30, 8, 0
35, 25, 0
Mild PSC
CME
Spicules
Resolved swelling
LMG200 #1539
8
20/30; 20/30
ND
ND
N/A
N/A
N/A
N/A
25
20/50; 20/40
40, 0, 0
40, 0, 0
Clear
Atrophy
Spicules
Pale+1
LMG200 #1538
6
20/40; 20/30
ND
ND
N/A
N/A
N/A
N/A
22
20/100; 20/60
6, 0, 0
9, 0, 0
Clear
Atrophy
Spicules
Pale+1
LMG186 #1484
21
20/30; 20/40
HVF
HVF
Mild PSC
Normal
Spicules
Pale
Diameter 5°
Diameter 10°
LMG407 #2149
55
20/400; 20/300
3, 0, 0
5, 0, 0
IOL OU
Atrophy
Spicules
Pale +3
LMG322 #1917
22
20/60; 20/30
140, 30, 0
145, 30, 0
Clear
CME
Spicules
Normal
LMG322 #1916
11
20/25; 20/25
110, 35, 0
110, 30, 0
Clear
Normal
Spicules
Normal
16
20/25; 20/25
110, 35, 0
110, 30, 0
Clear
Normal
Spicules
Normal
LMG125 #1221
12
20/30; 20/30
ND
ND
Clear
CME, ERM
Spicules
Pale
LMG197 #1831¥
30
20/50, 20/50
80, 7, 0
100, 10, 0
PSC
Normal
Spicules
Pale +1
38
20/60, 20/60
40, 0, 0
60, 4, 0
PSC
Atrophy
Spicules
Pale +2
50
20/160, 20/100
15, 0, 0
22, 0, 0
PSC
Atrophy
Spicules
Pale +3
LMG197 #1839¥
27
20/60, 20/125
140, 15, 0
140, 15, 0
Clear
ERM
RPE atrophy
Pale +1
37
20/125, 20/250
65, 13, 0
55, 10, 0
Clear
ERM
Spicules
Pale +3
52
20/250, 20/250
35, 12, 0
30, 4, 0
PSC +1
Atrophy
Spicules
Pale +3
Figure 1—figure supplement 1.
Fundus autofluorescence, optical coherence tomography (OCT), and electroretinography in compound heterozygous patient LMG197 #1831.
(a–c) Left eye fundus autofluorescence in (c) shows a central area, delineated by white arrowheads, of complete loss of autofluorescence consistent with RPE atrophy (compare with normal fundus autofluorescence in a). The images were obtained at the most recent patient visit (age 50 years). (d). Left eye OCT, also obtained at 50 years of age, shows the corresponding macular area with complete RPE and outer retinal atrophy as indicated by homogenous choroidal hypertransmission (white arrowheads) and absence of RPE band (in addition to significant macular thinning and loss of photoreceptors). Contrast with normal OCT anatomy presented in panel (b). (e) Electroretinography from the same patient at 38 years of age with noise level (extinguished) responses in both eyes. Median and 95% confidence interval for amplitude and implicit time indicated by the gray bars and orange line for the median. An example of normal waveform tracing is also shown. RPE, retinal pigment epithelium.
Figure 1.
USH1F p.Arg245* spectrum and longitudinal eye phenotype.
(a–c) Fundus images depicting the spectrum of retinal findings in p.Arg245* USH1F patients, show mottling of pigment epithelium, attenuation of retinal vasculature, and pallor of optic nerve head seen in all three fundus photos. Peripheral bony spicules and macular atrophy are noted (b). Diffuse atrophy and advanced retinal degeneration are seen in (c). (d) Longitudinal progression of macular atrophic changes (arrowheads point at edge of macular atrophic area) over a 12-year period in a USH1F patient who is compound heterozygous for p.Arg245*/p.Arg929*. (e) Mean and SEM of Goldmann visual field diameters for patients with data binned by decade of life. (f) Mean and SEM of best-corrected visual acuity binned by decade of life for all patient visits. (g) Survival analysis curves for visual acuity (logMAR visual acuity>1, i.e., acuity worse than 20/200) and visual field (visual field <20° in better eye). These values were chosen since they usually denote visual function at legal blindness levels. SEM, standard error of the mean. The online version of this article includes source data and the following figure supplement(s) for Figure 1.
(a–c) Left eye fundus autofluorescence in (c) shows a central area, delineated by white arrowheads, of complete loss of autofluorescence consistent with RPE atrophy (compare with normal fundus autofluorescence in a). The images were obtained at the most recent patient visit (age 50 years). (d). Left eye OCT, also obtained at 50 years of age, shows the corresponding macular area with complete RPE and outer retinal atrophy as indicated by homogenous choroidal hypertransmission (white arrowheads) and absence of RPE band (in addition to significant macular thinning and loss of photoreceptors). Contrast with normal OCT anatomy presented in panel (b). (e) Electroretinography from the same patient at 38 years of age with noise level (extinguished) responses in both eyes. Median and 95% confidence interval for amplitude and implicit time indicated by the gray bars and orange line for the median. An example of normal waveform tracing is also shown. RPE, retinal pigment epithelium.
Ophthalmic clinical manifestations of patients with biallelic PCDH15 mutations.
Eleven patients in this study are homozygous for the p.Arg245* variants while two siblings carry compound heterozygous variants, ¥p.Arg245*/p.Arg929*. Visual acuity assessments consistently show a decline between the third and fourth decade of life. Visual field loss in these subjects, shown in Table 1, further support severe retinitis pigmentosa. Macular atrophy and PSC cataract appear early and may contribute to the observed reduction in visual acuity. Optic nerve head pallor is also frequent and advanced. Normal Goldmann Visual Field Perimetry horizontal diameters are in the range of: V4e—150–160°, I4e—130–140°, and I1e—20–30°. BCVA: Best-Corrected Visual Acuity, OD: right eye, OS: left eye, HM: Hand Motion visual acuity, LP: Light Perception, HVF: Humphrey Visual Field, PSC: Posterior Subcapsular Cataract, NS: Nuclear Sclerosis Cataract, IOL: Intraocular lens, CME: Cystoid Macular Edema, ERM: Epiretinal Membrane, RPE: Retinal Pigment Epithelium, ONH: Optic Nerve Head, ND: Not Done, N/A: Not Available.
USH1F p.Arg245* spectrum and longitudinal eye phenotype.
(a–c) Fundus images depicting the spectrum of retinal findings in p.Arg245* USH1F patients, show mottling of pigment epithelium, attenuation of retinal vasculature, and pallor of optic nerve head seen in all three fundus photos. Peripheral bony spicules and macular atrophy are noted (b). Diffuse atrophy and advanced retinal degeneration are seen in (c). (d) Longitudinal progression of macular atrophic changes (arrowheads point at edge of macular atrophic area) over a 12-year period in a USH1F patient who is compound heterozygous for p.Arg245*/p.Arg929*. (e) Mean and SEM of Goldmann visual field diameters for patients with data binned by decade of life. (f) Mean and SEM of best-corrected visual acuity binned by decade of life for all patient visits. (g) Survival analysis curves for visual acuity (logMAR visual acuity>1, i.e., acuity worse than 20/200) and visual field (visual field <20° in better eye). These values were chosen since they usually denote visual function at legal blindness levels. SEM, standard error of the mean. The online version of this article includes source data and the following figure supplement(s) for Figure 1.
Fundus autofluorescence, optical coherence tomography (OCT), and electroretinography in compound heterozygous patient LMG197 #1831.
(a–c) Left eye fundus autofluorescence in (c) shows a central area, delineated by white arrowheads, of complete loss of autofluorescence consistent with RPE atrophy (compare with normal fundus autofluorescence in a). The images were obtained at the most recent patient visit (age 50 years). (d). Left eye OCT, also obtained at 50 years of age, shows the corresponding macular area with complete RPE and outer retinal atrophy as indicated by homogenous choroidal hypertransmission (white arrowheads) and absence of RPE band (in addition to significant macular thinning and loss of photoreceptors). Contrast with normal OCT anatomy presented in panel (b). (e) Electroretinography from the same patient at 38 years of age with noise level (extinguished) responses in both eyes. Median and 95% confidence interval for amplitude and implicit time indicated by the gray bars and orange line for the median. An example of normal waveform tracing is also shown. RPE, retinal pigment epithelium.
Pcdh15 knockin mutant recapitulates human p.Arg245* Usher phenotype
In order to investigate the precise role of protocadherin-15 in light transduction and the mechanism of visual deficits observed in patients homozygous or compound heterozygous for the recessive Arg245* pathogenic variant of PCDH15, we used CRISPR/Cas9 technology to engineer a mouse model with the Pcdh15 variant (Materials and methods) (Cong et al., 2013). Immunostaining showed that protocadherin-15 is localized to the inner segments of the PR, the outer plexiform layer, and the ganglion cell layer as reported previously (Garwin et al., 2000). However, the RPE was not assessed for the localization of protocadherin in those studies. Using immunohistochemistry, here we show that protocadherin-15 is also expressed in the RPE (Figure 2—figure supplement 1). The p.Arg250* variant is located in exon 9 common to all Pcdh15 transcripts and, consequently, is predicted to cause a complete loss of all known protocadherin-15 isoforms (Ahmed et al., 2006). Indeed, with immunostaining, we could not detect protocadherin-15 expression in retinal tissue (Figure 2—figure supplement 1a-b) or cochlear tissue (Figure 2—figure supplement 1c) from Pcdh15 mutant mice.
Figure 2—figure supplement 1.
Validation of loss of protocadherin-15 in the retina and cochlea of Pcdh15 mutant mice.
(a) Confocal micrographs of P97 mouse retinae from control and Pcdh15 mutants immunostained for protocadherin-15 (PCDH15, cyan, left panel) and opsin to label outer segments (OS, magenta, center panel) shows robust protocadherin 15 localized to the inner segments (IS), outer plexiform layer (OPL), and ganglion cell layer (GCL). Notably, protocadherin-15 immunoreactivity is absent in Pcdh15 mutant mice. (b) Zoomed-in image of the OS/ IS interface. DAPI to visualize nuclei in gray. (c) Confocal micrographs of P60 organ of Corti of indicated genotype immunostained with protocadherin-15 (PCDH15) antibody HL5614 (green) and counterstained with phalloidin (red) confirm the loss of protocadherin-15 in Pcdh15R250X mice. Scale bar: 10 μm. INL, inner nuclear layer; IPL, inner plexiform layer.
Consistent with previously published Pcdh15 mouse models (Alagramam et al., 2011; Garwin et al., 2000; Senften et al., 2006), we detected no auditory-evoked brainstem responses (ABRs) in mutant Pcdh15 mice at P16, the earliest postnatal day that ABRs can be reliably detected (Figure 2—figure supplement 2a), indicating that they were profoundly deaf. Furthermore, Pcdh15 mutant mice displayed abnormal motor vestibular behaviors such as circling, hyperactivity, and head bobbing. Behavioral tests including exploratory behavior and tail-hanging tests confirmed that these deaf mice also have a significant vestibular dysfunction (Figure 2—figure supplement 2b, c). Finally the Pcdh15 mutant cochlear and vestibular hair cells also had no functional mechanotransduction (Figure 2—figure supplement 2d), accounting for deafness, and at P60 also showed degeneration of hair cells in the organ of Corti (Figure 2—figure supplement 3). Taken together, our data indicate that the Pcdh15 mutants recapitulate human p.Arg245* deafness and peripheral vestibular areflexia.
Figure 2—figure supplement 2.
Pcdh15 mutant mice have profound hearing loss and severe vestibular system dysfunction.
(a) Average thresholds of acoustic brainstem response (ABR) to broadband clicks and tone-pips with frequencies of 8 kHz, 16 kHz, and 32 kHz in control (Pcdh15; black) and mutant (Pcdh15; red) mice at P16–P30 (n=4/genotype), revealed no detectable hearing in Pcdh15 mutants. (b) Representative open‐field exploratory behavior of a 2-month-old mouse for denoted genotypes shows increased circling behavior in mutant mice (left panels), quantified in right panel. (n=3/genotype). (c) Average score of tail-suspension test in control and mutants at P16-30, further confirms vestibular areflexia in Pcdh15 mutant mice. (n=4/genotype). Data are shown as mean ± SEM. (***, p<0.001) using Student’s unpaired t-test. (d) Epifluorescence micrographs and corresponding DIC micrographs of control and Pcdh15 cultured organ of Corti and vestibular explants imaged after exposure to 3 µM of FM1–43, a channel permeable dye, for 10 s, revealed impaired mechanotransduction function in Pcdh15 mutant mice. The samples were dissected at P0 and kept for 2 days in vitro (P0+2 DIV). Scale bar: 20 µm.
Figure 2—figure supplement 3.
Pcdh15 mutant mice have degeneration of sensory hair cells in the organ of Corti (a, b).
Confocal micrographs of P60 organ of Corti (a) and vestibular end organs (b) of control (Pcdh15) and mutant (Pcdh15) mice immunostained with myosin VIIa antibody (green) and counterstained with phalloidin (red) and DAPI (blue), revealed degeneration of sensory hair cells. Medial and basal turns of the cochlea and utricle are shown. Scale bar: 10 μm.
To parallel the visual examinations performed in patients, we assessed the visual function of Pcdh15 mutant mice using full-field ERG. Dark-adapted (scotopic) ERG waves, which are preferentially driven by rod PRs at low light intensity and by rod and cone PRs at high light intensity, showed normal wave architecture albeit with reduced amplitudes (Figure 2—figure supplement 4a). Quantification showed significant reduction in amplitudes of the a-wave derived primarily from the PR layer and the b-wave derived from Müller glia and bipolar neurons in 1-month-old Pcdh15 mutant mice as compared to littermate control mice (Figure 2a). Similarly, photopic ERG amplitudes, primarily representing cone-mediated function, were also reduced in 1-month-old Pcdh15 mutant mice (Figure 2b). The b- to a-wave ratio (b/a) was similar across genotypes indicating that deficits were manifested mainly at the PR level (Figure 2—figure supplement 4b). We then performed ERGs at 2–3, 6–7, and 12–14 months of age. Pcdh15 mutant mice consistently had lower scotopic and photopic ERG amplitudes compared to controls (Figure 2c–h), indicating that the functional deficits observed at 1 month were not due to delayed development. Further, to assess the visual cycle dysfunction and dark adaptation, we assessed the recovery of a-wave amplitude following bleaching of more than 90% of rhodopsin (Kolesnikov et al., 2020). We observed equivalent recovery of a-wave irrespective of genotype (Figure 2—figure supplement 4c), but we did observe that initial single flash a-wave amplitude was lower in mutant mice (Figure 2—figure supplement 4d), which suggests functional alterations in phototransduction such as are indicated by aberrant light-dependent translocation of arrestin and transducin (see details below). To correlate functional deficits with the structural integrity of the retina, we performed non-invasive in vivo retinal imaging using optical coherence tomography (OCT) in young (1–2 months) and old (12–14 months) mice, which showed no gross structural abnormality in homozygous Pcdh15 mutants (Figure 2i). However, we did note a small but significant decrease in the outer nuclear layer (ONL) thickness in 12–14 months old mutant mice (Figure 2j).
Figure 2—figure supplement 4.
Loss of protocadherin-15 leads to retinal dysfunction in Pcdh15 mutant mice.
(a) Representative ERG waveforms from 1-month-old mice of the denoted genotypes show normal wave architecture with significantly reduced waveforms for mutant mice. (b) b/a ratio shows the mutant mice have a ratio comparable to control mice. (c) Recovery of scotopic ERG maximal a-wave amplitudes (a-wave ratio; mean ± SEM) after strong bleaching (estimated>90%) of rhodopsin in overnight dark-adapted control (Pcdh15) and mutant (Pcdh15) mice. Bleaching was achieved by a 45 s illumination with bright white light at time 0. (d) Quantification of single flash pre-bleach a-wave amplitudes from the same mice as shown in (c). Although the recovery of a-wave amplitude (ratio of pre-bleach to post-bleach) in both control and mutant was similar, the initial single flash a-waves were significantly reduced in mutant mice. ERG, electroretinography.
Figure 2.
Loss of protocadherin-15 leads to visual dysfunction over a period of 1 year.
(a) Quantification of scotopic (dark adapted) responses from littermate control (Pcdh15 or Pcdh15) and mutant (Pcdh15) mice at 1 month of age revealed progressive loss of both a- (left panels) and b-wave (right panels) amplitudes in mutant mice. Representative ERG waveforms are shown in Extended data Figure 3b. (b) Quantification of photopic (light adapted) b-wave indicates decline of cone photoreceptor function in mutant mice. (c–h) Quantification of scotopic ERG amplitudes (c, e, g) and photopic ERG amplitudes (d, f, h) at indicated ages shows sustained decline in amplitudes over time in Pcdh15 mutant mice. (i) Representative OCT images from mice of denoted genotype, shows no gross retinal degeneration in young (1–2 months, top panels) or old (12–14 months, bottom panels) mice. (j) Quantification of outer nuclear layer (ONL) of images showed in (i), shows mild loss of ONL in aged mutant mice. Data presented as mean ± SEM. Each data point represents an individual mouse. Data presented as mean ± SEM. Student’s unpaired t-test, p<0.05 (*), p<0.01 (**). The online version of this article includes source data and the following figure supplement(s) for Figure 2.
(a) Confocal micrographs of P97 mouse retinae from control and Pcdh15 mutants immunostained for protocadherin-15 (PCDH15, cyan, left panel) and opsin to label outer segments (OS, magenta, center panel) shows robust protocadherin 15 localized to the inner segments (IS), outer plexiform layer (OPL), and ganglion cell layer (GCL). Notably, protocadherin-15 immunoreactivity is absent in Pcdh15 mutant mice. (b) Zoomed-in image of the OS/ IS interface. DAPI to visualize nuclei in gray. (c) Confocal micrographs of P60 organ of Corti of indicated genotype immunostained with protocadherin-15 (PCDH15) antibody HL5614 (green) and counterstained with phalloidin (red) confirm the loss of protocadherin-15 in Pcdh15R250X mice. Scale bar: 10 μm. INL, inner nuclear layer; IPL, inner plexiform layer.
(a) Average thresholds of acoustic brainstem response (ABR) to broadband clicks and tone-pips with frequencies of 8 kHz, 16 kHz, and 32 kHz in control (Pcdh15; black) and mutant (Pcdh15; red) mice at P16–P30 (n=4/genotype), revealed no detectable hearing in Pcdh15 mutants. (b) Representative open‐field exploratory behavior of a 2-month-old mouse for denoted genotypes shows increased circling behavior in mutant mice (left panels), quantified in right panel. (n=3/genotype). (c) Average score of tail-suspension test in control and mutants at P16-30, further confirms vestibular areflexia in Pcdh15 mutant mice. (n=4/genotype). Data are shown as mean ± SEM. (***, p<0.001) using Student’s unpaired t-test. (d) Epifluorescence micrographs and corresponding DIC micrographs of control and Pcdh15 cultured organ of Corti and vestibular explants imaged after exposure to 3 µM of FM1–43, a channel permeable dye, for 10 s, revealed impaired mechanotransduction function in Pcdh15 mutant mice. The samples were dissected at P0 and kept for 2 days in vitro (P0+2 DIV). Scale bar: 20 µm.
Confocal micrographs of P60 organ of Corti (a) and vestibular end organs (b) of control (Pcdh15) and mutant (Pcdh15) mice immunostained with myosin VIIa antibody (green) and counterstained with phalloidin (red) and DAPI (blue), revealed degeneration of sensory hair cells. Medial and basal turns of the cochlea and utricle are shown. Scale bar: 10 μm.
(a) Representative ERG waveforms from 1-month-old mice of the denoted genotypes show normal wave architecture with significantly reduced waveforms for mutant mice. (b) b/a ratio shows the mutant mice have a ratio comparable to control mice. (c) Recovery of scotopic ERG maximal a-wave amplitudes (a-wave ratio; mean ± SEM) after strong bleaching (estimated>90%) of rhodopsin in overnight dark-adapted control (Pcdh15) and mutant (Pcdh15) mice. Bleaching was achieved by a 45 s illumination with bright white light at time 0. (d) Quantification of single flash pre-bleach a-wave amplitudes from the same mice as shown in (c). Although the recovery of a-wave amplitude (ratio of pre-bleach to post-bleach) in both control and mutant was similar, the initial single flash a-waves were significantly reduced in mutant mice. ERG, electroretinography.
Loss of protocadherin-15 leads to visual dysfunction over a period of 1 year.
(a) Quantification of scotopic (dark adapted) responses from littermate control (Pcdh15 or Pcdh15) and mutant (Pcdh15) mice at 1 month of age revealed progressive loss of both a- (left panels) and b-wave (right panels) amplitudes in mutant mice. Representative ERG waveforms are shown in Extended data Figure 3b. (b) Quantification of photopic (light adapted) b-wave indicates decline of cone photoreceptor function in mutant mice. (c–h) Quantification of scotopic ERG amplitudes (c, e, g) and photopic ERG amplitudes (d, f, h) at indicated ages shows sustained decline in amplitudes over time in Pcdh15 mutant mice. (i) Representative OCT images from mice of denoted genotype, shows no gross retinal degeneration in young (1–2 months, top panels) or old (12–14 months, bottom panels) mice. (j) Quantification of outer nuclear layer (ONL) of images showed in (i), shows mild loss of ONL in aged mutant mice. Data presented as mean ± SEM. Each data point represents an individual mouse. Data presented as mean ± SEM. Student’s unpaired t-test, p<0.05 (*), p<0.01 (**). The online version of this article includes source data and the following figure supplement(s) for Figure 2.
Figure 3.
Loss of protocadherin-15 leads to aberrant localization of key proteins involved in the phototransduction cascade and retinoid cycle.
(a) Representative confocal micrographs of light-adapted retinae show mislocalization of phototransduction cascade proteins, arrestin, and transducin, to both the inner segment (IS) and outer segment (OS) in mutant mice (right panels). In control mice, transducin is correctly localized to the IS and arrestin is to the OS (left panels). A schematic of the localization of arrestin and transducin in control and mutant mice is also shown. Scale bar: 20 µm. (b, c) Immunoblot of proteins involved in the visual retinoid cycle shows reduced quantities of RPE65 and CRALBP but not IRBP, quantified in (c). (d) Quantification of indicated retinoid species from control and mutant mice shows reduced quantities of 11-cis retinal oxime. Data presented as mean ± SEM. Each data point represents an individual mouse. Student’s unpaired t-test, p<0.05 (*), p<0.01 (**). The online version of this article includes source data and the following figure supplement(s) for Figure 3. ONL, outer nuclear layer; OPL, outer plexiform layer.
(a) Representative confocal micrographs of dark-adapted retinae show the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS), and arrestin to the inner segment (IS), in both control and mutant mice. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. (b) Dark-adapted (top panels) and light-adapted (bottom panels) localization of opsin is not affected by loss of protocadherin-15. Schematic of the localization of opsin in control and mutant mice is also shown. Scale bar: 20 µm. (c–e) Quantification of denoted proteins in the IS or OS for panels in (a, b) and Figure 3a shows mislocalization of transducin to the OS and arrestin to the IS in mutant mice. Student’s unpaired t-test, p<0.05 (*), p<0.001 (***). NS. not significant; ONL, outer nuclear layer, OPL, outer plexiform layer.
Transmission electron micrographs of 1–2-month-old mice of denoted genotype show normal RPE with no obvious structural abnormalities, irrespective of genotype. Scale bar: 2 µm. Data presented as mean ± SEM. Each data point represents an individual mouse. Student’s unpaired t-test, p<0.01 (**).
Validation of loss of protocadherin-15 in the retina and cochlea of Pcdh15 mutant mice.
(a) Confocal micrographs of P97 mouse retinae from control and Pcdh15 mutants immunostained for protocadherin-15 (PCDH15, cyan, left panel) and opsin to label outer segments (OS, magenta, center panel) shows robust protocadherin 15 localized to the inner segments (IS), outer plexiform layer (OPL), and ganglion cell layer (GCL). Notably, protocadherin-15 immunoreactivity is absent in Pcdh15 mutant mice. (b) Zoomed-in image of the OS/ IS interface. DAPI to visualize nuclei in gray. (c) Confocal micrographs of P60 organ of Corti of indicated genotype immunostained with protocadherin-15 (PCDH15) antibody HL5614 (green) and counterstained with phalloidin (red) confirm the loss of protocadherin-15 in Pcdh15R250X mice. Scale bar: 10 μm. INL, inner nuclear layer; IPL, inner plexiform layer.
Pcdh15 mutant mice have profound hearing loss and severe vestibular system dysfunction.
(a) Average thresholds of acoustic brainstem response (ABR) to broadband clicks and tone-pips with frequencies of 8 kHz, 16 kHz, and 32 kHz in control (Pcdh15; black) and mutant (Pcdh15; red) mice at P16–P30 (n=4/genotype), revealed no detectable hearing in Pcdh15 mutants. (b) Representative open‐field exploratory behavior of a 2-month-old mouse for denoted genotypes shows increased circling behavior in mutant mice (left panels), quantified in right panel. (n=3/genotype). (c) Average score of tail-suspension test in control and mutants at P16-30, further confirms vestibular areflexia in Pcdh15 mutant mice. (n=4/genotype). Data are shown as mean ± SEM. (***, p<0.001) using Student’s unpaired t-test. (d) Epifluorescence micrographs and corresponding DIC micrographs of control and Pcdh15 cultured organ of Corti and vestibular explants imaged after exposure to 3 µM of FM1–43, a channel permeable dye, for 10 s, revealed impaired mechanotransduction function in Pcdh15 mutant mice. The samples were dissected at P0 and kept for 2 days in vitro (P0+2 DIV). Scale bar: 20 µm.
Pcdh15 mutant mice have degeneration of sensory hair cells in the organ of Corti (a, b).
Confocal micrographs of P60 organ of Corti (a) and vestibular end organs (b) of control (Pcdh15) and mutant (Pcdh15) mice immunostained with myosin VIIa antibody (green) and counterstained with phalloidin (red) and DAPI (blue), revealed degeneration of sensory hair cells. Medial and basal turns of the cochlea and utricle are shown. Scale bar: 10 μm.
Loss of protocadherin-15 leads to retinal dysfunction in Pcdh15 mutant mice.
(a) Representative ERG waveforms from 1-month-old mice of the denoted genotypes show normal wave architecture with significantly reduced waveforms for mutant mice. (b) b/a ratio shows the mutant mice have a ratio comparable to control mice. (c) Recovery of scotopic ERG maximal a-wave amplitudes (a-wave ratio; mean ± SEM) after strong bleaching (estimated>90%) of rhodopsin in overnight dark-adapted control (Pcdh15) and mutant (Pcdh15) mice. Bleaching was achieved by a 45 s illumination with bright white light at time 0. (d) Quantification of single flash pre-bleach a-wave amplitudes from the same mice as shown in (c). Although the recovery of a-wave amplitude (ratio of pre-bleach to post-bleach) in both control and mutant was similar, the initial single flash a-waves were significantly reduced in mutant mice. ERG, electroretinography.
Mechanisms contributing to ERG defects due to protocadherin absence
We hypothesized that the functional deficits, reflected by abnormal ERG findings, without structural impairment of the retina might result from deficits in the phototransduction cascade or the visual retinoid cycle. The phototransduction cascade mediates the transduction of light into neuronal signals, while the visual retinoid cycle regenerates a key chromophore, 11-cis retinal. The rod outer segments (OS) are exquisitely adapted for light transduction. Phototransduction proteins are generated in the PR cell body and delivered to the OS via the inner segment (IS) and connecting cilium. Under photopic conditions (daylight), arrestin translocates from IS of the PRs to the OS, to desensitize the opsin. Conversely, transducin translocates from OS to IS of the photoreceptors allowing arrestin to bind to opsin (Arshavsky et al., 2002; Burns and Baylor, 2001). We found significant mislocalization of both arrestin and transducin to the PR IS and OS in Pcdh15 mutant mice under light-adapted conditions, whereas transducin was correctly localized only to the IS and arrestin only to the OS in control mouse retinae (Figure 3a, Figure 3—figure supplement 1). In dark-adapted conditions, arrestin was correctly localized to the IS and transducin to the OS in both mutant and control mice (Figure 3—figure supplement 1a, c-d). Finally, opsin was correctly localized only in the OS under both dark- and light-adapted conditions (Figure 3—figure supplement 1b, e), indicating that protocadherin-15 is essential for rapid shuttling of proteins from IS to OS and vice-versa in response to adaptation to light.
Figure 3—figure supplement 1.
Loss of protocadherin-15 does not affect dark-adapted localization of key phototransduction cascade proteins.
(a) Representative confocal micrographs of dark-adapted retinae show the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS), and arrestin to the inner segment (IS), in both control and mutant mice. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. (b) Dark-adapted (top panels) and light-adapted (bottom panels) localization of opsin is not affected by loss of protocadherin-15. Schematic of the localization of opsin in control and mutant mice is also shown. Scale bar: 20 µm. (c–e) Quantification of denoted proteins in the IS or OS for panels in (a, b) and Figure 3a shows mislocalization of transducin to the OS and arrestin to the IS in mutant mice. Student’s unpaired t-test, p<0.05 (*), p<0.001 (***). NS. not significant; ONL, outer nuclear layer, OPL, outer plexiform layer.
Loss of protocadherin-15 leads to aberrant localization of key proteins involved in the phototransduction cascade and retinoid cycle.
(a) Representative confocal micrographs of light-adapted retinae show mislocalization of phototransduction cascade proteins, arrestin, and transducin, to both the inner segment (IS) and outer segment (OS) in mutant mice (right panels). In control mice, transducin is correctly localized to the IS and arrestin is to the OS (left panels). A schematic of the localization of arrestin and transducin in control and mutant mice is also shown. Scale bar: 20 µm. (b, c) Immunoblot of proteins involved in the visual retinoid cycle shows reduced quantities of RPE65 and CRALBP but not IRBP, quantified in (c). (d) Quantification of indicated retinoid species from control and mutant mice shows reduced quantities of 11-cis retinal oxime. Data presented as mean ± SEM. Each data point represents an individual mouse. Student’s unpaired t-test, p<0.05 (*), p<0.01 (**). The online version of this article includes source data and the following figure supplement(s) for Figure 3. ONL, outer nuclear layer; OPL, outer plexiform layer.
Loss of protocadherin-15 does not affect dark-adapted localization of key phototransduction cascade proteins.
(a) Representative confocal micrographs of dark-adapted retinae show the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS), and arrestin to the inner segment (IS), in both control and mutant mice. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. (b) Dark-adapted (top panels) and light-adapted (bottom panels) localization of opsin is not affected by loss of protocadherin-15. Schematic of the localization of opsin in control and mutant mice is also shown. Scale bar: 20 µm. (c–e) Quantification of denoted proteins in the IS or OS for panels in (a, b) and Figure 3a shows mislocalization of transducin to the OS and arrestin to the IS in mutant mice. Student’s unpaired t-test, p<0.05 (*), p<0.001 (***). NS. not significant; ONL, outer nuclear layer, OPL, outer plexiform layer.
Loss of protocadherin-15 did not apparent degeneration of RPE in Pcdh15 mutant mice.
Transmission electron micrographs of 1–2-month-old mice of denoted genotype show normal RPE with no obvious structural abnormalities, irrespective of genotype. Scale bar: 2 µm. Data presented as mean ± SEM. Each data point represents an individual mouse. Student’s unpaired t-test, p<0.01 (**).The 11-cis retinal complexes with opsin to form rhodopsin. Absorption of a single photon by 11-cis retinal leads to its photo-isomerization to all-trans-retinal within femtoseconds (Nogly et al., 2018), thus activating opsin and initiating the phototransduction cascade. Consequently, there is decoupling of opsin and all-trans-retinal. All-trans-retinal must be re-isomerized to 11-cis retinal to form rhodopsin again. These enzymatic steps occur in the RPE (Saari, 2000; Travis et al., 2007; Wald and Brown, 1956). Next, we assessed the levels of crucial retinoid cycle proteins such as RPE65, an essential isomerase that catalyzes the conversion of all-trans-retinyl ester to 11-cis retinol (Jin et al., 2005; Moiseyev et al., 2005; Redmond et al., 2005), CRALBP (cellular retinaldehyde-binding protein), a key retinoid transporter, and IRBP (interphotoreceptor retinoid-binding protein). These studies were rationalized based on the findings that protocadherin-15 is a binding partner of myosin VIIA (Senften et al., 2006), which also interacts with RPE65 (Lopes et al., 2011). Similar to protocadherin-15, pathogenic variants of myosin VIIA also causes USH1 (Jacobson et al., 2011; Weston et al., 1996). Intriguingly, immunoblotting revealed significantly reduced quantities of RPE65 and CRALBP, but not IRBP in Pcdh15 mutant mice (Figure 3b and c).We also quantified the absolute retinoid levels within the eyes after overnight dark adaptation, and as compared to controls found reduced levels of retinoids, particularly 11-cis-retinaloxime, in Pcdh15 mutant mice (Figure 3d). 11-cis retinaloxime levels correlate with PR rhodopsin levels. Next, we quantified the retinoid levels 1 hr after dark adaptation following bleaching with 15,000 lux for 1 hr (Li et al., 2019). Reduction of 11-cis retinaloxime in control and mutant mice retinae (Figure 3d) correlated with prebleach levels, as did increase in all-trans-retinyl esters. These findings from Pcdh15 mutants suggest a reduced function of the visual cycle due to reduced expression of RPE65 and CRALBP. Since we observed lower visual cycle proteins (RPE65 and CRALBP), we also assessed the structure of the RPE, the main cell type harboring the key enzymes of the visual cycle. Transmission electron microscopy showed no gross structural deficits in the RPE (Figure 3—figure supplement 2). Taken together, our data indicate that the loss of protocadherin-15 in the retina leads to aberrant translocation of proteins involved in the phototransduction cascade and reduced levels of key retinoids and enzymes involved in the visual retinoid cycle.
Figure 3—figure supplement 2.
Loss of protocadherin-15 did not apparent degeneration of RPE in Pcdh15 mutant mice.
Transmission electron micrographs of 1–2-month-old mice of denoted genotype show normal RPE with no obvious structural abnormalities, irrespective of genotype. Scale bar: 2 µm. Data presented as mean ± SEM. Each data point represents an individual mouse. Student’s unpaired t-test, p<0.01 (**).
Pre-clinical administration of exogenous retinoids
We hypothesized that low levels of retinoids in the mutant mice could be overcome by providing exogenous retinoids, thus rescuing the ERG deficits (Palczewski, 2010; Sethna et al., 2020). To test this hypothesis, we first performed baseline ERGs on 2–3-month-old control and Pcdh15 mutant mice. After 1 week, Pcdh15 mutant mice were injected intraperitoneally (IP) with 9-cis retinal, an analog of naturally occurring 11-cis retinal. Control mice were injected with vehicle. ERGs were performed the next day after overnight dark adaptation. Remarkably, a single treatment of Pcdh15 mutant mice with 9-cis retinal was sufficient to increase their ERG amplitudes to levels comparable to those in vehicle-injected wild-type (WT) controls (Figure 4a–b, Figure 4—figure supplement 1). Similarly, we also observed an improvement in cone function to levels of the vehicle-injected control mice (Figure 4d). The b- to a-wave ratio was consistent with vehicle-injected control mice or baseline Pcdh15 mutant mice (Figure 4c), suggesting a proportional increase in PR function after retinoid therapy. To confirm the 9-cis retinal delivery and metabolism, in a separate cohort of mice, 24 hr post-injection followed by 2 hr light exposure, we evaluated the retinaloxime levels, including 9-cis retinaloxime, both in the liver and retina. As expected, we found trace levels of 9-cis retinaloxime levels in the liver and retinae (Figure 4—figure supplement 1).
Figure 4.
Exogenous 9-cis retinal rescues ERG deficits in young and old mutant mice.
(a, d) Representative scotopic ERG traces from young (2–3 months) (a) and old (6–7 months) (d). 9-cis retinal injected Pcdh15 mutant mice (right panels) show waveforms comparable to vehicle-injected control mice (left panels). Same Pcdh15 mutant mice assessed 1 week prior to 9-cis retinal injection and ERG assessment show significantly reduced waveforms (central panels, baseline). (b, e) a- (left panel) and b-wave (right panel) quantification of scotopic ERG amplitudes shown in (a) and (d), respectively. (c, f) Quantification of photopic b-wave for the denoted mice shows 9-cis retinal also improved cone-mediated function of mutant mice. (f) a- (left panel) and b-wave (right panel) quantification of scotopic ERG amplitudes for a different cohort of 6–7-month-old mice show that 2 weeks after 9-cis retinal injection in mutant mice, the efficacy starts to wane. Data presented as mean ± SEM. One-way ANOVA and Bonferroni post hoc test, p<0.05 (*) or p<0.001 (***). NS, not significant. The online version of this article includes source data and the following figure supplement(s) for Figure 4. ERG, electroretinography.
(a) Eye and (b) liver. Student’s unpaired t-test, p<0.05 (*), ns. not significant.
(a) Representative confocal micrographs of light-adapted retinae from vehicle-injected control mice (Pcdh15), exhibit the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS) and arrestin to the inner segment (IS). 9-cis retinal injected mutant mice (Pcdh15) exhibit the same aberrant mislocalization of arrestin and transducin. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. Scale bar: 10 μm. (b) (Quantification of denoted proteins in the IS or the OS for panels in a). Student’s unpaired t-test, ns, not significant.
Figure 4—figure supplement 1.
Accumulation of various retinoids in tissues following exogenous 9-cis retinal delivery.
(a) Eye and (b) liver. Student’s unpaired t-test, p<0.05 (*), ns. not significant.
Exogenous 9-cis retinal rescues ERG deficits in young and old mutant mice.
(a, d) Representative scotopic ERG traces from young (2–3 months) (a) and old (6–7 months) (d). 9-cis retinal injected Pcdh15 mutant mice (right panels) show waveforms comparable to vehicle-injected control mice (left panels). Same Pcdh15 mutant mice assessed 1 week prior to 9-cis retinal injection and ERG assessment show significantly reduced waveforms (central panels, baseline). (b, e) a- (left panel) and b-wave (right panel) quantification of scotopic ERG amplitudes shown in (a) and (d), respectively. (c, f) Quantification of photopic b-wave for the denoted mice shows 9-cis retinal also improved cone-mediated function of mutant mice. (f) a- (left panel) and b-wave (right panel) quantification of scotopic ERG amplitudes for a different cohort of 6–7-month-old mice show that 2 weeks after 9-cis retinal injection in mutant mice, the efficacy starts to wane. Data presented as mean ± SEM. One-way ANOVA and Bonferroni post hoc test, p<0.05 (*) or p<0.001 (***). NS, not significant. The online version of this article includes source data and the following figure supplement(s) for Figure 4. ERG, electroretinography.
Accumulation of various retinoids in tissues following exogenous 9-cis retinal delivery.
(a) Eye and (b) liver. Student’s unpaired t-test, p<0.05 (*), ns. not significant.
Exogenous 9-cis retinal does not improve the mislocalization of key phototransduction cascade proteins.
(a) Representative confocal micrographs of light-adapted retinae from vehicle-injected control mice (Pcdh15), exhibit the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS) and arrestin to the inner segment (IS). 9-cis retinal injected mutant mice (Pcdh15) exhibit the same aberrant mislocalization of arrestin and transducin. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. Scale bar: 10 μm. (b) (Quantification of denoted proteins in the IS or the OS for panels in a). Student’s unpaired t-test, ns, not significant.Next, to assess the impact of exogenous retinoids in aged animals, we performed similar experiments using 6–7-month-old mice. We found a comparable increase in functional activity with a single IP injection of 9-cis retinal in mutant mice as compared to the same cohort of mutant mice assessed one week earlier (baseline Pcdh15 mutant mice). The ERG amplitudes of 9-cis retinal-injected mutant mice were nearly indistinguishable from those of vehicle-injected WT control mice (Figure 4d–f). Finally, in a separate cohort of 6–7-month-old mutant mice, we assessed the longevity of the retinoid-mediated improvement. We found that by 2 weeks after 9-cis retinal treatment, the impact of exogenous retinoid treatment on ERG improvements was reduced (Figure 4g).Next, we assessed whether exogenous 9-cis retinal treatment also improved translocation of arrestin and transducin in Pcdh15 mutant mice. For these studies, we injected a cohort of mutant mice with either 9-cis retinal or vehicle. Overnight dark-adapted mice were exposed to normal room light for 2 hr and their retinae was examined for localization of arrestin and transducin. We found mislocalization of arrestin and transducin in mutant mice injected with 9-cis retinal as well (Figure 4—figure supplement 2). Taken together, our data link the visual deficits to the retinoid cycle dysfunction in Pcdh15 mutant mice and provides a starting point to investigate the possibility of therapeutically boosting visual function in USH1F patients.
Figure 4—figure supplement 2.
Exogenous 9-cis retinal does not improve the mislocalization of key phototransduction cascade proteins.
(a) Representative confocal micrographs of light-adapted retinae from vehicle-injected control mice (Pcdh15), exhibit the correct localization of phototransduction cascade proteins, transducin to the outer segment (OS) and arrestin to the inner segment (IS). 9-cis retinal injected mutant mice (Pcdh15) exhibit the same aberrant mislocalization of arrestin and transducin. Schematic of the localization of arrestin and transducin in control and mutant mice is also shown. Scale bar: 10 μm. (b) (Quantification of denoted proteins in the IS or the OS for panels in a). Student’s unpaired t-test, ns, not significant.
The spectrum and longitudinal ophthalmic phenotypes of USH1F patients homozygous for the p.Arg245* variant (or compound heterozygotes) consisted of a rod-cone dystrophy and are relatively uniform across this cohort of patients. They include an onset of symptoms such as night vision difficulties and visual field deficits in the first or early second decade, the presence of macular atrophy with reduction in central visual acuity by the third decade and, subsequently, the progressive constriction of visual fields resulting in tunnel vision between the third and fifth decades of life. Progressive posterior subcapsular cataract and optic nerve head atrophy are also frequent manifestations of this PCDH15 genotype.Pcdh15 mutant mice have a retinal dysfunction as early as 1 month after birth. We do not observe gross retinal damage, however, in aged mutant mice we do observe marginal loss of ONL thickness. Our data indicate that protocadherin-15 has a dual role in PRs and the RPE. First, at the junction of the PR IS and OS, where protocadherin-15 is localized (Reiners et al., 2005a), the loss of protocadherin-15 leads to disrupted shuttling of arrestin and transducin under light-adapted conditions. Second, within the RPE, loss of protocadherin-15 is associated with lower levels of two key visual retinoid cycle enzymes, CRALBP and RPE65. Reduced levels of RPE65 were reported in Myo7a knockout mice (Lopes et al., 2011), a binding partner of protocadherin-15. Further, CRALBP facilitates the transport of 11-cis retinal between the RPE and the PR OS (Saari et al., 2001). Hence, reduced levels of RPE65 and CRALBP lead to delayed and reduced regeneration and transport of 11-cis retinal to the PR OS, and thus we observed a concordant reduction in levels of 11-cis retinal oxime. Our data provide a plausible explanation for reduced ERG amplitudes without gross retinal degeneration in Pcdh15 mutants, suggesting this may also be the case for other Pcdh15 mutant mice (Garwin et al., 2000; Libby and Steel, 2001; Liu et al., 2007; Peng et al., 2011).Unlike the typical human ocular manifestations of USH1, which have severe retinal degeneration, our mouse model has much less severe pathophysiology. The discordance between retinal pathologies in humans and mice may be further attributable to the structural differences in their PRs, particularly the presence of calyceal process in humans, monkeys, and frogs, but not in rodents (Sahly et al., 2012), light exposure (Lopes et al., 2011), or environmental factors. The role of Usher proteins in the calyceal processes is supported by recent observations of PR degeneration in Ush1 frog models that have calyceal processes (Schietroma et al., 2017). Further, this is consistent with reported ocular phenotypes of other USH mouse models on C57BL/6J background (Garwin et al., 2000; Jacobson et al., 2008; Liu et al., 2007; Liu et al., 1999; Williams et al., 2009). However, a recent study showed degeneration of cone PRs in Ush1c and Ush1g knockout mice on an albino background (Trouillet et al., 2018), which suggests that pigmentation might be providing protection to mice against the ambient light condition in their housing facilities. Currently, we are backcrossing Pcdh15 to generate congenic mice with an albino background. Future studies will assess the PR fate and ERG progression in these mice.In conclusion, documenting the natural history and the degree of clinical variability of the ocular phenotype in human and animal models is pivotal for evaluating the efficacy and potential therapeutics in future clinical trials. Our longitudinal USH1F patient ocular data show that significant vision and PRs are preserved until the third decade of life, providing a long window of opportunity. Our results with an 11-cis retinal analog, 9-cis retinal, raise the possibility that longer-lasting analogs such as 9-cis retinyl acetate, which has an excellent safety profile (Koenekoop et al., 2014; Scholl et al., 2015) or a synthetic version of 11-cis β-carotene, whose capsule formulation is already approved by the United States Food and Drug Administration (Rotenstreich et al., 2013), could preserve vision in USH1F patients. Furthermore, in mouse models lacking key visual cycle enzyme RPE65 or with one of the most common variants of opsin causing RP (p.Pro23His), administration of retinoids has been shown to preserve PR morphology or proper folding of opsin to a greater extent (Maeda et al., 2009; Noorwez et al., 2004), and thus might also extend the life of functional PRs in USH1 patients. Based on our pre-clinical data in mouse and prior human trials, a clinical trial in USH1F patients may show benefit if the retinoid is administered early in life.
Materials and methods
Patient assessment
The records of 13 patients were reviewed under the National Eye Institute, National Institutes of Health protocol 08-EI-N014. Informed consents were obtained from the patients to conduct this research. Eleven were homozygous for the p.Arg245* founder variant was associated with the majority of USH1 of the Ashkenazi Jews in our study and two subjects who were compound heterozygous with one p.Arg245* variant and a second pathogenic variant p.Arg929* of PCDH15 in trans. Data included demographic information, age of onset of visual symptoms, date of ophthalmic exams and reason for visit, BCVA, visual fields, presence and type of lenticular opacities, fundus exam findings, Optical Coherence Retinography when available, and electroretinography. The horizontal diameter of the V4e, I4e, and I1e isopters on Goldmann Visual Fields were measured. Five patients were seen at the NIH Clinical Center under protocol 05-EI-0096 and three had follow-up visits over a 30-year period. These patients underwent a complete ophthalmologic examination including BCVA with manifest refraction, biomicroscopy, and photography of lens opacity, if present, and visual field evaluation by Goldmann kinetic perimetry. Dilated ophthalmoscopic examination was performed after instillation of phenylephrine 2.5% and tropicamide 1%. Digital photography of the retinal fundus was performed. Snellen visual acuity was measured using ETDRS charts. In patients whose visual acuity was reduced to a degree preventing them from reading the chart, the ability to recognize hand motion (HM) or perceive light (LP) was documented. The presence or absence of cystoid macular changes and/or atrophic pigmentary macular changes were assessed by ophthalmoscopy and/or macular photography.
Generating Pcdh15 mice
Pcdh15 mice were generated by the Cincinnati Children’s Hospital Genetics Core using CRISPR/Cas9 technology and then transferred to the University of Maryland School of Medicine (UMSOM) facilities. In addition to the desired mutation (in red, see below) that changes the codon of R250 from CGA to TGA, silent mutations were introduced to create a Hae II restriction endonuclease site (underlined) which is used to facilitate genotyping as well as to prevent recutting by Cas9 nuclease.PAM.Wt: …GACCGTGCACAAAATCTGAATGAGAGG….R.X.KI: …GACCGTGCACAAAATCTGAATG….Hae II.Heterozygous founder mice were bred with WT C57BL/6J mice and the colony was further expanded on the C57BL/6J background. Mice are genotyped using primers VS4576: TTCACCTTCCATTCCCCCAAC and VS4577: CTTACCGGAGTCCTCAGTTCAGG, which generates a 343-bp amplicon that was also Sanger sequenced. Mice were housed in a facility with 12 hr of light and 12 hr with the lights off. Mice were fed after weaning on a standard mouse diet and with water available ad libitum. We followed the ARRIVE guidelines for reporting animal research and studies were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research as well as the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the UMSOM IACUC (Institutional Animal Care and Use Committees).
Electroretinography and optical coherence tomography
ERGs were recorded as previously described (Sethna et al., 2016). Overnight dark-adapted mice were anesthetized with a combination of ketamine-xylazine (100 mg/kg and 10 mg/kg, respectively), followed by dilation of pupils with 1% Tropicamide. A gold loop wire electrode was placed on the cornea, a reference electrode was placed on the scalp under the skin and a ground electrode was placed under the skin near the tail. ERG waveforms were acquired using sequentially brighter stimuli (0.003962233–3.147314 cd × s/m2) with 5–60 s intervals using the Diagnosys ColorDome Ganzfeld system (Diagnosys Systems, Lowell, MA). Three to five waveforms per intensity were averaged. Photopic, cone-only, responses were acquired at a single bright flash (3.15 cd × s/m2) under a steady rod-suppressing field of 30 cd × s/m2, with 10 waves averaged. Waves were analyzed using inbuilt Espion software. For exogenous 9-cis retinal treatment, animals received intraperitoneal 0.25 mg 9-cis retinal (Sigma-Aldrich Inc, Saint Louis, MO) (25 mg dissolved in 200 µl 100% ethanol) and diluted 1:10 in vehicle (180 µl sterile filtered 10% BSA in 0.9% NaCl solution) or vehicle-only (20 µl 100% ethanol and 180 µl 10% BSA in 0.9% NaCl solution), in the dark (Sethna et al., 2020; Xue et al., 2015). Animals were dark adapted overnight and ERGs were performed as above. OCT was performed using Spectralis OCT (Heidelberg Engineering, Heidelberg, Germany). Mice were anesthetized and dilated as above. A custom-designed plano-concave contact lens micro-M 2.00/5.00 (Cantor & Nissel Ltd, Northamptonshire, UK) was used to obtain cross sections of the entire retina. Outer nuclear quantification was performed as detailed before (Zeng et al., 2016).
Immunohistochemistry (eye and ear) and FM1–43 uptake
Mice (1–3-month-old) were dark adapted overnight and euthanized before light onset and eyes were enucleated following CO2 asphyxiation followed by cervical dislocation or exposed to normal room light for 2 hr after light onset and euthanized as above and processed as below. Dark-adapted procedures were performed under very dim red light. Eyes were immediately fixed in Prefer fixative (Anatech LTD, Battle Creek, MI), paraffin embedded and stained using standard protocols (Sethna et al., 2016; Sethna and Finnemann, 2013). Briefly, 7 µm sections were deparaffinized, rehydrated in phosphate-buffered saline (PBS), blocked and permeabilized with 10% normal goat serum/0.3% Triton-X 100 for 2 hr at room temperature (RT), and incubated overnight at 4°C with the indicated primary antibodies to transducin (1:100 dilution, #Sc-517057, Santa Cruz Biotechnology, Dallas, TX) and arrestin (clone C10C10, 1:25 dilution, kind gift from Drs. Paul Hargrave and Clay Smith, University of Florida, FA). The following day, sections were incubated with Alexa fluor labeled goat secondary antibodies (1:250) and DAPI (Thermo Fisher Scientific, Waltham, MA) to label nuclei. Sections were scanned using the UMSOM core facility Nikon W1 spinning disk microscope and images were processed using FIJI software (Schindelin et al., 2012). To stain for protocadherin-15, dissected eyes were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) and processed as above using a previously described custom antibody targeting the C-terminus of protocadherin-15 (PB303; 1:200) (Ahmed et al., 2003a).P60 temporal bones were fixed and processed for immunocytochemistry as previously described (Riazuddin et al., 2012). The cochlear and vestibular sensory epithelia were isolated, fine dissected, and permeabilized in 0.25% Triton X-100 for 1 hr and blocked with 10% normal goat serum in PBS for 1 hr. Tissue samples were probed overnight with antibodies against myosin VIIa or custom antibody targeting the N-terminus of antibody protocadherin-15 (HL56614; 1:200 dilution)(Ahmed et al., 2006), and after three washes, were incubated with the secondary antibody for 45 min at RT. Rhodamine phalloidin was used at a 1:250 dilution for F-actin labeling. All images were acquired using an LSM 700 laser scanning confocal microscope (Zeiss, Germany) using a 63× 1.4 NA or 100× 1.4 NA oil immersion objectives. Stacks of confocal images were acquired with a Z-step of 0.5 µm and processed using ImageJ software (National Institutes of Health, Bethesda, MD).Cochlear and vestibular explants were dissected at postnatal day 0 (P0) and cultured in a glass-bottom petri dish (MatTek, Ashland, MA). They were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA) for 2 days at 37°C and 5% CO2. Explants were incubated for 10 s with 3 µM FM1–43, washed three times with Hank’s balanced salt solution, and imaged live using a Zeiss LSM 700 scanning confocal microscope.
Auditory brainstem response measurements
Hearing thresholds of heterozygous and homozygous Pcdh15 mice at P16 (n=5 each genotype) were evaluated by recording ABRs. All ABR recordings, including broadband clicks and tone-burst stimuli at three frequencies (8, 16, and 32 kHz), were performed using an auditory-evoked potential RZ6-based auditory workstation (Tucker-Davis Technologies Alachua, FL) with a high frequency transducer. Maximum sound intensity tested was 100 dB SPL. TDT system III hardware and BioSigRZ software (Tucker Davis Technology, Alachua, FL) were used for stimulus presentation and response averaging.
Vestibular testing
Exploratory tests were performed as previously described (Michel et al., 2017). Briefly, mice were placed individually in a new cage. A camera was placed on top of the cage to record movements of mice for 2 min and tracked using ImageJ software. Tail hanging tests were performed as follows: mice were held 5 cm above a tabletop. The test scores were given as following: normal behavior was demonstrated by a ‘reaching position,’, with a score of 4, by the extension of limb and head forward and downward aiming to the tabletop. Mice with abnormal behavior, ranked with a score of 1, tried to climb towards the examiner’s hand, curling the body upward reaching with the head to the tail one time. Mice ranked with a score of 0, tried to climb toward the examiner’s hand, curling the body upward reaching with the head to the tail multiple times.
Retinoid extraction and analysis
All procedures for retinoid extraction were performed under red safelights. Overnight dark-adapted mice were euthanized with CO2, eyes enucleated, lens and vitreous removed, followed by freezing the eyecups in pairs on dry ice. These were stored at –80°C until retinoid extraction was performed. Mouse eyecup pairs were homogenized in fresh hydroxylamine buffer (1 ml of 0.1 M MOPS, 0.1 M NH2OH, and pH 6.5). 1 ml ethanol was added, samples were mixed and incubated (30 min in the dark at RT). Retinoids were extracted into hexane (2×4 ml), followed by solvent evaporation using a gentle stream of argon at 37°C. After reconstituting in 50 μl mobile phase, the retinoid samples were separated on LiChrospher Si-60 (5 μm) normal-phase columns (two 2.1×250 mm in series; ES Industries, West Berlin, NJ) using an H-Class Acquity UPLC (Waters Corp., Milford, MA) along with standards at a flow rate of 0.6 ml/min, following published methods (Landers and Olson, 1988). Retinaloxime standards were prepared from 9-cis-retinal (Toronto Research Chemicals, Toronto, Canada), 11-cis-retinal (National Eye Institute, NIH), and all-trans-retinal (Sigma-Aldrich, Saint Louis, MO) using published methods (Garwin et al., 2000). Also, synthetic retinyl palmitate (Sigma-Aldrich Inc, St. Louis, MO) was used as a standard. Absorbance was monitored at 350 nm for retinaloximes and at 325 nm for retinyl esters. Peak areas were integrated and quantified using external calibration curves. Data were analyzed using Empower three software (Waters Corp., Milford, MA).
Data analysis
Four to eight animals per time point/genotype/treatment for ERG analysis were used. One-way ANOVA with Tukey’s post hoc test or Student’s t-test was used to compare the control sample to test samples with the data presented as mean ± SEM. Differences with p<0.05 were considered significant. Data were analyzed using GraphPad Prism (GraphPad Software, Inc, La Jolla, CA).In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:The study showed progressive retinal degeneration in Usher syndrome type I patients with the p.Arginine 245 variant of the PCDH15 gene. In mouse mutants with an equivalent variant there was impaired light-dependent translocation of arrestin and transducin, and reduced retinoid levels. Systemic supplementation of 9-cis retinal, improved retinal function suggesting a potential therapeutic approach.Decision letter after peer review:Thank you for submitting your article "Potential therapy for progressive vision loss due to PCDH15-associated Usher Syndrome developed in an orthologous mouse" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Mone Zaidi as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Henri Leinonen (Reviewer #2); Prof. Claudio Punzo (Reviewer #3).The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1. The paper nicely links clinical phenotype, disease model generation and finding a new therapeutic approach. The mouse phenotyping was done quite extensively. However, the main topic (it is even in the title) of the manuscript is the novel therapy, but then the drug research part itself is the smallest in the whole MS.2. The level of 11-cis-retinal downregulation could explain the mouse phenotype the authors see. But the finding of arrestin and transducin mis-trafficking was a bit confusing. Does this fact affect visual function and how does the retinoid supplementation therapy address this?3. How relevant is this mouse model translationally since there is no progression, and the human condition is progressive? Then, in humans, is progression caused by defective visual cycle or phototransduction protein mislocalization? The authors need to discuss this.4. The paper requires elaboration of the proposed main mechanisms of visual function loss because the proposed drug treatment is specific to this mechanism. It also requires also clear presentation, or citing of previous literature, that the mutated gene/protein exists in main locus of the dysfunction, the RPE.5. The authors find major types of mechanistic dysfunction in the retina; dysfunctional trafficking of arrestin/transducin and impaired visual cycle. Their treatment specifically addresses visual cycle, and vision is practically fully restored. Therefore, is dysfunctional trafficking of arrestin/transducin insignificant? Or is it also secondarily corrected by the retinoid supplementation?6. A few experiments specifically to study visual cycle function are needed, because the treatment is fully dependent on this.7. The specific experiments concerning how authors could elaborate the degree of visual cycle defect are:a. Either dark-adaptation recovery with ERG, for example as in Figure 5 here:https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.201902535Rb. Or retinoid recovery kinetics after strong bleach:https://academic.oup.com/hmg/article/27/13/2225/4969374Figure 7 here. Three time points (e.g. 1 h, 4 h and 8 h) could be sufficient. Essentially, the authors already have 0 h time point as they did dark-adapted one.8. How was the RPE affected in patients and mice with PCDH15 mutation? And with treatment?9. One single IP injection of 9-cis retinal was shown to preserve retinal function in mouse mutants, levels of 9-cis retinal in circulation and retinas should be included after injection and the duration of the effect noted10. Would 9-cis retinal administration prevent mislocalization of transducin and arrestin in light-adapted mice?11. At least 2 mice per group should be added to 1-mon old ERG data set (current n=4) to increase n up to 6.Reviewer #1:1. How was the RPE affected in patients and mice with PCDH15 mutation? And with treatment?2. One single IP injection of 9-cis retinal was shown to preserve retinal function in mouse mutants, levels of 9-cis retinal in circulation and retinas should be included after injection and the duration of the effect noted3. Would 9-cis retinal administration prevent mislocalization of transducin and arrestin in light-adapted mice?4. At least 2 mice per group should be added to 1-mon old ERG dataset (current n=4) to increase n up to 6.Reviewer #2:Usher Syndrome is a rare genetic disorder characterized by deafness, vestibular (body balance) problems and progressive loss of vision. Usher syndrome is divided into 3 subtypes differing in progression and severity such that type 1 is the most dramatic. Saumil and colleagues´ manuscript concerns Usher Syndrome type 1 (USH1) and proposes a novel treatment strategy to mitigate visual dysfunction in affected patients. In their manuscript Saumil et al., first present longitudinal phenotype characterization of a patient population affected mutation in the gene encoding protocadherin-15 (PCDH15) that is one of the gene mutations causative for USH1. They then generate a novel mouse model carrying the same mutation and perform a thorough phenotype characterization including auditory, vestibular and visual system; however, primarily focusing on the eye. They find that the Pcdh15 mutant mice have compromised photoreceptoral trafficking of phototransduction proteins transducin and arrestin at the dark-light switch, and abnormally low expression of visual cycle-related proteins RPE65 and CRALBP as well as lowered level of visual chromophore in their retinas culminating into retinal function impairment. The authors then test the hypothesis if chromophore supplementation by exogenous 9-cis-retinal could mitigate retinal dysfunction, which proves to be true: a single i.p. injection of 9-cis-retinal essentially rescued visual function to WT levels. The concept bears clinical importance as chromophore supplementation therapies have been used in other retinal degenerative diseases before and have proved acceptable safety profile.The patient phenotype follow-up is uniquely longitudinal and quite comprehensive. Establishment and characterization of the new mouse model with respect to the inner ear problems is adequate. Where the current manuscript falls short is confirmation that visual cycle defect is the main cause of visual dysfunction. The authors base their conclusion on lowered visual cycle-protein expression levels and a single time-point retinoid level analysis. This poorly establishes the breadth of visual cycle dysfunction. The authors should test the kinetics of retinoid regeneration after a strong bleach and also preferably test how dark-adaptation differs from healthy mice using electroretinography (a dark-adaptation recovery test, well characterized in literature). The authors should also clearly and discreetly explain/show the expression level of PCDH15 in the RPE, which was not clear to me. Another puzzling thing is the defect in phototransduction-protein trafficking at dark-light switch. How much does this contribute to the observed visual dysfunction, and if it does, by what mechanism a single administration 9-cis-retinal corrects this defect as well, or does it? Authors should test transducin and arrestin trafficking during/after their treatment, similarly as they did in mouse phenotyping part. Finally, the authors did not quantitatively test presence of retinal degeneration in the mouse model. OCT was done only at 1-month of age and statistical analysis of morphometrical parameters is not shown. Nevertheless, due to its clinical applicability retinoid supplementation should be tested in PCDH15-mutation affected USH1 individuals as only a single dose could prove its potential.– I suggest to use presence tense "reveals" instead of "revealed" in the manuscript main title.– Transducin not transducing in the abstract.– What are the retinoid products FDA-accepted for clinical use in retinal degeneration?– In introduction, general prevalence of the condition is missing. How many patients per million inhabitants? This may not be known, but at least some kind of estimate would be good to disclose for readers.– In row 81 authors write about vision preservation. In reality, the PCDH15 mutation causes also other problems than visual cycle, as authors even show themselves. How does the retinoid therapy tackle these issues? Maybe safer to say "improve visual function".– In row 91, the authors talk about ERG defects and refer to table 1, but I do not see any parameters of ERGs in the table.– Row 140: I suggest to remove "outer nuclear" from bipolar neurons. Kind of confusing since BCs are located in the inner nuclear layer.– Supplementary figure 3. Quantification of retinal layers from OCT images is missing. Best if authors did this in the older mice they tested with ERG. Based on the arrestin/transducin trafficking and visual cycle issues, one would expect there to be at least a slowly progressive degeneration (which may not be so readily detectable from current ERG follow-up).– Major comment: visual cycle defect needs to be better characterized by a bleaching challenge test. Please perform a strong bleach and chromophore regeneration assessment preferably coupled with dark-adaptation test with ERG.– Row 203: Current journal policies in general do not like (data not shown).– Did the authors produce the 9-cis-retinal or where was it obtained from?– Row 324-325: ethanol is highly toxic in mice. What was the total ethanol amount injected into mice?– Retinoid extraction and analysis: Details missing how long the mice were dark-adapted.– Data analysis: why/how did the authors use one-way ANOVA when there are two factors: treatment group as a between-subjects factor and flash intensity as a within-subjects factor. Would two-way ANOVA be more appropriate? Were the pre-assumptions tested and met for parametric tests, such as normality of the data?– Data presentation in general. Largest amount of data granularity is encouraged, in keeping with the clarity of presentation. For example, in Figure S2C would be nice to see replicates. The number of biological/technical replicates need to be apparent in the M%M section and in figure legends.– In Figure 1d, it would be nice to see the disease stage (e.g. age) associated with each of the panels in the figure (not figure legend).– Figure 2: Do the authors mean log cd´s/m2 in the x-axis?– Figure 2 legend says that t-test is applied. This is not proper for the ERG data performed with several flash intensities. Change of type 1 error becomes very prevalent, due to multiple comparisons.Figure 2. Could the authors comment about the retinal sensitivity. It seems that sensitivity (I50) is not declined, but rather Rmax. Would significant visual cycle defect cause retinal drop in sensitivity (I50) parameter?Reviewer #3:The manuscript by Sethna et al., decribes a new mouse model based on a founder mutation in the Usher syndrome type 1 gene called Protocadherin-15, known to cause Usher syndrome type 1F. The mouse model recapitulates most aspects of the human disease including hearing loss and sever visual dysfunction. However, unlike in humans there seems to be no apparent retinal degeneration. Unfortunately, this is a common problem seen with many gene mutations known to cause Usher syndrome. The authors therefore characterize the mouse model further with the aim to determine what underlies the visual dysfunction. They determine that there are problems in the visual cycle in these mice. In particular, the translocation of arrestin and transducin in light adapted mice is wrong as they are suddenly present throughout the inner and outer segments. They also identify reduced CRALBP and RPE65 levels in these mice. Both these proteins play an intricate role in the recycling of the visual chromophore. Consequently these mice had also reduced levels of 11-cis retinal. Based on their findings and previous reports in the literature they treated their mice with 9-cis retinal, which is a analog of 11-cis retinal that has more stable chemical properties and is easier to synthesize and administer. Treatment of mice with 9-cis retinal significantly improved visual function, even in 6 months old mice. The authors conclude that patients suffering from this particular founder mutation in Protocadherin-15 could be potentially treated with 9-cis retinal in a clinical trial. In particular, since the compound is already FDA approved.The manuscript is well written and clear. major strength of the manuscript are the phenotypic analyses of 13 human patients, some over a prolonged period of time, with the same mutation as is mimicked in mouse. The recapitulation of the human phenotype in mouse and the discovery of a potential therapy in mouse add further strength to the rationale for a clinical trial in humans with the same therapeutic approach used in mouse. The data support this conclusion and idea, especially since the drug is already FDA approved. The only weakness is that the characterization of the eye phenotype in mouse is not extended beyond 6-7 months of age. While this does not diminish the conclusion it would have been interesting to see if there are phenotypes that take more time to develop in mouse. The explanation for why the authors believe there will likely be no phenotype is sound and supported by data from other Usher mouse models in the literature.Overall this is an important study that may not only help individuals affected by this particular mutation in Protocadherin-15, but may also pave the way for similar approaches in other Usher syndrome cases. The study is therefore of broad impact.The study by by Sethna et al., is a well developed study with a linear line that tracks through the manuscript. It is very logical and clear. There are no concerns with the study in its current form.As mentioned in the above comments it would have been interesting to analyze the eyes also at a later time point (~1 year of age) to see if any degeneration develops slowly. While the rationale for why this is likely not the case is sound (absence of calyceal processes), given that this is a new mouse model it would have added more to the story. In case there would be some slow degeneration after a year this could have opened the opportunity to test how well the 9-cis retinal treatment works when the tissue is degenerating. After all, in humans treatment is likely start in patients that have already some signs of degeneration. Nonetheless, absence of this experiment does not diminish the conclusions nor the impact of the study.Essential revisions:1. The paper nicely links clinical phenotype, disease model generation and finding a new therapeutic approach. The mouse phenotyping was done quite extensively. However, the main topic (it is even in the title) of the manuscript is the novel therapy, but then the drug research part itself is the smallest in the whole manuscript.Thanks. We agree and provided additional data on evaluating the impact of 9-cis retinal delivery on the visual function as well as on arrestin and transducin transport.2. The level of 11-cis-retinal downregulation could explain the mouse phenotype the authors see. But the finding of arrestin and transducin mis-trafficking was a bit confusing. Does this fact affect visual function and how does the retinoid supplementation therapy address this?To address reviewer’s comment, we performed additional experiments, including analyses of arrestin and transducin trafficking after 9-cis retinal injections. We also evaluated the levels of 9-cis retinal in the eye and liver tissues of injected mice. Based on the findings from these experiments, we added the following sentences in the Results section:“To confirm the 9-cis retinal delivery and metabolism, in a separate cohort of mice, 24 hours post-injection followed by 2-hour light exposure, we evaluated the retinaloxime levels, including 9-cis retinaloxime, both in the liver and retina (Figure S7). As expected, we found no or trace levels of 9-cis retinaloxime levels in the same retinae.”“Next, we assessed whether exogenous 9-cis retinal treatment also improved translocation of arrestin and transducin in Pcdh15 mutant mice. For these studies, we injected a cohort of mutant mice with 9-cis retinal and control mice with vehicle. Overnight dark-adapted mice were exposed to normal room light for two hours and their retinae examined for localization of arrestin and transducin. We found mis-localization of arrestin and transducin in mutant mice injected with 9-cis retinal as well (Figure S8). Taken together, our data link the visual deficits to the retinoid cycle dysfunction in Pcdh15 mutant mice and provides a starting point to investigate the possibility of therapeutically boosting visual function in USH1F patients.”3. How relevant is this mouse model translationally since there is no progression, and the human condition is progressive? Then, in humans, is progression caused by defective visual cycle or phototransduction protein mislocalization? The authors need to discuss this.We agree with the reviewer that it’s important to explore the status of the visual cycle proteins in human tissue. However, USH1 subjects have a normal life span. Hence, obtaining ocular tissue in which the retina is still preserved is a limitation to correlating our observations in mouse models implicating the RPE and PR dual dysfunction. However, we did contact several EyeBanks in the USA. None of them have cadaver eye tissues from USH1F subjects. Perhaps a pig model of USH1F can be developed similar to the USH1C pig model (bioRxiv 2021.05.31.446123;), which seems to more faithfully mirror the human retinal degeneration, would be an alternative path forward.To address the point raised by the reviewer, we have added the following sentences in the revised discussion:“Unlike the typical human ocular manifestations of USH1, which have severe retinal degeneration, our mouse model has much less severe pathophysiology. The discordance between retinal pathologies in humans and mice may be further attributable to the structural differences in their photoreceptors, particularly the presence of calyceal process in humans, monkeys, and frog, but not in rodents (Sahly et al., 2012), light exposure (Lopes et al., 2011) or environmental factors. The role of Usher proteins in the calyceal processes is supported by recent observations of photoreceptor degeneration in Ush1 frog models that have calyceal processes (Schietroma et al., 2017). Further, this is consistent with reported ocular phenotypes of other USH mouse models on C57BL/6J background (Haywood-Watson et al., 2006a; Jacobson et al., 2008; Liu et al., 2007; Liu et al., 1999; Williams et al., 2009). However, a recent study showed degeneration of cone photoreceptors in Ush1c and Ush1g knockout mice on an albino background (Trouillet et al., 2018), which suggest that pigmentation might be providing protection to mice against ambient light condition in their housing facilities. Currently, we are backcrossing Pcdh15 to generate congenic mice with an albino background. Future studies will assess the photoreceptor fate and ERG progression in these mice.”4. The paper requires elaboration of the proposed main mechanisms of visual function loss because the proposed drug treatment is specific to this mechanism. It also requires also clear presentation, or citing of previous literature, that the mutated gene/protein exists in main locus of the dysfunction, the RPE.We agree and have added the following information in the revised manuscript:“Immunostaining showed that protocadherin-15 is localized to the inner segments of the PR, the outer plexiform layer and the ganglion cell layer as reported previously (Haywood-Watson, Ahmed et al., 2006a). However, the RPE was not assessed for the localization of protocadherin in those studies. Here we show that protocadherin-15 is also expressed in the RPE using immunohistochemistry (Figure S2b).”Furthermore, our new data reveals an improvement of ERG amplitudes with retinoids, but not a correction of arrestin and transducin trafficking after 9-cis retinal injection, further supporting the notion that the visual cycle deficit observed in Pcdh15 mutant mice stem from a retinoid cycle dysfunction.5. The authors find major types of mechanistic dysfunction in the retina; dysfunctional trafficking of arrestin/transducin and impaired visual cycle. Their treatment specifically addresses visual cycle, and vision is practically fully restored. Therefore, is dysfunctional trafficking of arrestin/transducin insignificant? Or is it also secondarily corrected by the retinoid supplementation?Please see our response to comment 2.6. A few experiments specifically to study visual cycle function are needed, because the treatment is fully dependent on this.7. The specific experiments concerning how authors could elaborate the degree of visual cycle defect are:a. Either dark-adaptation recovery with ERG, for example as in Figure 5 here:https://faseb.onlinelibrary.wiley.com/doi/10.1096/fj.201902535Rb. Or retinoid recovery kinetics after strong bleach:https://academic.oup.com/hmg/article/27/13/2225/4969374Figure 7 here. Three time points (e.g. 1 h, 4 h and 8 h) could be sufficient. Essentially, the authors already have 0 h time point as they did dark-adapted one.Thank you for suggesting these experiments. We have performed the experiments suggested in 7a and b and incorporated the results in Figure 3d-e and Figure S5c-d.“Next, we quantified the retinoids levels one hour after dark adaptation following bleaching with 15,000 lux for one hour (Li et al., 2019). Reduction of 11-cis retinaloxime in control and mutant mice retinae (Figure 3d) correlated with prebleach levels, as did increase in all-trans retinyl esters. These findings from Pcdh15 mutants suggest a reduced function of the visual cycle due to reduced expression of RPE65 and CRALBP. Since we observed lower visual cycle proteins (RPE65 and CRALBP), we also assessed the structure of the RPE, the main cell type harboring the key enzymes of the visual cycle. Transmission electron microscopy showed no gross structural deficits in the RPE (Figure S5e). Together, our data indicates that the loss of protocadherin-15 in the retina leads to aberrant translocation of proteins involved in the phototransduction cascade and reduced levels of key retinoids and enzymes involved in the visual retinoid cycle.”8. How was the RPE affected in patients and mice with PCDH15 mutation? And with treatment?Clinically, it is difficult to address RPE involvement separately from the photoreceptor degeneration in PCDH15 patients. We did observe macular hypoautofluorescence indicating RPE atrophy, as well as RPE and outer retinal atrophy on Optical Coherence Tomography, in LMG197#1831 starting at 38 years of age. A supplement figure (Figure S1) was added showing the left eye fundus autofluorescence and OCT findings for this patient at 50 yrs. of age. The fundus autofluorescence shows a central reduced / absent autofluorescence consistent with RPE atrophy. The OCT shows the corresponding macular area with complete RPE and outer retinal atrophy as indicated by homogenous choroidal hypertransmission and absence of RPE band.We also performed transmission electron microscopy in mutant and control mice, which showed no gross structural deficits of the RPE (Figure S5e).9. One single IP injection of 9-cis retinal was shown to preserve retinal function in mouse mutants, levels of 9-cis retinal in circulation and retinas should be included after injection and the duration of the effect notedWe have included the 9-cis retinaloxime analysis data in the revised supplementary Figure S7.10. Would 9-cis retinal administration prevent mislocalization of transducin and arrestin in light-adapted mice?We performed an arrestin/ transducin localization experiment under light adapted conditions after 9-cis retinal injections and found no correction in the localization of either proteins (Figure S8).11. At least 2 mice per group should be added to 1-mon old ERG data set (current n=4) to increase n up to 6.We agree and have amended the figure to now reflect an n of 10 mice per genotype. Please see the revised Figure 2.Reviewer #1:1. How was the RPE affected in patients and mice with PCDH15 mutation? And with treatment?Please refer to response 3 for human samples. We performed transmission electron microscopy in mutant and control mice, which showed no gross structural deficits of the RPE (Figure S5e).2. One single IP injection of 9-cis retinal was shown to preserve retinal function in mouse mutants, levels of 9-cis retinal in circulation and retinas should be included after injection and the duration of the effect notedWe have included the 9-cis retinaloxime analysis data in the revised supplementary Figure S7.3. Would 9-cis retinal administration prevent mislocalization of transducin and arrestin in light-adapted mice?Our new data reveals an ERG improvement with retinoids, but not a correction of arrestin and transducin trafficking after 9-cis retinal injection, further support the notion that the visual cycle deficit observed in Pcdh15 mutant mice stem from a retinoid cycle dysfunction.4. At least 2 mice per group should be added to 1-mon old ERG dataset (current n=4) to increase n up to 6.We have amended the figure to reflect an n of 10 mice per genotype. Please see the updated Figure 2.Reviewer #2:[…]– I suggest to use presence tense "reveals" instead of "revealed" in the manuscript main title.Fixed– Transducin not transducing in the abstract.Thank you for pointing this out. During submission of the abstract online, we missed the error incorporated by the spell checker resulting in “transducing”.– What are the retinoid products FDA-accepted for clinical use in retinal degeneration?In the revised discussion, we have added the following sentences to list current FDA-accepted retinoid products that are currently in clinical trials:“Our results with an 11-cis retinal analog, 9-cis retinal, in a mouse model of USH1F raises the possibility that a longer lasting analog such as 9-cis retinyl acetate, which has an excellent safety profile (Koenekoop et al., 2014; Scholl et al., 2015) or a capsule formulation of a synthetic version of 11-cis β-carotene, which is already approved by the United States Food and Drug Administration (Rotenstreich et al., 2013), may preserve vision in USH1F Usher syndrome patients.”– In introduction, general prevalence of the condition is missing. How many patients per million inhabitants? This may not be known, but at least some kind of estimate would be good to disclose for readers.We have added the following sentences in the introduction:“Usher syndrome (USH) is estimated to be responsible for more than 50% of deaf-blind cases, 8-33% of patients with RP and 3-6% of congenitally deaf individuals (Boughman et al., 1983; Brownstein et al., 2004b; Vernon, 1969). Clinical data review studies estimated a prevalence of 3.2 to 6.2 per 100,000 for USH cases (Boughman and Fishman, 1983; Koenekoop et al., 1993). However, a molecular diagnosis study in children with hearing loss found variants in USH-associated genes in 11% and estimated a frequency of 1/6000 individuals afflicted with USH in the USA (Kimberling et al., 2010). Assuming similar prevalence, this would translate into 255,000 to 1.34 million USH cases worldwide. However, this estimate varies considerably in specific population substructures. For instance, the p.Arg245* founder variant of PCDH15 (USH1F) has ~2% carrier frequency amongst Ashkenazi Jews accounts for nearly 60% of their USH1 cases (Ben-Yosef et al., 2003). Thus, we speculate that a comprehensive understanding of the pathophysiology and disease mechanisms is a prelude for developing therapeutic interventions for Usher syndrome after clinical trials.”– In row 81 authors write about vision preservation. In reality, the PCDH15 mutation causes also other problems than visual cycle, as authors even show themselves. How does the retinoid therapy tackle these issues? Maybe safer to say "improve visual function".Fixed.– In row 91, the authors talk about ERG defects and refer to table 1, but I do not see any parameters of ERGs in the table.We have fixed the error. Electroretinography recordings were at noise-level for both scotopic and photopic responses so no data to add in Table 1. Also, we have added a representative example in supplementary Figure S1.– Row 140: I suggest to remove "outer nuclear" from bipolar neurons. Kind of confusing since BCs are located in the inner nuclear layer.Fixed.– Supplementary figure 3. Quantification of retinal layers from OCT images is missing. Best if authors did this in the older mice they tested with ERG. Based on the arrestin/transducin trafficking and visual cycle issues, one would expect there to be at least a slowly progressive degeneration (which may not be so readily detectable from current ERG follow-up).We have quantified OCT images and added the data to Figure 2i.– Major comment: visual cycle defect needs to be better characterized by a bleaching challenge test. Please perform a strong bleach and chromophore regeneration assessment preferably coupled with dark-adaptation test with ERG.We have performed the bleaching challenge test and added the results in (Figure S5). We observed equivalent recovery of a-wave regardless of genotype (Figure S5d), but we did observe that initial a-wave amplitude was lower in mutant mice (Figure S5e).– Row 203: Current journal policies in general do not like (data not shown).Fixed.– Did the authors produce the 9-cis-retinal or where was it obtained from?Sigma Aldridge (catalog #R5754). Added this information to the Methods section.– Row 324-325: ethanol is highly toxic in mice. What was the total ethanol amount injected into mice?We have added details in the methods section:“For exogenous 9-cis retinal treatment, animals received intraperitoneal 0.25 mg 9-cis retinal (Sigma Aldrich Inc, Saint Louis, MO) (25 mg dissolved in 200 µl 100% ethanol) and diluted 1:10 in vehicle (180 µl sterile filtered 10% BSA in 0.9% NaCl solution) or vehicle only (20 µl 100% ethanol and 180 µl 10% BSA in 0.9% NaCl solution), in the dark (Sethna et al., 2020; Xue et al)”.– Retinoid extraction and analysis: Details missing how long the mice were dark-adapted.Overnight, which we added to the methods section.– Data analysis: why/how did the authors use one-way ANOVA when there are two factors: treatment group as a between-subjects factor and flash intensity as a within-subjects factor. Would two-way ANOVA be more appropriate? Were the pre-assumptions tested and met for parametric tests, such as normality of the data?We are comparing amplitudes between groups at a single intensity. We performed this analysis for each intensity, similar to previous studies (e.g. PMID: 33677964; PMID: 30018116).– Data presentation in general. Largest amount of data granularity is encouraged, in keeping with the clarity of presentation. For example, in Figure S2C would be nice to see replicates. The number of biological/technical replicates need to be apparent in the M%M section and in figure legends.Fixed.– In Figure 1d, it would be nice to see the disease stage (e.g. age) associated with each of the panels in the figure (not figure legend).Done. We have revised the figure and included ages in the panel.– Figure 2: Do the authors mean log cd´s/m2 in the x-axis?Yes.– Figure 2 legend says that t-test is applied. This is not proper for the ERG data performed with several flash intensities. Change of type 1 error becomes very prevalent, due to multiple comparisons.We analyzed amplitude at each flash intensity individually between genotype, therefore t-test is appropriate, similar to previous studies (e.g. PMID: 33677964; PMID: 30018116). However, to avoid the confusion that significance is measured through multiple comparisons, we have updated the figure and legend to reflect that significance levels are assessed by one-to-one comparison of the intensity across mutants vs wild type controls, at each intensity, through a t-test.Figure 2. Could the authors comment about the retinal sensitivity. It seems that sensitivity (I50) is not declined, but rather Rmax. Would significant visual cycle defect cause retinal drop in sensitivity (I50) parameter?That is a very interesting and important comment. We think that the paradox is explained by the complex phenotype of the Pcdh15 mutant, on the one hand there is reduced expression of visual cycle proteins (RPE65 and CRALBP), and on the other hand an effect on photoreceptor biochemistry/physiology. The visual cycle in mutants, though reduced in output, is still sufficient to supply what chromophore is needed by the mutant photoreceptors so sensitivity (“I50”) is not that impacted. The reduced a-wave response (“Rmax”) observed is probably due to the impacted photoreceptor biochemistry/physiology (as illustrated by arrestin/transducin effect) while the actual threshold is not that affected.Reviewer #3:As mentioned in the above comments it would have been interesting to analyze the eyes also at a later time point (~1 year of age) to see if any degeneration develops slowly. While the rationale for why this is likely not the case is sound (absence of calyceal processes), given that this is a new mouse model it would have added more to the story. In case there would be some slow degeneration after a year this could have opened the opportunity to test how well the 9-cis retinal treatment works when the tissue is degenerating. After all, in humans treatment is likely start in patients that have already some signs of degeneration. Nonetheless, absence of this experiment does not diminish the conclusions nor the impact of the study.We performed additional experiments on 12 to14 month old animals and have incorporated these data in Figure 2g, h, j.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Gene (mouse)
Pcdh15
GenBank
Gene ID: 11994
Gene (human)
PCDH15
GenBank
Gene ID: 65217
Genetic reagent (Mus musculus)
Pcdh15R250X
This paper
Antibody
Protocadherin-15 (Rabbit polyclonal)
Ahmed et al., 2003a
PB303;C-terminus
IF (1:200)
Antibody
Opsin (Ret-P1; mouse monoclonal)
MilliporeSigma
MAB5316
IF (1:500)
Antibody
Transducin (mouse monoclonal)
Santa Cruz Biotechnology
Sc-517057
IF (1:100)
Antibody
Arrestin(mouse monoclonal)
Drs. Paul Hargrave and Clay Smith, University of Florida, FA
clone C10C10
IF (1:25)
Antibody
Protocadherin-15(Rabbit polyclonal)
Ahmed et al., 2006
HL5614;N-terminus
IF (1:1200)
Antibody
Transducin(mouse monoclonal)
Santa Cruz Biotechnology
Sc-517057
IF (1:100)
Antibody
Rhodopsin clone RET-P1(mouse monoclonal)
EMD Millipore
MAB5316
IF (1:250)
Antibody
Actin clone 13E5(Rabbit polyclonal)
Cell Signaling Technology
4970S
IF (1:200)
Probe
Rhodamine phalloidin
Thermo Fisher Scientific
R415
IF (1:200)
Antibody
IRBP(Rabbit polyclonal)
Santa Cruz Biotechnology
Sc-25787
WB (1:500)
Antibody
CRALBP(Rabbit polyclonal)
Santa Cruz Biotechnology
Sc-28193
WB (1:1000)
Antibody
RPE65(Rabbit polyclonal)
Kind gift from Dr. Michael Redmond, National Institutes of Health, Bethesda, MD
Authors: Samuel G Jacobson; Artur V Cideciyan; Dan Gibbs; Alexander Sumaroka; Alejandro J Roman; Tomas S Aleman; Sharon B Schwartz; Melani B Olivares; Robert C Russell; Janet D Steinberg; Margaret A Kenna; William J Kimberling; Heidi L Rehm; David S Williams Journal: Invest Ophthalmol Vis Sci Date: 2011-10-07 Impact factor: 4.799
Authors: Piotr Kazmierczak; Hirofumi Sakaguchi; Joshua Tokita; Elizabeth M Wilson-Kubalek; Ronald A Milligan; Ulrich Müller; Bechara Kachar Journal: Nature Date: 2007-09-06 Impact factor: 49.962
Authors: Mathias Senften; Martin Schwander; Piotr Kazmierczak; Concepcion Lillo; Jung-Bum Shin; Tama Hasson; Gwenaëlle S G Géléoc; Peter G Gillespie; David Williams; Jeffrey R Holt; Ulrich Müller Journal: J Neurosci Date: 2006-02-15 Impact factor: 6.167
Authors: Yong Zeng; Ronald S Petralia; Camasamudram Vijayasarathy; Zhijian Wu; Suja Hiriyanna; Hongman Song; Ya-Xian Wang; Paul A Sieving; Ronald A Bush Journal: Invest Ophthalmol Vis Sci Date: 2016-07-01 Impact factor: 4.799