| Literature DB >> 34737699 |
Huimin Yan1,2, Jia Lu2,3, Jiabao Wang1,2,3, Lu Chen1,2,3, Yu Wang1,2,3, Lin Li1,2,3, Lin Miao1,2,3, Han Zhang1,2,3.
Abstract
Background and aims: Xuanfei Baidu decoction (XFBD), a traditional Chinese medicine formulation, was designed and successfully applied for COVID-19 disease treatment in China, while the mechanism is still not clear.Entities:
Keywords: Xuanfei Baidu decoction; cyclophosphamide; immune modification; immunosuppression; traditional Chinese medicine
Year: 2021 PMID: 34737699 PMCID: PMC8560678 DOI: 10.3389/fphar.2021.730567
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequences used for RT-PCR.
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
|
| AGGAACCTGAAACTCCCCAG | AAATCCAGAACATGCCGCAG |
|
| TCTCGAATGTACCAGGAGCC | ACCTTGGAAGCCCTACAGAC |
|
| CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
FIGURE 1Effect of XFBD on body weights and immune organ indices. (A) Body weights during treatment; (B) body weights after treatment; (C) spleen index, and (D) thymus index. Normal, administered with saline; Model: intraperitoneally administered with cyclophosphamide; XFBD: intraperitoneally administered with cyclophosphamide first and followed by XFBD at 3.9 g/kg/day; and LH: intraperitoneally administered with cyclophosphamide first and followed by LH at 20 mg/kg. Data are expressed as mean ± SD (n = 6).*p < 0.05 and **p < 0.01 vs. Normal group, # p < 0.05 and ## p < 0.01 vs. Model group.
FIGURE 2Effects of XFBD on the morphological changes in the liver, the spleen, and the thymus in CY-treated mice. stained by H&E, 10× Normal, administered with saline; Model: intraperitoneally administered with cyclophosphamide; XFBD: intraperitoneally administered with cyclophosphamide first and followed by XFBD at 3.9 g/kg/day; and LH: intraperitoneally administered with cyclophosphamide first and followed by LH at 20 mg/kg.
FIGURE 3Effect of XFBD on immunoglobulin levels and cytokines in the CY-treated mice. TNF-α (A), IFN-γ (B) IgG (C), and IgM (D) levels in serum were determined by ELISA and IL-2 (E), IL-4 (F), and IL-6 (G) expressions in the spleen were determined by RT-PCR. Normal, administered with saline; Model: intraperitoneally administered with cyclophosphamide; XFBD: intraperitoneally administered with cyclophosphamide first and followed by XFBD at 3.9 g/kg/day; and LH: intraperitoneally administered with cyclophosphamide first and followed by LH at 20 mg/kg. Data are expressed as mean ± SD [(A–D), n = 5] [(E–F), n = 3]. *p < 0.05 and **p < 0.01 vs. Normal group, #p < 0.05 and ##p < 0.01 vs. Model group.
FIGURE 4Effects of XFBD on LPS-induced splenic lymphocyte proliferation and T lymphocyte subsets in CY-treated mice. (A) LPS-induced splenic lymphocyte proliferation; (B) representative flow cytometry analysis result of CD4+ subset; (C) representative flow cytometry analysis result of CD8+ subset; and (D) representative images of Splenic T lymphocyte subsets detected by flow cytometry. Normal, administered with saline; Model: intraperitoneally administered with cyclophosphamide; XFBD: intraperitoneally administered with cyclophosphamide first and followed by XFBD at 3.9 g/kg/day; and LH: intraperitoneally administered with cyclophosphamide first and followed by LH at 20 mg/kg. Data are expressed as mean ± SD (n = 3).*p < 0.05 and **p < 0.01 vs. Normal group, #p < 0.05 and ##p < 0.01 vs. Model group.