Luxiang Pan1, Mingrui Du2,3, Haixia Liu4, Boyang Cheng3, Maorong Zhu3, Bo Jia5, Yinwen Wang3, Wei He1, Xiaoju Li1, Chenlin Liu1, Jintao Gu1, Meng Li1, Yingqi Zhang1, Li Yao6, Yi Zhang1, Qiang Hao1. 1. State Key Laboratory of Cancer Biology, Biotechnology Center, School of Pharmacy, Fourth Military Medical University, Xi'an, China. 2. Department of Orthopedics, Tangdu Hospital, Fourth Military Medical University, Xi'an, China. 3. School of Basic Medicine, Fourth Military Medical University, Xi'an, China. 4. Department of Gynecology and Obstetrics, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China. 5. Department of Neurosurgery, Xijing Hospital, Fourth Military Medical University, Xi'an, China. 6. Department of Pathology, Xi'an No. 3 Hospital, The Affiliated Hospital of Northwest University, Xi'an, China.
Abstract
BACKGROUND: Long non-coding RNAs (lncRNAs) have recently been found to be vital regulators of various cancers, including colorectal cancer (CRC). It has been previously reported that the dysregulated expression of lncRNA Five prime to Xist (FTX) is involved in carcinogenesis. However, the role of lncRNA FTX in the progression of CRC is still unclear. METHODS: Fluorescence in situ hybridization (FISH) was used to detect the expression of lncRNA FTX and miR-214-5p in CRC tissues. Cell Counting Kit-8 assay, transwell assay, wound-healing assay, and proliferation assay were used to explore the function of lncRNA FTX in CRC cells. Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting, and luciferase reporter assay were used to confirm the relationship between lncRNA FTX and miR-214-5p-jagged canonical Notch ligand 1 (JAG1). We further explored the role of lncRNA FTX in vivo using xenograft tumor assay. RESULTS: lncRNA FTX was found to be upregulated in CRC tissues by FISH. The downregulation of endogenous lncRNA FTX expression inhibited CRC cell proliferation, migration, and invasion. Mechanistically, lncRNA FTX sequestered miR-214-5p and thus released its repression on JAG1, driving the malignant progression of CRC. CONCLUSIONS: These findings give rise to a new perspective, the lncRNA FTX-miR-214-5p-JAG1 regulatory axis, in exploring the cancer-promoting mechanism of lncRNA FTX in CRC. 2021 Annals of Translational Medicine. All rights reserved.
BACKGROUND: Long non-coding RNAs (lncRNAs) have recently been found to be vital regulators of various cancers, including colorectal cancer (CRC). It has been previously reported that the dysregulated expression of lncRNA Five prime to Xist (FTX) is involved in carcinogenesis. However, the role of lncRNA FTX in the progression of CRC is still unclear. METHODS: Fluorescence in situ hybridization (FISH) was used to detect the expression of lncRNA FTX and miR-214-5p in CRC tissues. Cell Counting Kit-8 assay, transwell assay, wound-healing assay, and proliferation assay were used to explore the function of lncRNA FTX in CRC cells. Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting, and luciferase reporter assay were used to confirm the relationship between lncRNA FTX and miR-214-5p-jagged canonical Notch ligand 1 (JAG1). We further explored the role of lncRNA FTX in vivo using xenograft tumor assay. RESULTS: lncRNA FTX was found to be upregulated in CRC tissues by FISH. The downregulation of endogenous lncRNA FTX expression inhibited CRC cell proliferation, migration, and invasion. Mechanistically, lncRNA FTX sequestered miR-214-5p and thus released its repression on JAG1, driving the malignant progression of CRC. CONCLUSIONS: These findings give rise to a new perspective, the lncRNA FTX-miR-214-5p-JAG1 regulatory axis, in exploring the cancer-promoting mechanism of lncRNA FTX in CRC. 2021 Annals of Translational Medicine. All rights reserved.
Entities:
Keywords:
colorectal cancer (CRC); lncRNA FTX; miR-214-5p; progression
Colorectal cancer (CRC) is 1 of the 3 most frequently diagnosed cancers and the fifth leading cause of cancer-related mortality in women and men (1,2). Aggressive surgical resection and chemotherapy are the mainstays of treatment for CRC, but the 5-year survival rate for patients with advanced disease is less than 10% (3). The causative factors of CRC involve various influences, and the molecular mechanisms of tumor development are unclear (4). Therefore, it is essential to elucidate the molecular mechanisms of CRC carcinogenesis and development.Long non-coding RNAs (lncRNAs) are a large class of transcripts comprising more than 200 bases, which do not have the potential to code protein (5). LncRNAs are crucial for cell proliferation, homeostasis, and differentiation (6,7), and their expression is considered to be distorted in cancerous cells. Previous studies have reported that lncRNAs are related to a variety of malignant tumors (8). Biological research on non-coding RNAs and gene therapy strategies for lncRNAs in CRC has recently attracted much attention (9,10).The five prime to Xist (FTX) gene is a non-protein-coding gene on the human X chromosome and a conserved transcript located in X chromosome inactivation (XCI) center (11). In addition to encoding 2 miRNA molecules, FTX also encodes a highly conserved transcription product, lncRNA FTX (12). In a previously published report, the essential role of lncRNA FTX in the regulation of Xist expression was demonstrated (13). Recent studies have revealed that lncRNA FTX may affect tumor genesis and development through regulating miRNAs (14,15) and that it can act as a competing endogenous RNA to interact with miRNAs (16,17). For example, in gastric cancer, lncRNA FTX has been found to promote tumor progression by targeting miR-215 (18), and lncRNA FTX knockdown suppresses the proliferation, migration, and invasion of renal cancer cells (19). Until now, the role of abnormal expression of lncRNA FTX in cancer, including CRC, remains largely unknown.In the present study, we found that lncRNA FTX was upregulated in CRC compared with adjacent normal tissues. We also found that CRC cell proliferation, invasion, migration, and tumorigenicity were restricted after lncRNA FTX knockdown in vivo and in vitro. After antagonizing the activity of miR-214-5p, the inhibition of tumor malignant biological properties nearly disappeared. Therefore, we investigated whether lncRNA FTX might play the role of sequestering miR-214-5p from normal target jagged canonical Notch ligand 1 (JAG1). We present the following article in accordance with the ARRIVE reporting checklist (available at https://dx.doi.org/10.21037/atm-21-2755).
Methods
Cell culture conditions and cell lines
CRC cell lines SW620 and HCT116 were obtained from the China Academia Sinica Cell Repository (Shanghai, China), which were derived from a male donor. The karyotypes can be found in the research by Camps et al. (20). Fetal bovine serum (10%) and 50 units/mL penicillin/streptomycin (Gibco, CA, USA) were added to McCoy’s 5A Medium (Gibco, USA) and Dulbecco’s Modified Eagle Medium (Gibco, USA), which were respectively used to culture the HCT-116 and SW-620 cells. All cell lines were cultured in a sterile incubator at 37 °C in a humidified atmosphere containing 5% CO2.
Patients and clinical samples
In total, 17 CRC tissue specimens were collected from patients, including 5 women and 12 men who had not received radiation or chemotherapy and who underwent surgery at Xijing Hospital of the Fourth Military Medical University (FMMU; Shaanxi, China). The pathology of every sample was validated by 2 professional and independent pathologists. General clinical information was collected. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Clinical Research Ethics Committee of the Fourth Military Medical University (FMMU) (No.: 202003-183). Before enrollment in the study, written informed consent was collected from all patients.
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
TRIzol reagent (Invitrogen, CA, USA) was used to isolate the total RNA from CRC cells. In total, 1 µg total mRNA was used to compose cDNA with a kit (Promega, WI, USA) for reverse transcription-polymerase chain reaction (RT-PCR) (21); qRT-PCR was performed in 20 µL volumes with SYBR Green reagents (Takara, Japan) using the Applied Biosystems 7500 Fast System (Applied Biosystems, USA). The instrument parameters were set as follows: 1 cycle with a pre-incubation step (95 °C for 2 min) and 40 cycles with an amplification step (95 °C for 15 s and 60 °C for 60 s), followed by a melting step (95 °C for 15 s, 60 °C for 1 min, and then 95 °C continuous) and a cooling step of 1 s at 40 °C. The relative expression of mRNA was normalized to β-actin and quantified with the 2−ΔCt method. All qRT-PCR experiments were conducted 3 times. U6 and miR-214-5p primers were provided by RiboBio (Guangzhou, China). The remaining primer sequences were as follows:❖ lncRNA FTX forward: 5'- GAGGATGAATTACGGTTGCC -3'❖ lncRNA FTX reverse: 5'- CCTGAGATACCTGTTCCTTTGT -3'❖ β-actin forward: 5'-CCACGAAACTACCTTCAACTCC-3'❖ β-actin reverse: 5'-TCATACTCCTGCTGCTTGCTGATC-3'❖ JAG1 forward: 5'- ATTACCAGGATAACTGTGCGAA-3'❖ JAG1 reverse: 5'- CAAATGTGCTCCGTAGTAAGAC-3'
Western blotting
The same quantities of denatured protein samples were divided on a separated using 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis and then placed on a polyvinylidene difluoride membrane. Then, 5% skimmed milk powder dissolved in Tris-buffered saline (TBS)/0.05% Tween-20 was used to block the membranes. The cells were then incubated overnight at 4 °C. Anti-JAG1 (1:1,000; Abcam, USA) and β-actin (1:5,000; CWBIO, Wuhan, China) primary antibodies and dilutions were used according to manufacturers’ instructions. Membranes were incubated at room temperature with goat anti-mouse IRDye 800CW secondary antibody or goat anti-rabbit IRDye 800CW for 1 h. The Odyssey CLx Imaging System (LI-COR, Lincoln, NE, USA) was used to scan and analyze the images.
Cell viability assay
Each well on a 96-well plate was seeded with 5,000 cells in 100 µL of complete culture medium. After 48 h, each well was supplemented with 10 µL Cell Counting Kit-8 (CCK-8) reagent and then incubated for 2 h at 37 °C. Using a plate reader for measurement (Bio-Rad, USA), optical density (OD) at 450 nm was used to establish the rate of cell growth.
Cell migration and invasion assay
A total of 5×105 cells were added to each well in a 6-well plate and cultured for 24 h. The confluent cell monolayer was damaged after scraping it with the tip of a 200 µL pipette. A serum-free medium was added for cell culture. Observing the healing of scratches at 0 and 48 h, the wells were then photographed using a microscope. Image-Pro Plus 6.0 software was used to measure the distances.Cells were retrieved and resuspended in an incomplete medium. A total of 1×105 cells were then added into a transwell chamber (Corning, USA) preloaded with Matrigel (BD Bioscience, USA). The chamber was placed onto a 24-well plate with a complete medium containing 20% serum. After incubation for 48 h, the chamber on top was removed, and the cells remaining on the surface of the upper membrane were wiped off with cotton buds. After air drying, cells on the exterior of the lower membrane were fixated with 4% paraformaldehyde for 20 min, colored with 0.1% crystal violet, and washed 3 times before air drying. Cells were then counting using a light microscope.
Luciferase reporter assay
The sequence of wild-type (WT) and mutant-type (MUT) lncRNA FTX and mRNA 3'-untranslated region (3'-UTR) of JAG were synthesized. HCT-116 cells were then added to 24-well plates. After 24 h, cells pretreated with miR-214-5p inhibitor or pretreated mimics were transfected with reporter plasmids. Untreated CRC cells were also transfected. Luciferase activity was analyzed after 24 h in the cells. Relative light units, determined by Renilla luciferase assay, were divided by the value measured by firefly luciferase, and then the relative luciferase values were obtained.
Lentiviral, plasmid, and miRNA mimics package and cell transfection
The loss- and gain-of-function experiments were conducted by infecting HCT-116 and SW620 cells with sh-FTX or sh-Negative contril (shNC) lentivirus, which were obtained from GeneChem (Shanghai, China), at a multiplicity of infection of 10 with 8 g/mL polybrene (GeneChem, China). Four days after infection, puromycin-resistant cell lines were screened using a medium containing 2 g/mL puromycin (Thermo Fisher, USA).Transfection of human miR-214-5p mimic, miRNA negative control, and miR-214-5p inhibitor, synthesized by RiboBio (Guangzhou, China), was conducted with Lipofectamine 3000 Reagent (Invitrogen, USA) for 15 min at room temperature. The mixture was then added to the cell supernatant with a culture medium and incubated in a cell incubator for 2 days before it completely entered the cells.
Fluorescence in situ hybridization (FISH) assay
After fixation for 6 h in 4% paraformaldehyde, the CRC tissues were dried in a graded ethanol series and immersed in paraffin. The embedded tissues were sliced into sections and then incubated for 2 h at 62 °C. Next, the sections were treated according to the following sequence: 15 min with dimethylbenzene xylene, 5 min in anhydrous ethanol, 5 min in 85% alcohol, and 5 min with 75% alcohol. The tissue sections were then mounted onto slides and treated for 30 min at 37 °C with proteinase K (2 µg/mL; Servicebio, China) and 3% H2O2, followed by washing, prehybridization for 1 h at 37 °C, and hybridization (RiboBio, China) with 1 µL of hybrid solution at 46 °C overnight, which contained miR-214-5p and lncRNA FTX probes. The biotin-labeled probe (the sequence of lncRNA FTX was 5'-CT+TCGTCAACACGGCACAA+TCTACAGCATAGT+TTCTGAT+TGAGTGTGGCGCAACCGTAAT+TCAT+TCGCCCTC-3') was designed by GenePharma (Shanghai, China) and used the streptavidin-biotin system to design to detect lncRNA specifically. The sequence of miR-214-5p was 5'-GCACAGCAAGTGTAGACAGGCA-3' and was designed by Servicebio. Finally, the fluorescence signal was observed under a microscope and processing fluorescence signal strength by ImageJ software.
Immunohistochemical (IHC) analysis
Formalin and paraffin were used to fix and embed the collected tissues, respectively. The slices were dewaxed in xylene and rehydrated in alcohol. Following the blockage of non-specific antigen-binding at 37 °C with 5% bovine serum albumin (BSA) for 1 h, antibodies against Ki67 (1:200; Abcam, USA), vimentin (1:1,000; Abcam, USA), MMP3 (1:1,000; Abcam, USA), and JAG1 (1:200; Abcam, USA) were added to the slices, and the slices incubated overnight at 4 °C. The slices were then hybridized with horseradish peroxidase-labeled secondary antibody for 1 h at 37 °C. Diaminobenzidine was used to stain the samples, and hematoxylin was used to counterstain them. Representative images were observed under a microscope (IX-71; Olympus, Japan).
In vivo tumorigenesis assay
Animal experiments were performed under a project license (No.:202003-183) granted by the Institutional Animal Care and Use Committee of FMMU, in compliance with institutional guidelines for the care and use of animals. The animals were reared at the Experimental Animal Center of FMMU. We screened HCT-116 cells with stably silenced lncRNA FTX using puromycin. We used the subcutaneous xenograft mouse model to evaluate the ability of tumor formation. First, 200 µL phosphate-buffered saline was used to suspend 5×106 HCT-116 cells, subcutaneously injected into BALB/c nude mice’s right flanks (single factor experiment, n=6 per group). The miR-214-5p inhibitor and NC inhibitor used were antagomir (RiboBio, China), injected into the caudal vein. The injection volume for each nude mouse was 100 nmol, and the injection was administered twice per week. Digital calipers were used to measure the tumor dimensions every 3 days. After 4 weeks, the tumors were removed, fixed in neutral formalin, and embedded in paraffin.
Statistical analysis
GraphPad Prism version 8.0 was used to perform the statistical analysis. P<0.05 indicated statistical significance. The student’s t-test was used for the 2-group comparison. Carcinoma and adjacent tissue samples from the same patient were tested by paired t-test, and the rest were tested by unpaired t-test. One-way analysis of variance was used to compare differences between 3 or more groups. All quantitative data were expressed as mean ± standard error of the mean (SEM) (n<60) or mean ± standard deviation (SD) (n>60).
Results
Expression and location of lncRNA FTX in CRC tissues and cells
The expression of lncRNA FTX was significantly higher in CRC tissues compared with normal colon tissues based on data from Sangerbox (http://sangerbox.com/), ENCORI (http://starbase.sysu.edu.cn/panCancer.php) and Gene Expression Profiling Interactive Analysis (http://gepia.cancer-pku.cn/) ( and Figure S1A,S1B). Kaplan-Meier analysis indicated that a high expression of lncRNA FTX was associated with poor disease-free survival in 269 CRC patients (P=0.0026) (). To confirm lncRNA FTX expression in CRC tissues, we performed FISH in a tissue microarray containing 17 pairs of CRC tissues and surrounding non-cancerous tissues and found that FTX had higher expression in tumor tissues (). To further investigate the confusing location of lncRNA FTX expression, we detected the localization of lncRNA FTX in CRC cells by FISH assay. The results showed that lncRNA FTX was distributed in the CRC cell nucleus and cytoplasm (). Considering the location of lncRNA FTX on the X chromosome, we detected the expression of lncRNA FTX in different gender donor samples. We found that there was no significant difference in the expression of lncRNA FTX in CRC samples from male and female donors (Figure S1C). Therefore, lncRNA FTX was located in both the nucleus and cytoplasm and was found to be highly expressed in CRC tissues and cells.
Figure 1
Expression and location of LncRNA FTX in CRC tissues and cells. (A) Differences in LncRNA FTX expression between 458 CRC tissues and 41 normal colon tissues (data from Sangerbox). (B) Kaplan-Meier analysis showing the correlation between lncRNA FTX expression and disease-free survival of CRC patients (n=269). (C) LncRNA FTX relative expression in CRC and non-cancerous tissues in 17 paired patients. P value was established by paired t-test. (D) LncRNA FTX (green) in CRC and non-cancerous tissues was established by FISH. Nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) are shown in blue. Magnification: 100× and 400×. (E) Location of lncRNA FTX (Red) was detected by FISH assay in CRC cells. Cytoplasmic marker 18S is stained green. Magnification: 1,200×. **, P<0.01; ***, P<0.001. CRC, colorectal cancer.
Expression and location of LncRNA FTX in CRC tissues and cells. (A) Differences in LncRNA FTX expression between 458 CRC tissues and 41 normal colon tissues (data from Sangerbox). (B) Kaplan-Meier analysis showing the correlation between lncRNA FTX expression and disease-free survival of CRC patients (n=269). (C) LncRNA FTX relative expression in CRC and non-cancerous tissues in 17 paired patients. P value was established by paired t-test. (D) LncRNA FTX (green) in CRC and non-cancerous tissues was established by FISH. Nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) are shown in blue. Magnification: 100× and 400×. (E) Location of lncRNA FTX (Red) was detected by FISH assay in CRC cells. Cytoplasmic marker 18S is stained green. Magnification: 1,200×. **, P<0.01; ***, P<0.001. CRC, colorectal cancer.
Knockdown of lncRNA FTX suppressed the proliferation, migration, and invasion of CRC cells
To evaluate the function of lncRNA FTX in CRC cells, we constructed HCT-116 and SW620 cells, which stably expressed low lncRNA FTX basal level by lentivirus infection. On transduction of 3 FTX shRNAs, we found that sh-FTX 2 could effectively downregulate lncRNA FTX expression by approximately 41–57% (Figure S1D,S1E). CCK-8 assay demonstrated that lncRNA FTX knockdown significantly suppressed the proliferation of HCT-116 and SW620 cells (). Moreover, immunofluorescence (IF) assay confirmed that low levels of lncRNA FTX reduced Ki67 expression (). In addition, we conducted transwell and wound-healing assays. The results indicated that lncRNA FTX depletion significantly curtailed the migration ability of both HCT-116 cells and SW620 cells (), and suppressed CRC cell invasion (). These results confirmed that lncRNA FTX knockdown could reduce the proliferation, invasion, and migration of CRC cells in vitro.
Figure 2
LncRNA FTX knockdown suppresses the proliferation, migration, and invasion of CRC cells. (A) Cell Counting Kit-8 was used to examine the effects of knocking down lncRNA FTX on the proliferation of HCT-116 and SW620 cells. (B) Representative immunofluorescence images and the fraction of cells expressing Ki67 (Ki67+ cells/DAPI-stained cells) after lncRNA FTX knockdown in CRC cells. Magnification: 100×. (C,D) Representative images of wound-healing assays used in the evaluation of the motility of CRC cells transfected with shNC or sh-FTX. (E) Representative images of transwell invasion assays used in the evaluation of the motility of CRC cells transfected with shNC or sh-FTX, stained with 0.5% crystal violet (100×). ***, P<0.001. CRC, colorectal cancer.
LncRNA FTX knockdown suppresses the proliferation, migration, and invasion of CRC cells. (A) Cell Counting Kit-8 was used to examine the effects of knocking down lncRNA FTX on the proliferation of HCT-116 and SW620 cells. (B) Representative immunofluorescence images and the fraction of cells expressing Ki67 (Ki67+ cells/DAPI-stained cells) after lncRNA FTX knockdown in CRC cells. Magnification: 100×. (C,D) Representative images of wound-healing assays used in the evaluation of the motility of CRC cells transfected with shNC or sh-FTX. (E) Representative images of transwell invasion assays used in the evaluation of the motility of CRC cells transfected with shNC or sh-FTX, stained with 0.5% crystal violet (100×). ***, P<0.001. CRC, colorectal cancer.
LncRNA FTX sequester miR-214-5p in CRC
Although early reports indicated that lncRNA FTX might be located in the nucleus, follow-up reports have demonstrated that lncRNA FTX is localized in both the nucleus and the cytoplasm (22,23). Our results indicated that lncRNA FTX is located in the nucleus and cytoplasm of CRC cells, making it possible to interact with miRNA. Using a non-coding RNA database (starBase), we selected miR-214-5p as an alternative target of lncRNA FTX, as it has the most binding sites and rates highest on multiple prediction sites (Figure S1F). MiR-214-5p works as a tumor inhibitor in different cancers and is downregulated in CRC patients (Figure S1G) (24,25). To further verify the interaction between lncRNA FTX and miR-214-5p, a tissue chip was used to detect miR-214-5p in a previously assessed tissue microarray. As shown in ,3B, miR-214-5p was notably downregulated in CRC tissues compared with adjacent peritumoral tissues.
Figure 3
LncRNA FTX sequester miR-214-5p in CRC. (A) Relative expression level of miR-214-5p in CRC and non-cancerous tissues in 17 paired patients was analyzed. P value was established by paired t-test. (B) Representative images of miR-214-5p (green) in CRC and non-cancerous tissues were established by fluorescence in situ hybridization. Nuclei stained with DAPI are shown in blue. Magnification: 100× and 400×. (C) Association between miR-214-5p expression and lncRNA FTX in CRC tissue specimens (r2=0.2598, P<0.05). To evaluate significance, Pearson’s coefficient tests were conducted. (D) Potential binding sites of the miR-214-5p and lncRNA FTX. (E) Reporter plasmids incorporated with mutant or wild-type lncRNA FTX and miR-214-5p mimics were co-transfected into HCT-116 cells. After 48 h, luciferase activity was evaluated. (F) Quantitative real-time polymerase chain reaction assays identified the impact of miR-214-5p on lncRNA FTX expression. **, P<0.01; ***, P<0.001; NS, nonsignificant. CRC, colorectal cancer.
LncRNA FTX sequester miR-214-5p in CRC. (A) Relative expression level of miR-214-5p in CRC and non-cancerous tissues in 17 paired patients was analyzed. P value was established by paired t-test. (B) Representative images of miR-214-5p (green) in CRC and non-cancerous tissues were established by fluorescence in situ hybridization. Nuclei stained with DAPI are shown in blue. Magnification: 100× and 400×. (C) Association between miR-214-5p expression and lncRNA FTX in CRC tissue specimens (r2=0.2598, P<0.05). To evaluate significance, Pearson’s coefficient tests were conducted. (D) Potential binding sites of the miR-214-5p and lncRNA FTX. (E) Reporter plasmids incorporated with mutant or wild-type lncRNA FTX and miR-214-5p mimics were co-transfected into HCT-116 cells. After 48 h, luciferase activity was evaluated. (F) Quantitative real-time polymerase chain reaction assays identified the impact of miR-214-5p on lncRNA FTX expression. **, P<0.01; ***, P<0.001; NS, nonsignificant. CRC, colorectal cancer.Interestingly, lncRNA FTX expression had a negative correlation with that of miR-214-5p (). Therefore, we subcloned MUT and WT miR-214-5p binding sites of lncRNA FTX into dual-luciferase reporter vectors to confirm whether lncRNA FTX could regulate miR-214-5p (). The luciferase assay demonstrated that the miR-214-5p mimics downregulated the relative luciferase activity of lncRNA FTX WT-treated CRC cells but did not impact that of lncRNA FTX MUT-treated CRC cells (). The expression of miR-214-5p was upregulated with the presence of lncRNA FTX knockdown (). These findings indicate that lncRNA FTX may sequester miR-214-5p from its normal targets in CRC cells.
LncRNA FTX affects cell proliferation, migration, and invasion of CRC cells through the regulation of miR-214-5p
To confirm the involvement of miR-214-5p in lncRNA FTX-mediated tumor-promoting activity, rescue experiments were conducted to evaluate the impact of lncRNA FTX and miR-214-5p on CRC cells. CCK-8 assay demonstrated that the suppression of cell growth induced by the knockdown of lncRNA FTX was alleviated by inhibiting miR-214-5p in HCT-116 and SW620 cells (). Low levels of Ki67 expression, as determined by IF, also showed that low levels of lncRNA FTX reduced cell proliferation. In contrast, the inhibition of miR-214-5p had the opposite effect on cell proliferation (). The wound-healing assay demonstrated that lncRNA FTX knockdown significantly suppressed the migration of cells, whereas the restrain miR-214-5p abolished these effects (). Similarly, the invasive capacity of HCT-116 and SW620 cells was significantly suppressed with miR-214-5p inhibition (). These findings demonstrated that lncRNA FTX affects cell migration, invasion, and proliferation of CRC cells through miR-214-5p in CRC cells.
Figure 4
LncRNA FTX affects cell migration, invasion, and proliferation of CRC cells through the regulation of miR-214-5p. (A) Inhibition of miR-214-5p undid the reduction of lncRNA FTX-induced inhibition of HCT-116 and SW620 cell proliferation. (B) Immunofluorescence was used to determine the expression of Ki67 of CRC cell transfection with miR-214-5p inhibitor, either alone or with sh-FTX. Magnification: 100×. (C-E) Wound-healing assays and transwell invasion assays were used to assess the mobility of CRC cells transfected with miR-214-5p inhibitor, either alone or with sh-FTX. The cells were stained with 0.5% crystal violet in invasion assays (100×). ***, P<0.001. CRC, colorectal cancer.
LncRNA FTX affects cell migration, invasion, and proliferation of CRC cells through the regulation of miR-214-5p. (A) Inhibition of miR-214-5p undid the reduction of lncRNA FTX-induced inhibition of HCT-116 and SW620 cell proliferation. (B) Immunofluorescence was used to determine the expression of Ki67 of CRC cell transfection with miR-214-5p inhibitor, either alone or with sh-FTX. Magnification: 100×. (C-E) Wound-healing assays and transwell invasion assays were used to assess the mobility of CRC cells transfected with miR-214-5p inhibitor, either alone or with sh-FTX. The cells were stained with 0.5% crystal violet in invasion assays (100×). ***, P<0.001. CRC, colorectal cancer.
LncRNA FTX regulates the expression of JAG1 via miR-214-5p
To determine the effects of the lncRNA FTX-miR-214-5p axis and its downstream pathways, we used TargetScanHuman (http://www.targetscan.org) and miRBase (https://www.mirbase.org) to predict that JAG1 might be a potential target of miR-214-5p. JAG1 has key roles in tumor progression (26). Data from Sangerbox indicate that JAG1 expression is significantly different in carcinoma and paracancerous tissues in CRC patients (). Therefore, we selected JAG1 as the potential target of miR-214-5p. To test the above hypothesis, we examined its expression in miR-214-5p-overexpressing CRC cells using qRT-PCR. The results indicated that JAG1 expression significantly decreased with miR-214-5p overexpression compared to cells expressing the NC mimic empty vector (). Therefore, JAG1 was chosen as the assumed target of miR-214-5p in additional observations. We constructed JAG1 full 3'-UTRs that contained the binding site of miR-214-5p that was predicted and a mutation of the site (). The overexpression of miR-214-5p mimic reduced the luciferase activity of WT JAG1 reporters, but not the MUT reporter, as shown by luciferase assay (), indicating that JAG1 was the direct target of miR-214-5p. Furthermore, JAG1 protein levels reduced on lncRNA FTX knockdown, whereas during the rescue experiments, the miR-214-5p inhibitor could partially prevent reduction in JAG1 levels in CRC cells (). These results indicated that JAG1 was the target of miR-214-5p in CRC and that lncRNA FTX had a functional role in regulating JAG1 expression by targeting miR-214-5p.
Figure 5
LncRNA FTX regulates JAG1 expression via miR-214-5p. (A) JAG1 expression in carcinoma and adjacent tissue of CRC patients. (B) Quantitative real-time polymerase chain reaction assays revealed the impact of miR-214-5p on JAG1 protein expression. (C) Predicted binding sequence of miR-214-5p was identified on JAG1 mRNA. (D) HCT-116 cells were co-transfected with reporter plasmids (JAG1 wild type and JAG1 mutant) and miR-214-5p mimics, and luciferase activity was measured. (E) Cells with sh-FTX were additionally treated with miR-214-5p inhibitor or NC inhibitor. Western blot assays were used to determine the JAG1 protein expression levels in SW620 and HCT-116 cells. (F) Statistical data of cells with sh-FTX additionally treated with miR-214-5p inhibitor or NC inhibitor. **, P<0.01; ***, P<0.001; NS, nonsignificant. CRC, colorectal cancer.
LncRNA FTX regulates JAG1 expression via miR-214-5p. (A) JAG1 expression in carcinoma and adjacent tissue of CRC patients. (B) Quantitative real-time polymerase chain reaction assays revealed the impact of miR-214-5p on JAG1 protein expression. (C) Predicted binding sequence of miR-214-5p was identified on JAG1 mRNA. (D) HCT-116 cells were co-transfected with reporter plasmids (JAG1 wild type and JAG1 mutant) and miR-214-5p mimics, and luciferase activity was measured. (E) Cells with sh-FTX were additionally treated with miR-214-5p inhibitor or NC inhibitor. Western blot assays were used to determine the JAG1 protein expression levels in SW620 and HCT-116 cells. (F) Statistical data of cells with sh-FTX additionally treated with miR-214-5p inhibitor or NC inhibitor. **, P<0.01; ***, P<0.001; NS, nonsignificant. CRC, colorectal cancer.
LncRNA FTX knockdown inhibits CRC growth in vivo
The findings indicated that lncRNA FTX affects cell migration, invasion, and proliferation of CRC cells via the regulation of miR-214-5p. To determine the function of lncRNA FTX and miR-214-5p in tumor growth in vivo, sh-FTX HCT-116 cells were subcutaneously inoculated into nude mice. During the predetermined time following subcutaneous injection, a significant reduction in tumor growth was seen in HCT-116-sh-FTX injected mice. The miR-214-5p inhibitor could abrogate this effect, both in tumor volume and weight (). Furthermore, IHC assays indicated that decreased expression of lncRNA FTX inhibited the expression of Ki67, vimentin, and MMP3, which are markers of cell proliferation, migration, and invasion, respectively (). JAG1 expression decreased in sh-FTX tumors (). Consistent with previous data, the inhibition of miR-214-5p reversed the lncRNA FTX silencing-induced phenomenon in vivo (). These findings indicated that lncRNA FTX might play a crucial role in promoting the growth and metastasis of CRC in vivo. We demonstrated that lncRNA FTX contributes to CRC growth by sequestering miR-214-5p, which modulates JAG1 expression.
Figure 6
LncRNA FTX knockdown inhibits the growth of CRC in vivo. (A) Every 3 days, tumor volume (n=6) was measured. (B) Average weight of tumors resected from mice (n=6). (C) Pictures of the tumors from the mice at 21 days following injection with the cells as indicated. (D,E) Quantification of Ki67-, vimentin-, MMP3-, and JAG1-positive CRC cells in xenograft tumors excised from mice. (F) Representative immunohistochemical images of Ki67, vimentin, MMP3, and JAG1 expression. Magnification: 400×. Data are presented as the mean ± standard error of mean. P-value was established by unpaired t-test. **, P<0.01; ***, P<0.001. CRC, colorectal cancer.
LncRNA FTX knockdown inhibits the growth of CRC in vivo. (A) Every 3 days, tumor volume (n=6) was measured. (B) Average weight of tumors resected from mice (n=6). (C) Pictures of the tumors from the mice at 21 days following injection with the cells as indicated. (D,E) Quantification of Ki67-, vimentin-, MMP3-, and JAG1-positive CRC cells in xenograft tumors excised from mice. (F) Representative immunohistochemical images of Ki67, vimentin, MMP3, and JAG1 expression. Magnification: 400×. Data are presented as the mean ± standard error of mean. P-value was established by unpaired t-test. **, P<0.01; ***, P<0.001. CRC, colorectal cancer.
Discussion
CRC is a devastating disease that has a complicated and somewhat unclear physiopathology. Previous studies have demonstrated critical gene alterations in CRC, but targeting them as therapeutic approaches has not been successful (4). LncRNAs have recently been found to contribute clinically significantly. Some are regarded as diagnostic indicators or prognostic markers for some diseases, including various cancers (27). For instance, lncRNA H19 is regarded as a possible diagnostic parameter in breast cancer patients, and lncRNA D16366 is considered to be a reference marker for predicting the prognosis of hepatocellular carcinoma (28,29). On this basis, our group verified the upregulation of lncRNA FTX expression in CRC and subsequently confirmed the suppression of CRC tumorigenesis by silencing lncRNA FTX. Mechanistically, lncRNA FTX sequester miR-214-5p and therefore releases its repression on JAG1, driving the malignant progression of CRC. The present study’s findings provide new evidence that lncRNA FTX is associated with CRC progression and can be considered a potential prognostic biomarker.LncRNAs have been reported as being related to different cancer types due to the emerging progression of next-generation sequencing, which has increased the number of available cancer transcriptomes (30). Initially, lncRNA FTX was found to be a key factor in malignant progression, dependent on RIG-I targeting to activate PI3K/Akt in hepatocellular carcinoma cells (22), and has since been found to have a regulatory function in other cancers. Zhang et al. revealed that lncRNA FTX could promote the progression and metastasis of gastric cancer through miR-215-3p (18). Liang et al. demonstrated that FTX might select as a novel predictor for the prognostic assessment of glioma patients (31). Furthermore, Huo et al. demonstrated that the cell cytoplasm location of lncRNA FTX contributes to cell proliferation and migration in lung adenocarcinoma by targeting miR-335-5p (23). However, Liu et al. demonstrated that lncRNA FTX inhibits hepatocellular carcinoma malignant progression by binding MCM2 and miR-374a (14). The reason for this inconsistency remains largely unknown. In addition, FTX was found to be expressed at a higher level in female livers than male livers but downregulated in hepatocellular carcinoma tissues in both males and females (14). These findings indicate that FTX plays an important role in tumor progression, although the expression of FTX may have sex differences. However, none have confirmed the role of lncRNA FTX in CRC cells in vivo. Therefore, in the present study, we further revealed the function of lncRNA FTX in vitro and in vivo.An increasing number of research have demonstrated the interaction between lncRNAs and miRNAs. The association between lncRNAs and miRNAs inhibits the suppressive impact of miRNAs on their target mRNAs. For instance, lncRNA JPX functions as an internal sponge to reduce the expression of miR-33a-5p in lung cancer (32). LncRNA MALAT1, which acts working as a ceRNA, can bind to miR-200c directly and, in endometrioid endometrial carcinoma, decreases its expression (33). Therefore, we conducted a bioinformatics analysis to determine the potential downstream gene(s) of lncRNA FTX. Our findings indicated that lncRNA FTX knockdown upregulated miR-214-5p expression, and miR-214-5p attaches to lncRNA FTX in a way specific to the sequence in CRC cells.Moreover, CRC tissue microarrays in our research showed a negative correlation between lncRNA FTX and miR-214-5p in the same group. lncRNA FTX depletion could suppress the proliferation and migration of CRC cells; the addition of the miR-214-5p inhibitor weakened this inhibition. These results indicated that lncRNA FTX performed its function via miR-214-5p in CRC cells. JAG1 was found to play a vital role in the epithelial to mesenchymal transition of pancreatic cancer cells (34). In the present study, we demonstrated that JAG1 was a direct target of miR-214-5p and regulated CRC progression through the lncRNA FTX-miR-214-5p axis. It is important to note that besides regulation of JAG1, there might be also other targets mediating the tumor suppressor function of lncRNA FTX-miR-214-5p axis. In fact, there are many other target genes of miR-214-5p, such as SOX4 and KLF5, are also important in the metastasis and/or chemoresistance of cancer (35,36). Although we certified that miR-214-5p–JAG1 functions as the critical axis regulated by FTX, future studies are warranted that investigate the downstream effects of the FTX-miR-214-5p axis on CRC to broaden understanding of how CRC cells evolve and develop.In conclusion, we identified that lncRNA FTX, which is highly expressed in CRC tissues, could sequester miR-214-5p to facilitate CRC progression through the lncRNA FTX-miR-214-5p JAG1 regulatory axis. Our research not only explored the downstream regulators of lncRNA FTX but also provided new sight into the promising utility of lncRNA FTX as a target of treatment in CRC.The article’s supplementary files as
Authors: Kaijiong Zhang; Zhenglian Luo; Yi Zhang; Li Zhang; Lichun Wu; Lian Liu; Jie Yang; Xiaoyu Song; Jinbo Liu Journal: Cancer Biomark Date: 2016-06-24 Impact factor: 4.388
Authors: Xiaodong Huo; Huixing Wang; Bin Huo; Lei Wang; Kuo Yang; Jinhuan Wang; Lili Wang; Haitao Wang Journal: Cancer Cell Int Date: 2020-03-23 Impact factor: 5.722