Literature DB >> 34735532

Plasma circulating cell-free mitochondrial DNA in depressive disorders.

Johan Fernström1,2, Lars Ohlsson3, Marie Asp1,2, Eva Lavant3, Amanda Holck1,2, Cécile Grudet1, Åsa Westrin1,4, Daniel Lindqvist1,4.   

Abstract

BACKGROUND: Plasma circulating cell-free mitochondrial DNA (ccf-mtDNA) is an immunogenic molecule and a novel biomarker of psychiatric disorders. Some previous studies reported increased levels of ccf-mtDNA in unmedicated depression and recent suicide attempters, while other studies found unchanged or decreased ccf-mtDNA levels in depression. Inconsistent findings across studies may be explained by small sample sizes and between-study variations in somatic and psychiatric co-morbidity or medication status.
METHODS: We measured plasma ccf-mtDNA in a cohort of 281 patients with depressive disorders and 49 healthy controls. Ninety-three percent of all patients were treated with one or several psychotropic medications. Thirty-six percent had a personality disorder, 13% bipolar disorder. All analyses involving ccf-mtDNA were a priori adjusted for age and sex.
RESULTS: Mean levels in ccf-mtDNA were significantly different between patients with a current depressive episode (n = 236), remitted depressive episode (n = 45) and healthy controls (n = 49) (f = 8.3, p<0.001). Post-hoc tests revealed that both patients with current (p<0.001) and remitted (p = 0.002) depression had lower ccf-mtDNA compared to controls. Within the depressed group there was a positive correlation between ccf-mtDNA and "inflammatory depression symptoms" (r = 0.15, p = 0.02). We also found that treatment with mood stabilizers lamotrigine, valproic acid or lithium was associated with lower ccf-mtDNA (f = 8.1, p = 0.005). DISCUSSION: Decreased plasma ccf-mtDNA in difficult-to-treat depression may be partly explained by concurrent psychotropic medications and co-morbidity. Our findings suggest that ccf-mtDNA may be differentially regulated in different subtypes of depression, and this hypothesis should be pursued in future studies.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34735532      PMCID: PMC8568274          DOI: 10.1371/journal.pone.0259591

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Oxidative stress and apoptosis trigger the release of mitochondrial DNA (mtDNA) from the cell into the systemic circulation [1]. Circulating cell-free mtDNA (ccf-mtDNA), as measured in blood plasma, triggers inflammatory cascades but may also have beneficial antibacterial effects and contribute to cell-to-cell communications [1]. Increased ccf-mtDNA has been reported in various somatic disorders including sepsis, diabetes, and traumatic injury [2-5]. Recent studies show that also psychological stress may trigger ccf-mtDNA release [1, 6, 7], suggesting that this biomarker might be useful in certain psychiatric disorders. We have previously shown that unmedicated patients with suicidal [8] and non-suicidal [9] major depressive disorder (MDD) have increased levels of plasma ccf-mtDNA, and that increased ccf-mtDNA levels are associated with hypothalamic-pituitary-adrenal axis hyperactivity [8]. While these findings suggest that depression and suicidality may be accompanied by increased amounts of cellular stress, other studies have reported unchanged [10, 11], or decreased [12] ccf-mtDNA in mood disorders compared to healthy controls. As recently reviewed elsewhere [1], there are several factors relating to assay methodology and study design that might explain divergent findings across studies. Moreover, the use of psychotropic medications may influence mitochondrial function and cellular health [13-15]. For instance, preclinical studies have shown that SSRIs, antipsychotics, and mood stabilizers may improve cellular health and have neuroprotective effects [16-21], but the relationship between these medications and cellular stress marker ccf-mtDNA has not yet been investigated in a real-life clinical sample of depression. Moreover, no previous studies that have investigated the relationship between ccf-mtDNA and specific symptom profiles of depression. The main aim of the current study was to investigate plasma ccf-mtDNA in a large and diagnostically well-characterized clinical sample difficult-to-treat depression and healthy controls. Moreover, we aimed to test the relationship between ccf-mtDNA and specific symptoms of depression, a history of a suicide attempt and medications that may influence ccf-mtDNA.

Methods and materials

Ethical approval

All patients included in the study have given written informed consent to participate. The GEN-DS project was approved by the Regional Ethical Board in Lund, Sweden (2011/673).

Subject recruitment, patient cohort

This study is a part of a more comprehensive cohort named “Genes, Depression and Suicidality” (GEN-DS), seeking to investigate pharmacogenetic aspects among patients who have made suicide attempts and those who have not. Patients who were previously diagnosed with an affective disorder and had an insufficient treatment response were referred to the GEN-DS study. In this study insufficient treatment response was defined as not having achieved remission with previous and ongoing treatments during the current depressive episode. Recruitment procedures have been described in a previous study [22]. Briefly, 281 patients were referred to the project from four psychiatric clinics in southern Sweden between the years of 2012 and 2020. All referrals of patients with clinical depression according to referring specialist or resident in psychiatry were included in the project. Exclusion criteria were body mass index less than 15, pregnancy or current liver disease. After inclusion, all patients were diagnosed according to DSM-IV by either a specialist in psychiatry or a senior resident in psychiatry under supervision by a specialist in psychiatry. The diagnostic procedure included a standardized research protocol including Mini International Neuropsychiatric Interview (MINI) 6.0 [23] and the Structured Clinical Interview for DSM-IV Personality Disorders (SCID-II) [24]. Psychiatric symptoms were assessed using the Comprehensive Psychopathological Rating Scale (CPRS) [25]. We extracted the Montgomery-Åsberg Rating Scale (MADRS) from the CPRS [26]. The structured research protocol also included questions on psychiatric symptoms, suicidal and self-harm behaviour, alcohol and substance use, psychiatric and somatic diagnoses and treatments. Remitted depression was defined as referring only to the nine DSM-IV-TR criterion symptom domains for MDD [27].

Subject recruitment, controls

Forty-nine healthy controls were recruited through advertisements in social media and through newspaper ads. If deemed eligible for inclusion, controls subjects underwent a MINI. Any previous or present psychiatric illness; addiction disorder; treatment with psychotropic drugs or psychotherapy; somatic illness deemed severe or chronic; ongoing infection; present pregnancy, breast-feeding or treatment with drugs influencing the immune system were considered to be an exclusion criterium. Healthy controls received 500 SEK in compensation after the blood draw.

Measurement of cell-free mtDNA

Plasma was sampled in the morning after a night of fasting and instructions to avoid taking medications and smoking in the morning. Samples were stored at -80C until analyses. DNA was isolated from thawed plasma samples using the QIAmp DNA Blood Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction for Blood and body-fluid protocol. Before the isolation of DNA, the plasma samples were centrifugated at 10 000 g for 10 min. The quantitative analysis of cell-free mtDNA was performed using quantitative real time polymerase chain reaction (PCR). The experiment was run once in triplicate reactions. A dilution series consisting of the PCR product was constructed and used to create a standard curve. The different crossing-point values from the unknown samples were compared with the standard curve, and the corresponding number of mitochondrial units was calculated using the following formula: The amount of DNA (g μl − 1) was divided with the size of the PCR fragment (bp) and the molar mass per base pair (g mol− 1). The product was finally multiplied with Avogadro’s constant. The primers (Life Technologies, Paisley, UK) used for PCR amplification of mtDNA were as stated in the table below: The PCR reactions were carried out using SYBR Green Technology (Thermo Fisher Scientific, Waltham, MA, USA). Each 20 μl reaction contained 5 μl of template, 1 μl of each primer (10 μM), 10 μl SYBR MIX (2 Å~, Sensifast, Bioline, London, UK) and 3 μl of nuclease-free water. Each reaction was run in triplicate on a LC480 LightCycler from Roche, Mannheim, Germany) using the following program: Initial denaturation at 95°C for 10 min, followed by 45 cycles consisting of 95°C in 10 s. for melting, 65°C for 10 s annealing and 72°C for 11 s extension. The program ended with a melting curve analysis measuring fluorescence continuously from 60 to 97°C.

Statistics

The Statistical Package for the Social Sciences for Mac (SPSS version 27, IBM, Armonk, NY, USA) was used for statistical calculations. One-way ANOVA or Student’s t-test were used to compare demographic data between groups. Since the ccf-mtDNA levels were skewed this variable was log-transformed. Bivariate correlations were calculated using Pearson’s r or Spearman’s Rho, as appropriate. All analyses involving ccf-mtDNA were a priori adjusted for age and sex using either ANCOVA or partial correlations. Pearson’s chi-2 was used to compare proportions between-groups. All tests were two-tailed and the significance level was set to p < 0.05. Ccf-mtDNA, as a danger-associated molecular pattern–DAMP—may trigger of chronic low-grade inflammation. Systemic low-grade inflammation has been implicated in the pathophysiology of depression [28, 29], particularly in those subjects with symptoms of low energy, fatigue and sleep and appetite disturbances [30]. We therefore calculated a composite symptom score of “inflammatory depression” using CPRS items lassitude, fatiguability, reduced appetite and reduced sleep–and investigated the association between this composite score and ccf-mtDNA.

Results

Demographic characteristics

Demographic characteristics and ccf-mtDNA levels in current depression, remitted depression and healthy controls are summarized in Data was missing for BMI (n = 14), smoking (n = 2) and MADRS (n = 17). As expected, MADRS scores were significantly higher among currently depressed individuals compared to those with remitted depression. Treatment with mood stabilizers (either lithium, lamotrigine or valproic acid) was more common in remitted depression than current depression. Diagnostic characteristics for all patients are summarized in Table 2.
Table 2

Detailed diagnostic characteristics including type of affective disorder.

Diagnostic group Number of patients
Current mood disorder 236
Depression, single episode 8
Recurrent depression 120
Chronic depression 79
Depression NOS 3
Dysthymia 59
Bipolar disorder, depressive episode 22
Remitted mood disorder 45
Recurrent depression, in remission 31
Bipolar depresson, in remissiom 11
No affective disorder 3

Patients could be assigned to more than one diagnosis.

Patients could be assigned to more than one diagnosis. Patients with remitted depression did not fullfill the DSM criteria for a depressive episode at the time of the diagnostic evaluation, although comorbidity with other psychiatric disorders was common as shown in below. Chi-square tests were carried out to compare current depression vs remitted depression Ccf-mtDNA was not significantly associated with age (p = 0.70), sex (p = 0.34), BMI (p = 0.66) or smoking (p = 0.74). The most common somatic comorbidities among the patients were musculoskeletal disorders (24.9%), gastrointestinal disorders (16.7%), respiratory disorders (8.5%), cardiovascular disorders (7.1%), neurological disorders (12.5%), endocrinological disorders (13.5%). We calculated a “composite somatic co-morbidity score” in which one point was added for each organ system affected. There was no significant correlation between this score and ccf-mtDNA (p = 0.63). Ccf-mtDNA was not significantly correlated with freezer time (p = 0.68).

Ccf-mtDNA in patients and controls

Mean levels in ccf-mtDNA were significantly different between patients with a current depressive episode, remitted depressive episode and healthy controls (F = 8.3, p<0.001, adjusting for age and sex,). Post-hoc tests revealed that both patients with current (p<0.001) and remitted (p = 0.002) depression had lower ccf-mtDNA compared to controls. There was no significant difference in ccf-mtDNA between current and remitted depression (p = 0.86). Patient samples had been stored longer in the freezer compared to control samples (median 4 vs 2 years, p<0.001, Mann-Whitney U-test). Storage time was, however, not significantly correlated with ccf-mtDNA as shown above and the group differences in ccf-mtDNA (controls vs ongoing depression and controls vs remitted depression) were still significant even after adding storage time as a covariate (F = 9.3, p<0.001). Ccf-mtDNA was plotted in current depression, remitted depression and controls in .

Log transformed ccf-mtDNA in controls, current depression and remitted depression.

Error bars represent mean, SD. The group effect was significant (F = 8.3, p<0.001, adjusted for age and sex). Post-hoc tests revealed that patients with current (p<0.001) and remitted (p = 0.002) depression had lower ccf-mtDNA compared to controls.

Associations between ccf-mtDNA and psychotropic medications

Patients taking mood stabilizers (n = 65) had significantly lower ccf-mtDNA compared to those not taking mood stabilizers (n = 216) (F = 8.1, p = 0.005, adjusted for age and sex). There were no differences in ccf-mtDNA between those taking antidepressants or not, or between those taking antipsychotics or not (all p>0.27). Patients with bipolar disorder did not differ significantly in ccf-mtDNA compared to patients without bipolar disorder (p = 0.42). Nineteen patients (6.8%) took no psychotropic medications at the time of the diagnostic evaluation. There was no significant difference in ccf-mtDNA between those patients and all other patients (p = 0.28).

Associations between ccf-mtDNA and psychiatric symptoms and suicidality

Ccf-mtDNA was not significantly correlated with MADRS or the SUAS subscale comprising items 16–20 (all p>0.25). As shown in , the inflammatory depression composite score correlated positively and significantly in all patients (r = 0.15, p = 0.02, df = 264, adjusted for age and sex). Patients with a history of a suicide attempt (n = 83) did not differ in ccf-mtDNA levels compared to those who had not made a suicide attempt (n = 191) (p = 0.18, adjusting for age and sex). Information regarding previous suicide attempts was missing for seven patients.

Correlation between ccf-mtDNA and “inflammation composite score” calculated by summarizing CPRS-items “lassitude”, “fatiguability”, “reduced appetite” and “reduced sleep”.

Both patients with current and remitted depression were included. The correlation was significant (r = 0.15, p = 0.02, df = 264, adjusting for age and sex).

Discussion

Our most salient finding was that patients with depression in secondary psychiatric care had lower ccf-mtDNA levels compared to healthy controls. These findings contrast our previous reports on unmedicated and suicidal depressed patients [8, 9], but are more in line with other studies on mood disorders [10-12]. Although low ccf-mtDNA was found in the depressed group overall, an “inflammatory depression symptom profile” [30] was conversely associated with higher ccf-mtDNA, suggesting that ccf-mtDNA may be differentially regulated across depression symptom profiles. Finally, treatment with mood stabilizers was associated with the lowest ccf-mtDNA within the depressed group, consistent with animal studies showing that these medications may promote cellular and neuronal health [31]. Previous studies have reported inconsistent findings regarding between-group differences in ccf-mtDNA in patients with mood disorders and healthy controls. The divergent results across studies may be explained by cohort-specific factors such as medication status, illness chronicity, symptom profiles and somatic and psychiatric co-morbidity. In the present study, 93% medicated with one, or a combination of several, psychotropics. Moreover, somatic as well as psychiatric comorbidities were common in the current sample. These sample characteristics are largely in contrast to one of our previous studies, where we reported increased ccf-mtDNA in depression, in which all patients were unmedicated, somatically healthy and had no or minimal psychiatric co-morbidity [9]. In the other study from our group in which increased ccf-mtDNA was reported patients versus controls, all patients were also unmedicated and had recently attempted suicide at the time of the blood sampling [8]. In line with the findings of the present study, Kageyama et al. also reported decreased ccf-mtDNA in unipolar and bipolar depression compared to controls [12]. In another recent study, Jeong et al. found no difference in ccf-mtDNA between adolescents with bipolar disorder and healthy controls [10]. Moreover, Jeong et al. also reported that severity of depressive symptoms was negatively correlated with ccf-mtDNA, although specific depression symptom profiles were not investigated in this partciluar study. In both of these studies [10, 12], a substantial part of the patients medicated with one or more psychotropic. In the present study, we found, in exploratory analyses, that patients within the depressed group treated with mood stabilizers had the lowest levels of ccf-mtDNA, suggesting that at least part of the between-group differences in ccf-mtDNA may be accounted for by medication status. Psychotropic medications, and lithium in particular, are known to influence mitochondrial biology and cellular health [20]. In one study based on pluripotent stem cell technology, mitochondrial abnormalities were found in neurons from patients with bipolar disorders. Furthermore, lithium could normalize some of these alterations [32]. Similar effects of lithium were shown in a post-mortem study, in which activity of electron transport chain (ETC) enzyme complex I-III was increased in human frontal cortex after exposure to lithium [33]. Moreover, an animal model of mania, in which mitochondrial dysfunction was induced using d-amphetamine, both lithium and valproate were found to reverse some of these alterations [34]. Also lamotrigine may have neuroprotective effects mediated via its actions on mitochondrial function, according to some preclinical studies [35, 36]. We show, for the first time, that medication with mood stabilizers is associated with lower plasma levels of ccf-mtDNA in a large clinical sample of depression. These findings may have future implications for treatment response and the understanding of mechanistic actions of mood stabilizers. Such issues should be pursued in future studies. Both clinical and preclinical studies suggest that ccf-mtDNA is an immunogenic molecule [37-41], although this assumption has also recently been challenged [1]. Mitochondrial DNA can act as damage associated molecular patterns (DAMPs) triggering the innate immune response primarily through binding to the toll-like receptor 9 (TLR-9). Interestingly, we found a significant positive relationship between ccf-mtDNA and depressive symptoms that have been more closely linked to low-grade inflammation [30]. While highly preliminary and in need of replication, these findings suggest that ccf-mtDNA may be differentially regulated in different subtypes of depression. Specifically, our findings point to a role of ccf-mtDNA in “inflammatory depression”; a depression subtype that has been associated with worse treatment response to conventional SSRIs and a better treatment anti-inflammatory compounds [29, 42]. Future clinical trials testing the antidepressant efficacy of such interventions should consider measuring ccf-mtDNA as a potential biomarker of treatment response. While the present study has several notable strengths including the large sample size and the thorough diagnostic assessments, it also comes with several limitations. There are many factors that potentially may influence ccf-mtDNA levels that were not accounted for in the present study. As described above, both exercise and psychological stress can induce changes in ccf-mtDNA within minutes [6, 7]. We attempted to mitigate these effects by standardizing blood sampling procedures to be done fasting in the morning. We did not, however, record levels of subjective perceived stress preceding the blood draw, sleep patterns or other health behaviors, thus we can not rule out that this may have influenced our results. Sample storage time in freezer differed significantly between patients and controls, but was not significantly correlated with ccf-mtDNA. Moreover, the main group effects remained significant even after taking this factor into account, making it unlikely that storage time confounded our results. The current study was originally designed to test another primary hypothesis, namely the relationship between genetic variants and suicidal behavior. Thus, we did not, a priori, power the study with the main intent to investigate differences in ccf-mtDNA between patients and controls. Although this might be considered a weakness of the study, our previous experiences using the same biomarker assay in other MDD/control cohorts (with substantially smaller sample size than the present study) showed effect sizes ranging between Cohen’s d of 0.9 [9] to Cohen’s d >2 [8]. Therefore, we believed that the current sample size would be large enough to detect a significant group difference between patients and controls. Finally, while we argue above that psychotropic medication might be a factor leading to lower ccf-mtDNA in the patient group, we did not find a significant difference in ccf-mtDNA between a small subset of the patients not taking any medications (7%) and all other patients. Potential reasons for this include that the unmedicated group might have been too small to detect a significant effect, and future larger studies should further investigate this hypothesis. In conclusion, we found that plasma ccf-mtDNA is decreased in individuals with depressive disorders compared to controls. These findings may be partly explained by concurrent psychotropic medications and psychiatric co-morbidity. Specifically, our results suggest that treatment with mood stabilizers may affect ccf-mtDNA levels, possibly as a down-stream consequence of their effect on mitochondrial enzymatic processes. Our findings suggest that ccf-mtDNA may be differentially regulated in different subtypes of depression. This hypothesis might be valuable to pursue in future studies. 21 Jun 2021 PONE-D-21-17236 Plasma circulating cell-free mitochondrial DNA in depressive disorders PLOS ONE Dear Dr. Fernström, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Aug 05 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Tadafumi Kato Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. 3. Please ensure that you refer to Figure 2 in your text as, if accepted, production will need this reference to link the reader to the figure. Additional Editor Comments (if provided): Two experts assessed the paper, and both found the importance of the study and suggested several issues to further improve the paper. Please follow the advise of the referees. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors investigated whether the plasma circulating cell-free mitochondrial DNA (ccf-mtDNA) levels differ between patients with clinical depression and healthy control in a large sample set. They showed an overall decrease in plasma ccf-mtDNA levels in patients compared to controls. This paper is well written. The study is quite interesting and significantly adds to the literature of the field. The following points should be addressed before publication. Major comments: 1)Table 1: As for the ref. 22, all the patients of ‘Current depression’ and ‘Remitted depression’ groups were diagnosed with some types of affective disorders. In table 1, it is hard to understand which affective disorder was comorbid with other psychiatric disorders. Since the number of patients in this paper increased (n = 279) compared to those of ref. 22 (n = 274), and to make a better understanding, please omit the row from ‘Bipolar disorder’ to ‘Substance or alcohol use disorder’ in table 1 and create new tables similar to table 2 and 3 of ref. 22. 2)-4) Since the ‘Current depression’ and ‘Remitted depression’ groups include major depressive disorder, bipolar disorder, and other types of affective disorders such as dysthymia and mixed anxiety and depressive disorder. The plasma ccf-mtDNA level might be affected by the ratio of the types of affective disorders. 2) Is there any difference in plasma ccf-mtDNA level among major depressive disorder patients with depressed state, major depressive disorder patients with remitted state, and controls? 3) Is there any difference in plasma ccf-mtDNA level among bipolar disorder patients with depressed state, bipolar disorder patients with remitted state, and controls? 4) Is there any difference in plasma ccf-mtDNA level between major depressive disorder patients taking mood stabilizers and those not taking mood stabilizers? Minor comment 1) Line 74 Please describe the definition of ‘difficult-to-treat depression’ briefly. If the definition of ‘difficult-to-treat depression’ is the same as of the ref.22, please cite the manuscript. 2) Line 91: What does ‘clinical depression’ mean? 3) Line 178-179 Does ‘Patients with remitted 179 depression wadid not fulfill the DSM criteria’ mean ‘Patients with remitted 179 depression did not fulfill the DSM criteria’? Reviewer #2: This study investigated ccf-mtDNA in medicated patients with depressive disorders and healthy controls. The main finding is that ccf-mtDNA is decreased in medicated patients and that ccf-mtDNA is correlated with "inflammatory depression composite score". I believe that the findings are novel and interesting, the methodology seems sound and the paper is well-written. Here are my comments: 1- Did the author calculate study power? Also, the number of controls are much lower than cases. Is that a problem to draw the conclusions? 2- if there is a difference in the handling time between patients and controls? 3- Would be interesting to examine the correlation between the amounts of medication taken and the level of ccf-mtDNA. Do the authors have this information available? 4- Based on literature, would you expect that the patients that were not under medication (6.8%) to have higher levels of ccf-mtDNA? 5- "Damage associated molecular patterns (DAMPs) are expressed on the surface of mitochondrial DNA"... is that correct? ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Yuki Kageyama Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 21 Sep 2021 Comment from editor Please ensure that you refer to Figure 2 in your text as, if accepted, production will need this reference to link the reader to the figure. Authors response: We now refer to Figure 2 in the text in the results section. Comments from Reviewer #1: The authors investigated whether the plasma circulating cell-free mitochondrial DNA (ccf-mtDNA) levels differ between patients with clinical depression and healthy control in a large sample set. They showed an overall decrease in plasma ccf-mtDNA levels in patients compared to controls. This paper is well written. The study is quite interesting and significantly adds to the literature of the field. The following points should be addressed before publication. Major comments: 1) Table 1: As for the ref. 22, all the patients of ‘Current depression’ and ‘Remitted depression’ groups were diagnosed with some types of affective disorders. In table 1, it is hard to understand which affective disorder was comorbid with other psychiatric disorders. Since the number of patients in this paper increased (n = 279) compared to those of ref. 22 (n = 274), and to make a better understanding, please omit the row from ‘Bipolar disorder’ to ‘Substance or alcohol use disorder’ in table 1 and create new tables similar to table 2 and 3 of ref. 22. Authors response: Thanks very much for this comment. The sample in reference 22 (Asp et al., Plos One) is overlapping (but not identical) to the sample in the present study. In the present study we have included all patients recruited for the study described by Asp et al (“GEN-DS”) for whom there were plasma samples and adequate clinical information available at the time of our analyses of ccf-mtDNA. In response to this comment we have now added to additional Tables (2+3). In table 2 we give a more detailed description of which subtypes of affective disorders the patients were diagnosed with. In Table 3, we show psychiatric co-morbidity in the two groups. Since the main purpose of these Tables is to give the reader a sense of the clinical characteristics of the sample, and specifically how the two main groups in or analyses (current vs remitted depression) are balanced with regards to these variables, we believe it makes more sense to show comorbidity numbers in these two, broader, groups rather than in several sets of smaller subgroups that are not a part of the main analyses. 2)-4) Since the ‘Current depression’ and ‘Remitted depression’ groups include major depressive disorder, bipolar disorder, and other types of affective disorders such as dysthymia and mixed anxiety and depressive disorder. The plasma ccf-mtDNA level might be affected by the ratio of the types of affective disorders. 2) Is there any difference in plasma ccf-mtDNA level among major depressive disorder patients with depressed state, major depressive disorder patients with remitted state, and controls? Authors response: There was no significant difference in ccf-mtDNA between unipolar MDD patients with depressed state and unipolar MDD patients with remitted state (p=0.39, one-way ANOVA), but both groups differed significantly from controls (p<0.001 and p=0.01). ccf-mtDNA was lower in both MDD groups compared to controls, just as in our main analyses. 3) Is there any difference in plasma ccf-mtDNA level among bipolar disorder patients with depressed state, bipolar disorder patients with remitted state, and controls? Authors response: There was no significant difference in ccf-mtDNA between bipolar depressed patients with depressed state and bipolar patients with remitted state (p=0.62 one-way ANOVA), but both groups differed significantly from controls (p=0.01). ccf-mtDNA was lower in both bipolar groups compared to controls, just as in our main analyses. 4) Is there any difference in plasma ccf-mtDNA level between major depressive disorder patients taking mood stabilizers and those not taking mood stabilizers? Authors response: Yes , in line with the findings that we present when all subjects are included, unipolar MDD patients with mood stabilizers had lower ccf mtDNA than those without mood stabilizers (p=0.01). Minor comment 1) Line 74 Please describe the definition of ‘difficult-to-treat depression’ briefly. If the definition of ‘difficult-to-treat depression’ is the same as of the ref.22, please cite the manuscript. Authors response: Thank you very much for this comment. We have now clarified in Methods section on page 5 that: “Patients who were previously diagnosed with an affective disorder and had an insufficient treatment response were referred to the GEN-DS study. In this study, insufficient treatment response was defined as not having achieved remission with the previous and ongoing treatments during the current depressive episode.” Please note that, for some patients, the depressive episodes were in fact judged to be in remission after detailed diagnostic assessments. The definition above refers to the instructions for the clinicians when referring patients to the study. 2) Line 91: What does ‘clinical depression’ mean? Authors response: We have revised this section (see also above) to be more consistent with the description in ref #22 (Asp et al). Please see “subject recruitment, patient cohort” in Methods section. 3) Line 178-179 Does ‘Patients with remitted 179 depression wadid not fulfill the DSM criteria’ mean ‘Patients with remitted 179 depression did not fulfill the DSM criteria’? Authors response: Yes, thanks for noticing this typo, this has been corrected. Comments from Reviewer #2: This study investigated ccf-mtDNA in medicated patients with depressive disorders and healthy controls. The main finding is that ccf-mtDNA is decreased in medicated patients and that ccf-mtDNA is correlated with "inflammatory depression composite score". I believe that the findings are novel and interesting, the methodology seems sound and the paper is well-written. Here are my comments: 1- Did the author calculate study power? Also, the number of controls are much lower than cases. Is that a problem to draw the conclusions? Authors response: The study was originally designed to test another primary hypothesis (the relationship between genetic variants and suicidal behavior). Thus, we did not, a priori, power the study with the main intent to test the hypotheses of the present study. However, previous experiences using the same biomarker assay in other MDD/control cohorts (with substantially smaller sample size than the present study) showed effect sizes ranging between Cohen’s d of 0.9 (Lindqvist et al., 2018, Neuropsychopharmacology) to Cohen’s d >2 (Lindqvist et al., 2016, Translational Psychiatry). Therefore, we deemed that the current patient and control groups would be large enough to detect a significant group difference between patients and controls. As suggested by the reviewer, similar group sizes in patients vs controls would yield greater power. In our analysis, the 95% CI for mean (log-transformed ccf-mtDNA) was 10.2-11.0 (controls), 9.6-9.9 (current depression) and 9.4-10.0 (remitted depression). 2- if there is a difference in the handling time between patients and controls? Authors response: Thanks for this comment. Patient samples had been stored longer in the freezer compared to control samples (median 4 years vs median 2 years, p<0.001, Mann-Whitney U test). Storage time was, however, not significantly correlated with ccf-mtDNA (p=0.68) and the group differences in ccf-mtDNA (controls vs ongoing depression and controls vs remitted depression) were still significant even after adjusting for storage time (f=9.3, p<0.001). Thus, we do not believe that differences in storage time had a significant impact on our results. This information has been added to the Results section. 3- Would be interesting to examine the correlation between the amounts of medication taken and the level of ccf-mtDNA. Do the authors have this information available? Authors response: Yes – that would indeed be interesting. However, we do not, at this time, have the required data regarding medication dosage or blood concentration. Analysis of how the number of different psychotropic medications correlate to ccf-mtDNA yielded no significant results. 4- Based on literature, would you expect that the patients that were not under medication (6.8%) to have higher levels of ccf-mtDNA? Authors response: Yes, based on our previous studies that would be expected. However, this has never been tested before. In our sample, it was only a very small subset of patients without medications, hence we might not have been able to detect such an effect. We have added a sentence about this in the limitations section (page 16): “Finally, while we argue above that psychotropic medication might be a factor leading to lower ccf-mtDNA in the patient group, we did not find a significant difference in ccf-mtDNA between a small subset of the patients not taking any medications (7%) and all other patients. Potential reasons for this include that the unmedicated group might have been too small to detect a significant effect, and future larger studies should further investigate this hypothesis. “ 5- "Damage associated molecular patterns (DAMPs) are expressed on the surface of mitochondrial DNA"... is that correct? Authors response: Thanks for noticing this. We have now revised: “Mitochondrial DNA can act as damage associated molecular patterns (DAMPs) triggering the innate immune response primarily through binding to the toll-like receptor 9 (TLR-9)” Submitted filename: Response to reviewers.docx Click here for additional data file. 19 Oct 2021 PONE-D-21-17236R1Plasma circulating cell-free mitochondrial DNA in depressive disordersPLOS ONE Dear Dr. Fernström, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Dec 03 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Tadafumi Kato Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): The essence of the other discussions made based on the comments by the referee 2 should also be incorporated into the manuscript, i.e., statistical power (point 1), handling time (point 2). [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Yuki Kageyama [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 20 Oct 2021 Comment from editor: The essence of the other discussions made based on the comments by the referee 2 should also be incorporated into the manuscript, i.e., statistical power (point 1), handling time (point 2). Authors response: Thanks for this comment. We have now added, to the discussion section (p17): “The current study was originally designed to test another primary hypothesis, namely the relationship between genetic variants and suicidal behavior. Thus, we did not, a priori, power the study with the main intent to investigate differences in ccf-mtDNA between patients and controls. Although this might be considered a weakness of the study, our previous experiences using the same biomarker assay in other MDD/control cohorts (with substantially smaller sample size than the present study) showed effect sizes ranging between Cohen’s d of 0.9 (9) to Cohen’s d >2 (8). Therefore, we believed that the current sample size would be large enough to detect a significant group difference between patients and controls.” In the results section (page 12) we report associations between ccf-mtDNA and handling time and we have now also added one sentence about this in the Discussion (page 16-17): “Sample storage time in freezer differed significantly between patients and controls, but was not significantly correlated with ccf-mtDNA. Moreover, the main group effects remained significant even after taking this factor into account, making it unlikely that storage time confounded our results.” Submitted filename: Response letter oct20_final.docx Click here for additional data file. 22 Oct 2021 Plasma circulating cell-free mitochondrial DNA in depressive disorders PONE-D-21-17236R2 Dear Dr. Fernström, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Tadafumi Kato Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 27 Oct 2021 PONE-D-21-17236R2 Plasma circulating cell-free mitochondrial DNA in depressive disorders Dear Dr. Fernström: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Tadafumi Kato Academic Editor PLOS ONE
Gen Primer forwardPrimer reverseAccession nr
ND2 CACACTCATCACAGCGCTAA GGATTATGGATGCGGTTGCT KJ676545
Table 1

Demographic characteristics and ccf-mtDNA in patients and controls.

Controls (n = 49)Current depression (n = 236)Remitted depression (n = 45)P-value
Age Mean ± SD36.7 ± 13.138.2 ± 13.534.0 ± 10.20.13
Sex N (%) females36 (73.5)154 (65.3)30 (66.7)0.54
BMI Mean ± SD23.8 ± 4.026.3 ± 5.325.3 ± 4.70.006
Current smokers, N (%)3 (6.1)48 (20.5)12 (26.7)0.03
MADRS score (mean, SD)na22.9 ± 7.914.6 ± 9.1<0.001
Current treatment with mood stabilizer N (%)na49 (20.8)16 (35.6)0.03
Current treatment with antipsychotic N (%)na45 (19.1)9 (20.0)0.90
Current treatment with antidepressant N (%)na192 (81.7)32 (71.1)0.20
Ccf-mtDNA (C/μl plasma) (mean, SD)105 578 ± 207 84835 683 ± 59 90626 762 ± 26 688p<0.001

Data was missing for BMI (n = 14), smoking (n = 2) and MADRS (n = 17).

Table 3

Psychiatric comorbidity in patients with current and remitted depression.

Controls (n = 49)Current depression (n = 236)Remitted depression (n = 45)P-value
Bipolar disorder N (%)na24 (10.2)12 (26.7)0.002
Personality disorder N (%)na81 (34.3)20 (44.4)0.53
Anxiety disorder N (%)na132 (55.9)24 (53.3)0.49
Substance or alcohol use disorder N (%)na12 (5.1)2 (4.4)0.82

Chi-square tests were carried out to compare current depression vs remitted depression

  40 in total

1.  Plasma mitochondrial DNA concentrations after trauma.

Authors:  Nicole Y L Lam; Timothy H Rainer; Rossa W K Chiu; Gavin M Joynt; Y M Dennis Lo
Journal:  Clin Chem       Date:  2004-01       Impact factor: 8.327

2.  Effects of mood stabilizers on mitochondrial respiratory chain activity in brain of rats treated with d-amphetamine.

Authors:  Samira S Valvassori; Gislaine T Rezin; Camila L Ferreira; Morgana Moretti; Cinara L Gonçalves; Mariana R Cardoso; Emílio L Streck; Flávio Kapczinski; João Quevedo
Journal:  J Psychiatr Res       Date:  2010-03-23       Impact factor: 4.791

Review 3.  Report by the ACNP Task Force on response and remission in major depressive disorder.

Authors:  A John Rush; Helena C Kraemer; Harold A Sackeim; Maurizio Fava; Madhukar H Trivedi; Ellen Frank; Philip T Ninan; Michael E Thase; Alan J Gelenberg; David J Kupfer; Darrel A Regier; Jerrold F Rosenbaum; Oakley Ray; Alan F Schatzberg
Journal:  Neuropsychopharmacology       Date:  2006-06-21       Impact factor: 7.853

Review 4.  Therapeutic Implications of Brain-Immune Interactions: Treatment in Translation.

Authors:  Andrew H Miller; Ebrahim Haroon; Jennifer C Felger
Journal:  Neuropsychopharmacology       Date:  2016-08-24       Impact factor: 7.853

Review 5.  Beneficial effects of mood stabilizers lithium, valproate and lamotrigine in experimental stroke models.

Authors:  Zhi-fei Wang; Emily Bame Fessler; De-Maw Chuang
Journal:  Acta Pharmacol Sin       Date:  2011-11-07       Impact factor: 6.150

Review 6.  Neurobiological basis of bipolar disorder: Mitochondrial dysfunction hypothesis and beyond.

Authors:  Tadafumi Kato
Journal:  Schizophr Res       Date:  2016-11-10       Impact factor: 4.939

Review 7.  The Mini-International Neuropsychiatric Interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10.

Authors:  D V Sheehan; Y Lecrubier; K H Sheehan; P Amorim; J Janavs; E Weiller; T Hergueta; R Baker; G C Dunbar
Journal:  J Clin Psychiatry       Date:  1998       Impact factor: 4.384

Review 8.  Advances in the understanding of mitochondrial DNA as a pathogenic factor in inflammatory diseases.

Authors:  Ray K Boyapati; Arina Tamborska; David A Dorward; Gwo-Tzer Ho
Journal:  F1000Res       Date:  2017-02-20

9.  Mitochondrial-derived N-formyl peptides: novel links between trauma, vascular collapse and sepsis.

Authors:  C F Wenceslau; C G McCarthy; S Goulopoulou; T Szasz; E G NeSmith; R C Webb
Journal:  Med Hypotheses       Date:  2013-07-24       Impact factor: 4.411

View more
  1 in total

1.  Common methods in mitochondrial research (Review).

Authors:  Yiyuan Yin; Haitao Shen
Journal:  Int J Mol Med       Date:  2022-08-25       Impact factor: 5.314

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.