Literature DB >> 34693907

Protein kinase Cδ is essential for the IgG response against T-cell-independent type 2 antigens and commensal bacteria.

Saori Fukao1, Kei Haniuda1, Hiromasa Tamaki1, Daisuke Kitamura1.   

Abstract

Antigens (Ags) with multivalent and repetitive structure elicit IgG production in a T-cell-independent manner. However, the mechanisms by which such T-cell-independent type-2 (TI-2) Ags induce IgG responses remain obscure. Here, we report that B-cell receptor (BCR) engagement with a TI-2 Ag but not with a T-cell-dependent (TD) Ag was able to induce the transcription of Aicda encoding activation-induced cytidine deaminase (AID) and efficient class switching to IgG3 upon costimulation with IL-1 or IFN-α in mouse B cells. TI-2 Ags strongly induced the phosphorylation of protein kinase C (PKC)δ and PKCδ mediated the Aicda transcription through the induction of BATF, the key transcriptional regulator of Aicda. In PKCδ-deficient mice, production of IgG was intact against TD Ag but abrogated against typical TI-2 Ags as well as commensal bacteria, and experimental disruption of the gut epithelial barrier resulted in fatal bacteremia. Thus, our results have revealed novel molecular requirements for class switching in the TI-2 response and highlighted its importance in homeostatic commensal-specific IgG production.
© 2021, Fukao et al.

Entities:  

Keywords:  B cells; TI-2; class switching; immune response; immunology; inflammation; mouse

Mesh:

Substances:

Year:  2021        PMID: 34693907      PMCID: PMC8610492          DOI: 10.7554/eLife.72116

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Ag-specific antibody production is essential for humoral immunity. After T-cell-dependent (TD) antigen (Ag) exposure, B cells are activated by interacting with cognate T cells and then proliferate, undergo class switching, and differentiate into plasma cells (PCs) and memory cells. In contrast, T-cell-independent (TI) Ags activate B cells without cognate help of T cells. TI type 1 (TI-1) Ags engage Toll-like receptors (TLRs) in addition to the B-cell receptor (BCR) whereas TI-2 Ags extensively crosslink the BCR because of their highly repetitive structure (Mond et al., 1995). In addition, some help from non-T cells, such as dendritic cells and innate lymphoid cells, may support B cells in a TI response (Magri et al., 2014; Balázs et al., 2002). Following activation, TI Ags induce proliferation, class switching, and antibody production by B cells. TI-2 Ags are large multivalent molecules, such as bacterial capsular polysaccharides and viral capsids, and thus antibody production against polysaccharides by the TI-2 response confers protection against disease (Mond et al., 1995; Lesinski and Westerink, 2001). To date, however, the mechanism of B-cell activation in the TI-2 response is poorly understood as compared to that in TD and TI-1 responses. Engagement of the BCR by Ag activates various signaling cascades and promotes B-cell survival, proliferation and differentiation. The antibody production in a TI-2 response, but not in a TD response, depends upon proximal BCR signaling molecules such as Btk and BLNK (Khan et al., 1995; Xu et al., 2000; Fruman et al., 2000), suggesting that BCR signaling plays a more critical role for B-cell activation in a TI-2 response than in a TD response. Given the highly repetitive structure of TI-2 Ags and the high demands for BCR signaling in TI-2 responses, TI-2 Ags seem to induce BCR signaling and the subsequent response more strongly than TD Ags. However, such functional differences between TD Ags and TI-2 Ags have not been investigated. Class (isotype) switching of the immunoglobulin (Ig) on B cells from IgM to either IgG, IgE, or IgA is caused by selective recombination of Igh constant region (CH) genes, namely class-switch recombination (CSR). Selection of the CH gene to be recombined is determined by T-cell-derived cytokines in the TD response but the mechanism in the TI-2 response is not clear. Immunization with TI-2 Ags, including NP-Ficoll and bacterial polysaccharides, predominantly elicits IgG3 (Perlmutter et al., 1978; Slack et al., 1980; Rubinstein and Stein, 1988) and IgG3 is required for protection against pneumococcal infection (McLay et al., 2002). CSR absolutely requires activation-induced cytidine deaminase (AID) (Muramatsu et al., 2000). AID deaminates deoxycytidine and introduces DNA double strand breaks (DSBs) in the switch (S) regions lying 5′ of the Cμ gene and the other targeted CH gene by triggering the DNA repair machinery (Stavnezer et al., 2008). CSR proceeds through looping-out deletion of the DNA segment intervening between Sμ and the other S region from the chromosome and religation of the DSB-free ends in the two S regions. Consequently, it leads to replacement of the Cμ gene with a different CH gene downstream of the variable region exon in the Igh locus. In a TD immune response, stimulation with CD40L and cytokines, such as IL-4 and TGFβ, induce the expression of AID and subsequent CSR in the B cell (Vaidyanathan et al., 2014; Dedeoglu et al., 2004), while signaling through TLRs, BCR, and TACI induce the expression of AID and CSR in a TI-1 response (Xu et al., 2012). On the other hand, the signaling and molecular demands for the induction of AID and CSR in the TI-2 response are far less understood, presumably due to the lack of in vitro studies that mimic a TI-2 response. Although TACI is required for IgG production in a TI-2 response (von Bülow et al., 2001), stimulation of TACI alone induces the expression of AID and IgG production only modestly (Castigli et al., 2005). Therefore, signaling through other receptors besides TACI seems to be required. As antibody production itself is disrupted in mice lacking proximal BCR signaling molecules (Khan et al., 1995; Xu et al., 2000), the requirement of BCR signaling and the downstream molecules for CSR remain unclear. Here, we report our finding that stimulation of the BCR with NP-Ficoll, a typical TI-2 Ag, triggered IgG CSR in the presence of secondary stimulation by IL-1, IFNα, or TLR ligands in vitro and that protein kinase C (PKC)δ is critical for the Ag-mediated upregulation of AID and IgG production in the TI-2 response.

Results

A TI-2 Ag induces B-cell proliferation and potentiates CSR to IgG

Considering the unique structure of TI-2 Ags, it is plausible that the engagement of the BCR with TI-2 Ags and TD Ags differently induces downstream signaling that leads to B-cell activation, although this idea has not been tested properly so far. We tested this in vitro by stimulating NP-specific B cells with the TD Ag NP-CGG or the TI-2 Ag NP-Ficoll to compare their ability to induce signaling, proliferation, and antibody production. NP-specific B cells were prepared from Igk mice (expressing only λ isotype light chain) carrying a V knock-in gene encoding a VH region which binds to NP when coupled with a λ light chain. Although NP-CGG induced little proliferation and no IgM production, NP-Ficoll induced strong proliferation and IgM production, whereas neither induced IgG production (Figure 1A and B). Thus, although NP-Ficoll alone can strongly activate B cells, additional stimulation seemed to be required for induction of class switching, similar to a previous report that anti-δ mAb/dextran and TLR ligands synergistically induced AID and CSR (Pone et al., 2012). Indeed, NP-Ficoll induced IgG production, generation of IgG+ cells and Aicda transcription in the presence of TLR ligands, LPS, R-848, or CpG, while NP-CGG did so marginally (Figure 1—figure supplement 1A-C). Besides TI-1 Ags, such as TLR ligands, we sought to identify costimulating molecules that induce class switching in the TI-2 response, some of which were suggested previously (Magri et al., 2014; Balázs et al., 2002). Since IgG3 is the most dominant class-switched Ig isotype produced in a TI-2 response, we screened various cytokines for their ability to promote the production of IgG3 in the presence of NP-Ficoll, and identified IL-1α, IL-1β, and IFNα as efficient costimuli for IgG3 production (Figure 1—figure supplement 1D and Figure 1C). These cytokines, together with NP-Ficoll, induced generation of IgG3+ cells (Figure 1D), as well as IgG1+ and IgG2b+ cells to a lesser extent (Figure 1—figure supplement 1E). In the presence of these cytokines, NP-Ficoll was far more potent than NP-CGG for IgG3 production, IgG3+ cell generation, Sµ-Sγ3 CSR (detectable as the Iγ3-Cµ transcript from the switch circle DNA) (Xu et al., 2012; Kinoshita et al., 2001), and the induction of Aicda transcription (Figure 1C–E). NP-Ficoll or each of these cytokines alone could not induce those responses (Figure 1C–E). Collectively, these results indicate that BCR signaling elicited by TI-2 Ag engagement is pivotal for the TI-2 B-cell response, namely induction of proliferation and antibody production, as well as potentiation of CSR to IgG.
Figure 1.

T-cell-independent type-2 (TI-2) antigen (Ag) distinctively induces B-cell activation and class-switch recombination (CSR) to IgG in vitro.

(A and B) Naive B cells purified from the spleen of Igk mice were stimulated with NP-CGG or NP-Ficoll. (A) 3H-thymidine incorporation on day 3. (B) IgM and IgG concentrations in the culture supernatants on day 3. (C–E) Igk B cells were stimulated with none (–), NP-CGG, or NP-Ficoll and IL-1α, IL-1β, or IFNα, as indicated. (C) Enzyme-linked immunosorbent assay (ELISA) of IgG3 in the culture supernatant on day 3. AU, arbitrary units. (D) Representative flow cytometric plots on day 3 with the numbers indicating percentages of IgG3+ B cells (top). The frequencies of IgG3+ cells among the B cells (bottom). (E) quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of the circle Iγ3-Cµ and Aicda transcripts on day 2. Data are means ± standard deviations (SDs) of two (B and C), two to three (D), or three (A) biological replicates or three technical replicates (E). The data are representative of at least three (A and B) or two (C–E) independent experiments. *p < 0.05; ***p < 0.001; ****p < 0.0001; p values were calculated by one- (B) or two (C and D)-way analysis of variance (ANOVA) with Tukey’s test.

(A–C) Igk naive B cells were stimulated with nothing (–), NP-CGG, or NP-Ficoll in the presence of LPS, R-848, or CpG. (A) IgG concentration in the culture supernatants on day 3. (B) Representative flow cytometric plots on day 3 showing percentages of IgG+ B cells. (C) qRT-PCR analysis of Aicda transcripts on day 2. (D and E) Igk naive B cells were stimulated with NP-Ficoll and each indicated cytokine. (D) IgG3 in the culture supernatants on day 4 titrated by enzyme-linked immunosorbent assay (ELISA). AU, arbitrary units. (E) Representative flow cytometric profiles of IgG1, IgG2b, IgG2c, and IgG3 on day 3 (left) and the ratio of B cells expressing these IgG subclasses estimated from the flow cytometry data (right). Data are means of three biological replicates (E), means ± standard deviations (SDs) of two biological replicates (A), or three technical replicates (C). The data are representative of two independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; p values were calculated by two-way analysis of variance (ANOVA) with Tukey’s test (A).

Figure 1—figure supplement 1.

T-cell-independent type-2 (TI-2) antigen (Ag) induces the generation of IgG+ cells in the presence of secondary stimulation.

(A–C) Igk naive B cells were stimulated with nothing (–), NP-CGG, or NP-Ficoll in the presence of LPS, R-848, or CpG. (A) IgG concentration in the culture supernatants on day 3. (B) Representative flow cytometric plots on day 3 showing percentages of IgG+ B cells. (C) qRT-PCR analysis of Aicda transcripts on day 2. (D and E) Igk naive B cells were stimulated with NP-Ficoll and each indicated cytokine. (D) IgG3 in the culture supernatants on day 4 titrated by enzyme-linked immunosorbent assay (ELISA). AU, arbitrary units. (E) Representative flow cytometric profiles of IgG1, IgG2b, IgG2c, and IgG3 on day 3 (left) and the ratio of B cells expressing these IgG subclasses estimated from the flow cytometry data (right). Data are means of three biological replicates (E), means ± standard deviations (SDs) of two biological replicates (A), or three technical replicates (C). The data are representative of two independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; p values were calculated by two-way analysis of variance (ANOVA) with Tukey’s test (A).

T-cell-independent type-2 (TI-2) antigen (Ag) distinctively induces B-cell activation and class-switch recombination (CSR) to IgG in vitro.

(A and B) Naive B cells purified from the spleen of Igk mice were stimulated with NP-CGG or NP-Ficoll. (A) 3H-thymidine incorporation on day 3. (B) IgM and IgG concentrations in the culture supernatants on day 3. (C–E) Igk B cells were stimulated with none (–), NP-CGG, or NP-Ficoll and IL-1α, IL-1β, or IFNα, as indicated. (C) Enzyme-linked immunosorbent assay (ELISA) of IgG3 in the culture supernatant on day 3. AU, arbitrary units. (D) Representative flow cytometric plots on day 3 with the numbers indicating percentages of IgG3+ B cells (top). The frequencies of IgG3+ cells among the B cells (bottom). (E) quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of the circle Iγ3-Cµ and Aicda transcripts on day 2. Data are means ± standard deviations (SDs) of two (B and C), two to three (D), or three (A) biological replicates or three technical replicates (E). The data are representative of at least three (A and B) or two (C–E) independent experiments. *p < 0.05; ***p < 0.001; ****p < 0.0001; p values were calculated by one- (B) or two (C and D)-way analysis of variance (ANOVA) with Tukey’s test.

T-cell-independent type-2 (TI-2) antigen (Ag) induces the generation of IgG+ cells in the presence of secondary stimulation.

(A–C) Igk naive B cells were stimulated with nothing (–), NP-CGG, or NP-Ficoll in the presence of LPS, R-848, or CpG. (A) IgG concentration in the culture supernatants on day 3. (B) Representative flow cytometric plots on day 3 showing percentages of IgG+ B cells. (C) qRT-PCR analysis of Aicda transcripts on day 2. (D and E) Igk naive B cells were stimulated with NP-Ficoll and each indicated cytokine. (D) IgG3 in the culture supernatants on day 4 titrated by enzyme-linked immunosorbent assay (ELISA). AU, arbitrary units. (E) Representative flow cytometric profiles of IgG1, IgG2b, IgG2c, and IgG3 on day 3 (left) and the ratio of B cells expressing these IgG subclasses estimated from the flow cytometry data (right). Data are means of three biological replicates (E), means ± standard deviations (SDs) of two biological replicates (A), or three technical replicates (C). The data are representative of two independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; p values were calculated by two-way analysis of variance (ANOVA) with Tukey’s test (A).

PKCδ is required for IgG production and AID expression induced by TI-2 Ag stimulation

By Western blot analyses for BCR signaling using NP-specific B cells, we noticed that NP-Ficoll-induced phosphorylation of PKCδ tyrosine 311 (Y311), indicative of activation of the kinase (Balasubramanian et al., 2006), more strongly than NP-CGG (Figure 2A). PKCδ belongs to a novel PKC subfamily (Salzer et al., 2016), whose function in the immune response remains elusive. Thus, we analyzed the role of PKCδ in the TI-2 response using PKCδ-deficient (Prkcd) mice. B cells from Prkcd mice normally proliferate and produce IgM when stimulated with NP-Ficoll alone (Figure 2—figure supplement 1A, B). Upon costimulation with NP-Ficoll and IL-1α, IL-1β, and IFNα, Prkcd B cells produced comparable levels of IgM but markedly reduced levels of IgG3 compared to Prkcd cells (Figure 2B). As class switching occurs along with cell division (Deenick et al., 1999), we analyzed the frequency of IgG3+ cells at each cell division using B cells labeled with CellTrace Violet (CTV). While cell division was almost equivalent between these cells after costimulation with any of the cytokines and NP-Ficoll (Figure 2—figure supplement 1C), the frequencies of IgG3+ cells barely increased at any points of cell division in Prkcd−/− cells in contrast to Prkcd+/+ cells (Figure 2C). Therefore, PKCδ is necessary for generation of IgG3+ cells regardless of cell division. Accordingly, Igh locus CSR to IgG3 assessed by the circle Iγ3-Cµ transcript and the expression of Aicda transcripts were attenuated in Prkcd B cells (Figure 2D). Collectively, these results suggest that PKCδ mediates the expression of AID and class switching to IgG3 induced by BCR stimulation with TI-2 Ag and IL-1/IFNα costimulation.
Figure 2.

Impaired T-cell-independent type-2 (TI-2) antigen (Ag)-mediated class-switch recombination (CSR) in protein kinase C (PKC)δ-deficient B cells.

(A) Immunoblot analysis of the indicated molecules in Igk B cells stimulated with NP-CGG or NP-Ficoll for the indicated time periods. (B–D) Prkcd+ Igk or Prkcd B cells were stimulated with NP-Ficoll and IL-1α, IL-1β, or IFNα. The B cells were labeled with CellTrace Violet (CTV) before culture in C. (B) Enzyme-linked immunosorbent assay (ELISA) of IgM and IgG3 in the culture supernatants on day 5. AU, arbitrary units. (C) Representative flow cytometric plots of the B cells on day 3 showing percentages of IgG3+ B cells (left). The frequencies of IgG3+ cells at each cell division number (right). (D) qRT-PCR analysis of the circle Iγ3-Cµ and Aicda transcripts on day 2. Data are means ± standard deviations (SDs) of two (B) or three (C) biological replicates or three technical replicates (D). The data are representative of at least three (A and B) or two (C and D) independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001; p values were calculated by unpaired multiple t-test (B and C).

(A and B) Prkcd+ Igk or Prkcd Igk naive B cells were cultured with medium alone (–) or NP-Ficoll. (A) 3H-thymidine incorporation on day 3. (B) IgM concentration in the culture supernatant on day 4. (C) The histogram of CellTrace Violet (CTV) in cells analyzed in Figure 2C. (D–G) Prkcd+ Igk or Prkcd− Igk naive B cells were cultured with NP-Ficoll and LPS, R-848, or CpG (D and E) or LPS, R-848, or CpG alone (F and G). (D and F) IgM and IgG concentrations in the culture supernatants on day 3. (E and G) qRT-PCR analysis of Aicda transcripts on day 2. Data are means ± standard deviation (SD) of three (A) or two to three (B), and two (D and F) biological replicates, or three technical replicates (E and G). The data are representative of two independent experiments. *p < 0.05; ***p < 0.001; p values were calculated by unpaired multiple t-test (A, B, and D).

Figure 2—figure supplement 1.

In vitro response of protein kinase C (PKC)δ-deficient B cells.

(A and B) Prkcd+ Igk or Prkcd Igk naive B cells were cultured with medium alone (–) or NP-Ficoll. (A) 3H-thymidine incorporation on day 3. (B) IgM concentration in the culture supernatant on day 4. (C) The histogram of CellTrace Violet (CTV) in cells analyzed in Figure 2C. (D–G) Prkcd+ Igk or Prkcd− Igk naive B cells were cultured with NP-Ficoll and LPS, R-848, or CpG (D and E) or LPS, R-848, or CpG alone (F and G). (D and F) IgM and IgG concentrations in the culture supernatants on day 3. (E and G) qRT-PCR analysis of Aicda transcripts on day 2. Data are means ± standard deviation (SD) of three (A) or two to three (B), and two (D and F) biological replicates, or three technical replicates (E and G). The data are representative of two independent experiments. *p < 0.05; ***p < 0.001; p values were calculated by unpaired multiple t-test (A, B, and D).

Impaired T-cell-independent type-2 (TI-2) antigen (Ag)-mediated class-switch recombination (CSR) in protein kinase C (PKC)δ-deficient B cells.

(A) Immunoblot analysis of the indicated molecules in Igk B cells stimulated with NP-CGG or NP-Ficoll for the indicated time periods. (B–D) Prkcd+ Igk or Prkcd B cells were stimulated with NP-Ficoll and IL-1α, IL-1β, or IFNα. The B cells were labeled with CellTrace Violet (CTV) before culture in C. (B) Enzyme-linked immunosorbent assay (ELISA) of IgM and IgG3 in the culture supernatants on day 5. AU, arbitrary units. (C) Representative flow cytometric plots of the B cells on day 3 showing percentages of IgG3+ B cells (left). The frequencies of IgG3+ cells at each cell division number (right). (D) qRT-PCR analysis of the circle Iγ3-Cµ and Aicda transcripts on day 2. Data are means ± standard deviations (SDs) of two (B) or three (C) biological replicates or three technical replicates (D). The data are representative of at least three (A and B) or two (C and D) independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001; p values were calculated by unpaired multiple t-test (B and C).

In vitro response of protein kinase C (PKC)δ-deficient B cells.

(A and B) Prkcd+ Igk or Prkcd Igk naive B cells were cultured with medium alone (–) or NP-Ficoll. (A) 3H-thymidine incorporation on day 3. (B) IgM concentration in the culture supernatant on day 4. (C) The histogram of CellTrace Violet (CTV) in cells analyzed in Figure 2C. (D–G) Prkcd+ Igk or Prkcd− Igk naive B cells were cultured with NP-Ficoll and LPS, R-848, or CpG (D and E) or LPS, R-848, or CpG alone (F and G). (D and F) IgM and IgG concentrations in the culture supernatants on day 3. (E and G) qRT-PCR analysis of Aicda transcripts on day 2. Data are means ± standard deviation (SD) of three (A) or two to three (B), and two (D and F) biological replicates, or three technical replicates (E and G). The data are representative of two independent experiments. *p < 0.05; ***p < 0.001; p values were calculated by unpaired multiple t-test (A, B, and D). Prkcd B cells also exhibited defects in the production of IgG and Aicda transcripts, but normal IgM production, upon stimulation with NP-Ficoll and TLR ligands (Figure 2—figure supplement 1D, E), but no defects in the production of IgM, IgG, and Aicda transcripts, upon stimulation with TLR ligands alone (Figure 2—figure supplement 1F, G). Together with the above results, PKCδ appears to be selectively required for TI-2-Ag-mediated BCR signaling to potentiate CSR to produce IgG.

PKCδ mediates IgG production in a TI-2 response in vivo

We next evaluated the contribution of PKCδ to IgG production in a TI-2 immune response using mice carrying loxP-flanked Prkcd alleles and Cd19-cre allele that lack Prkcd specifically in B cells (referred to herein as Cd19). We first examined the cellularity of mature B-cell subpopulations in such mice and their control (Cd19). The numbers of follicular and marginal zone B cells in spleens were comparable between these mice, whereas those of splenic and peritoneal B1 cell populations were slightly increased in Cd19 mice (Figure 3—figure supplement 1A). Thus, PKCδ is dispensable for the development of B cells, as previously described (Mecklenbräuker et al., 2002; Miyamoto et al., 2002).
Figure 3—figure supplement 1.

B-cell development and T-cell-dependent (TD) response of protein kinase C (PKC)δ-deficient mice.

(A) Flow cytometric analysis of spleen cells and peritoneal cavity cells of Cd19 and Cd19 mice. Gating strategy of follicular B cells (Fo B; CD19+CD43−CD21+CD23+), marginal zone B cells (MZ B; CD19+CD43−CD21highCD23low), B1a cells (CD19+CD43+CD5+), and B1b cells (CD19+CD43+CD5−) in the spleen is shown (left). The numbers of Fo B, MZ B, B1a, and B1b cells in spleen (middle) and peritoneal cavity (right) are plotted. (B) Enzyme-linked immunosorbent assay (ELISA) of anti-NP IgM, IgG1, and IgG3 in the sera of Cd19 and Cd19 mice at indicated weeks after immunization with NP-CGG in alum. AU, arbitrary units. Small horizontal bars are the means of four (A) or six (B) biological replicates. Each symbol represents an individual mouse. The data are representative of three (A) or two (B) independent experiments. *p < 0.05; ****p < 0.0001; p values were calculated by unpaired multiple t-test.

To analyze the role of PKCδ in a TI-2 response, we immunized Cd19 and the control mice with NP-Ficoll. Although the production of serum anti-NP IgM was slightly enhanced in Cd19 mice, that of anti-NP IgG3 was severely suppressed (Figure 3A), and so was that of anti-NP IgG1, IgG2b, and IgG2c (Figure 3B). We then analyzed PCs in the spleen 1 week after immunization. Among the NP-specific PCs, the proportion and the number of IgG3- and IgG2b-producing PCs were severely decreased in Cd19 mice compared to the control mice, whereas the number of IgM+ PCs was comparable between the two groups (Figure 3C). Therefore, PKCδ is required for the generation of IgG+ PCs and the subsequent production of IgG in the TI-2 response.
Figure 3.

Protein kinase C (PKC)δ is required for IgG production in T-cell-independent type-2 (TI-2) response in vivo.

(A–C) Cd19 and Cd19 mice were immunized with NP-Ficoll. (A) Enzyme-linked immunosorbent assay (ELISA) of serum anti-NP IgM and IgG3 at the indicated weeks. (B) ELISA of serum anti-NP IgG1, IgG2b, and IgG2c at 2 weeks after immunization. (C) Representative flow cytometric plots of the spleen cells on day 7 after immunization. The numbers indicate the percentage of cells in each gate (left). The frequencies of IgM+, IgG2b+, and IgG3+ cells among NP-binding plasma cells (PCs; NP+ CD138+; middle) and the numbers of such cells per 1 × 107 total lymphocytes (right) are plotted. (D) ELISA of anti-PPS3 IgM and IgG3 in the serum of Cd19 and Cd19 mice at the indicated weeks after immunization with PPS3. Results are presented in AU, arbitrary units (A, B, and D). Small horizontal bars are the means of six to eight (A and B), five (C), and eight (D) biological replicates. Each symbol represents an individual mouse. The data are representative of three (A and C) or two (B and D) independent experiments. *p < 0.05; **p < 0.01; ****p < 0.0001; p values were calculated by unpaired multiple (A, C, and D) or two-tailed unpaired Welch’s t-test (B).

(A) Flow cytometric analysis of spleen cells and peritoneal cavity cells of Cd19 and Cd19 mice. Gating strategy of follicular B cells (Fo B; CD19+CD43−CD21+CD23+), marginal zone B cells (MZ B; CD19+CD43−CD21highCD23low), B1a cells (CD19+CD43+CD5+), and B1b cells (CD19+CD43+CD5−) in the spleen is shown (left). The numbers of Fo B, MZ B, B1a, and B1b cells in spleen (middle) and peritoneal cavity (right) are plotted. (B) Enzyme-linked immunosorbent assay (ELISA) of anti-NP IgM, IgG1, and IgG3 in the sera of Cd19 and Cd19 mice at indicated weeks after immunization with NP-CGG in alum. AU, arbitrary units. Small horizontal bars are the means of four (A) or six (B) biological replicates. Each symbol represents an individual mouse. The data are representative of three (A) or two (B) independent experiments. *p < 0.05; ****p < 0.0001; p values were calculated by unpaired multiple t-test.

Protein kinase C (PKC)δ is required for IgG production in T-cell-independent type-2 (TI-2) response in vivo.

(A–C) Cd19 and Cd19 mice were immunized with NP-Ficoll. (A) Enzyme-linked immunosorbent assay (ELISA) of serum anti-NP IgM and IgG3 at the indicated weeks. (B) ELISA of serum anti-NP IgG1, IgG2b, and IgG2c at 2 weeks after immunization. (C) Representative flow cytometric plots of the spleen cells on day 7 after immunization. The numbers indicate the percentage of cells in each gate (left). The frequencies of IgM+, IgG2b+, and IgG3+ cells among NP-binding plasma cells (PCs; NP+ CD138+; middle) and the numbers of such cells per 1 × 107 total lymphocytes (right) are plotted. (D) ELISA of anti-PPS3 IgM and IgG3 in the serum of Cd19 and Cd19 mice at the indicated weeks after immunization with PPS3. Results are presented in AU, arbitrary units (A, B, and D). Small horizontal bars are the means of six to eight (A and B), five (C), and eight (D) biological replicates. Each symbol represents an individual mouse. The data are representative of three (A and C) or two (B and D) independent experiments. *p < 0.05; **p < 0.01; ****p < 0.0001; p values were calculated by unpaired multiple (A, C, and D) or two-tailed unpaired Welch’s t-test (B).

B-cell development and T-cell-dependent (TD) response of protein kinase C (PKC)δ-deficient mice.

(A) Flow cytometric analysis of spleen cells and peritoneal cavity cells of Cd19 and Cd19 mice. Gating strategy of follicular B cells (Fo B; CD19+CD43−CD21+CD23+), marginal zone B cells (MZ B; CD19+CD43−CD21highCD23low), B1a cells (CD19+CD43+CD5+), and B1b cells (CD19+CD43+CD5−) in the spleen is shown (left). The numbers of Fo B, MZ B, B1a, and B1b cells in spleen (middle) and peritoneal cavity (right) are plotted. (B) Enzyme-linked immunosorbent assay (ELISA) of anti-NP IgM, IgG1, and IgG3 in the sera of Cd19 and Cd19 mice at indicated weeks after immunization with NP-CGG in alum. AU, arbitrary units. Small horizontal bars are the means of four (A) or six (B) biological replicates. Each symbol represents an individual mouse. The data are representative of three (A) or two (B) independent experiments. *p < 0.05; ****p < 0.0001; p values were calculated by unpaired multiple t-test. The capsular polysaccharides of Streptococcus pneumoniae, such as pneumococcal polysaccharide serotype 3 (PPS3), are also classified as TI-2 Ags, and immunization with PPS3 is known to induce an Ag-specific IgG3 response (McLay et al., 2002). Thus, we next immunized Cd19 and control mice with PPS3. Although early production of anti-PPS3 IgM was modestly enhanced in Cd19 mice, production of anti-PPS3 IgG3 was ablated in these mice (Figure 3D). Thus, PKCδ appears to be generally required for IgG production in response to a variety of TI-2 Ags. We next assessed whether PKCδ is also required for IgG production in a TD response. After immunization with NP-CGG, the production of anti-NP IgM was transiently enhanced in Cd19 mice at 1 week, whereas anti-NP IgG1 and IgG3 titers were normal in these mice (Figure 3—figure supplement 1B). These data indicated that PKCδ signaling is required for IgG production in a TI-2 response, but not in a TD response.

PKCδ mediates class switching through induction of AID in a TI-2 response in vivo

We next assessed whether PKCδ mediates IgG production through class switching in an in vivo TI-2 response. To discriminate Ag-specific B-cell responses, we transferred CTV-labeled naive B cells from B1-8 CD45.1 mice into C57BL/6 (B6) mice, which were immunized with NP-Ficoll on the next day and analyzed by flow cytometry 3 days later. About 30% of the splenic donor cells were IgG3+ in the mice transferred with control B cells, whereas only about 3% were IgG3+ in recipients of Cd19 B cells (Figure 4A). IgG3+ cells emerged at the second cell division and their frequency was increased as the cell division proceeded in the cells of control mice, whereas the frequency of IgG3+ cells was extremely low in the cells of Cd19 mice at any point of cell division (Figure 4A). Thus, PKCδ mediates the generation of IgG3+ cells in a manner unrelated to cell division.
Figure 4.

Protein kinase C (PKC)δ signaling promotes IgG class switching by inducing activation-induced cytidine deaminase (AID).

(A and B) B cells purified from Prkcd or Prkcd mice were labeled with CellTrace Violet (CTV) and transferred into B6 mice, which were immunized with NP-Ficoll on the next day. Spleen cells were analyzed 3 days later. (A) Representative flow cytometric plots of the spleen cells with the numbers indicating percentages of the cells within the neighboring gates (left). The frequency of IgG3+ cells among whole donor B cells (CD45.1+ CD19+ CD138–) (middle) and at each cell division number (right) are shown. (B) qRT-PCR analysis of the indicated transcripts in the donor B cells collected as in Figure 4—figure supplement 1A. (C) Prkcd or Prkcd B cells transduced with an empty vector (Ev) or vectors expressing AID or PKCδ were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day as in Figure 4—figure supplement 1B. Representative flow cytometry plots of the donor cells transduced with the vectors (CD45.1+GFP+, gated as in Figure 4—figure supplement 1C) (left) and the frequency of IgG3+ cells among the CD45.1+GFP+ cells (right) on day 3 after transfer. Small horizontal bars are the means of five (A) or six to nine (C) biological replicates. Each symbol represents an individual mouse (A, middle; C). The symbols are the means of five biological replicates (A, right). Data are means ± standard deviations (SDs) of three technical replicates pooled from five mice (B). The data are representative of three (A) or two (B) independent experiments or is pooled from two independent experiments (C). ns, not significant (p > 0.05); **p < 0.01; ****p < 0.0001; p values were calculated by unpaired multiple t-test (A) or one-way analysis of variance (ANOVA) with Tukey’s test (C).

(A) Sorting strategy for donor B cells used in Figure 4B. The starting population was spleen cells of B6 mice transferred with Prkcd or Prkcd, CD45.1+ B cells and immunized with NP-Ficoll 3 days previously. CD45.1+ cells were enriched by a MACS system (left) and then donor B cells (CD45.1+CD19+CD138−) were further sorted by flow cytometry (right). (B and C) Strategy for retrovirus (Rv) transduction and the analysis of the TI-2 response (B, left). B cells collected from Prkcd or Prkcd mice immunized with NP-Ficoll 1 day previously were infected with Rv and cultured for 1 day. Some Rv-transduced cells were further cultured in medium for 6 hr and analyzed by flow cytometry. Representative data of the cells transduced with pMXs-IRES-GFP empty vector (Ev) is shown (B, right). Other Rv-transduced cells were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day. Spleen cells of recipient mice were analyzed or used for cell sorting 3 or 4 days later. Gating strategy of donor cells transduced with vectors (CD45.1+ GFP+) and the expression profile of IgG3 are shown (C, left). After the enrichment of CD45.1+ cells by a MACS system, the vector-transduced donor B cells (CD45.1+ GFP+ CD19+ CD138–) were sorted as shown (C, right). The data are representative of at least three independent experiments.

Protein kinase C (PKC)δ signaling promotes IgG class switching by inducing activation-induced cytidine deaminase (AID).

(A and B) B cells purified from Prkcd or Prkcd mice were labeled with CellTrace Violet (CTV) and transferred into B6 mice, which were immunized with NP-Ficoll on the next day. Spleen cells were analyzed 3 days later. (A) Representative flow cytometric plots of the spleen cells with the numbers indicating percentages of the cells within the neighboring gates (left). The frequency of IgG3+ cells among whole donor B cells (CD45.1+ CD19+ CD138–) (middle) and at each cell division number (right) are shown. (B) qRT-PCR analysis of the indicated transcripts in the donor B cells collected as in Figure 4—figure supplement 1A. (C) Prkcd or Prkcd B cells transduced with an empty vector (Ev) or vectors expressing AID or PKCδ were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day as in Figure 4—figure supplement 1B. Representative flow cytometry plots of the donor cells transduced with the vectors (CD45.1+GFP+, gated as in Figure 4—figure supplement 1C) (left) and the frequency of IgG3+ cells among the CD45.1+GFP+ cells (right) on day 3 after transfer. Small horizontal bars are the means of five (A) or six to nine (C) biological replicates. Each symbol represents an individual mouse (A, middle; C). The symbols are the means of five biological replicates (A, right). Data are means ± standard deviations (SDs) of three technical replicates pooled from five mice (B). The data are representative of three (A) or two (B) independent experiments or is pooled from two independent experiments (C). ns, not significant (p > 0.05); **p < 0.01; ****p < 0.0001; p values were calculated by unpaired multiple t-test (A) or one-way analysis of variance (ANOVA) with Tukey’s test (C).
Figure 4—figure supplement 1.

Gating strategies.

(A) Sorting strategy for donor B cells used in Figure 4B. The starting population was spleen cells of B6 mice transferred with Prkcd or Prkcd, CD45.1+ B cells and immunized with NP-Ficoll 3 days previously. CD45.1+ cells were enriched by a MACS system (left) and then donor B cells (CD45.1+CD19+CD138−) were further sorted by flow cytometry (right). (B and C) Strategy for retrovirus (Rv) transduction and the analysis of the TI-2 response (B, left). B cells collected from Prkcd or Prkcd mice immunized with NP-Ficoll 1 day previously were infected with Rv and cultured for 1 day. Some Rv-transduced cells were further cultured in medium for 6 hr and analyzed by flow cytometry. Representative data of the cells transduced with pMXs-IRES-GFP empty vector (Ev) is shown (B, right). Other Rv-transduced cells were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day. Spleen cells of recipient mice were analyzed or used for cell sorting 3 or 4 days later. Gating strategy of donor cells transduced with vectors (CD45.1+ GFP+) and the expression profile of IgG3 are shown (C, left). After the enrichment of CD45.1+ cells by a MACS system, the vector-transduced donor B cells (CD45.1+ GFP+ CD19+ CD138–) were sorted as shown (C, right). The data are representative of at least three independent experiments.

Gating strategies.

(A) Sorting strategy for donor B cells used in Figure 4B. The starting population was spleen cells of B6 mice transferred with Prkcd or Prkcd, CD45.1+ B cells and immunized with NP-Ficoll 3 days previously. CD45.1+ cells were enriched by a MACS system (left) and then donor B cells (CD45.1+CD19+CD138−) were further sorted by flow cytometry (right). (B and C) Strategy for retrovirus (Rv) transduction and the analysis of the TI-2 response (B, left). B cells collected from Prkcd or Prkcd mice immunized with NP-Ficoll 1 day previously were infected with Rv and cultured for 1 day. Some Rv-transduced cells were further cultured in medium for 6 hr and analyzed by flow cytometry. Representative data of the cells transduced with pMXs-IRES-GFP empty vector (Ev) is shown (B, right). Other Rv-transduced cells were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day. Spleen cells of recipient mice were analyzed or used for cell sorting 3 or 4 days later. Gating strategy of donor cells transduced with vectors (CD45.1+ GFP+) and the expression profile of IgG3 are shown (C, left). After the enrichment of CD45.1+ cells by a MACS system, the vector-transduced donor B cells (CD45.1+ GFP+ CD19+ CD138–) were sorted as shown (C, right). The data are representative of at least three independent experiments. We next analyzed molecular events associated with CSR in sorted donor cells (Figure 4—figure supplement 1A). The amounts of the Iγ3-Cµ circle transcripts and the Iµ-Cγ3 early postswitch transcripts were far less in Cd19 B cells compared to control cells, indicating fewer CSR events in the former in vivo (Figure 4B). The expression of Iµ-Cµ and Iγ3-Cγ3 germline transcripts was comparable between the Cd19 B cells and the control cells, whereas the expression of Aicda was substantially reduced in the former (Figure 4B). These results indicate that PKCδ mediates CSR to IgG3 through upregulation of AID mRNA, but not through the activation of Ig gene S regions in B cells responding to TI-2 Ags in vivo. To examine whether the reduction of AID is a primary reason for the impaired generation of IgG3+ cells from PKCδ-deficient B cells, we transduced AID into in vivo primed Cd19 B cells and transferred them into B6 mice that had been immunized with NP-Ficoll 1 day previously (Figure 4—figure supplement 1B). The reconstitution of AID expression restored IgG3 class switching to a frequency comparable to the same cells reconstituted with PKCδ (Figure 4—figure supplement 1C and Figure 4C). Collectively, these results indicate that PKCδ mediates class switching to IgG3 by upregulating the expression of AID in the TI-2 response.

PKCδ upregulates the transcription of Aicda through BATF

It has been shown that expression of Aicda gene is regulated by various transcriptional factors (Vaidyanathan et al., 2014; Tran et al., 2010; Crouch et al., 2007). To assess the role of PKCδ in Aicda gene expression, we quantified expression levels of the genes encoding such transcription factors in PKCδ-sufficient and PKCδ-deficient B cells collected from mice immunized with NP-Ficoll. Among the genes tested, we found that the amount of Batf mRNA was markedly lower in Cd19 B cells than in control cells (Figure 5A). The expression of BATF mRNA and protein was induced by in vitro stimulation with NP-Ficoll alone in PKCδ-sufficient B cells, but only marginally in PKCδ-deficient B cells (Figure 5B and C), whereas BATF expression was not induced by NP-CGG (Figure 5B and Figure 5—figure supplement 1A). IL-1α, IL-1β, or IFNα did not augment the phosphorylation of PKCδ nor induce Batf expression nor enhance the NP-Ficoll-induced Batf expression (Figure 5B and Figure 5—figure supplement 1B-D). Collectively, these data indicate that PKCδ induces the expression of BATF downstream of the BCR in the TI-2 response.
Figure 5.

Protein kinase C (PKC)δ regulates IgG class switching by upregulating BATF expression.

(A) qRT-PCR analysis of the transcripts of the indicated genes in Prkcd or Prkcd donor B cells (CD45.1+CD19+CD138−) purified as in Figure 4—figure supplement 1A from the recipient mice immunized with NP-Ficoll 3 days previously. Shown is the relative expression of each gene in Prkcd cells to that in Prkcd cells. (B) qRT-PCR analysis of Batf transcripts in Prkcd+ Igk or Prkcd B cells cultured with medium alone (–) or with the indicated stimuli for 2 days. (C) Immunoblot analysis in Prkcd+ Igk or Prkcd B cells stimulated with NP-Ficoll for the indicated times. (D and E) B1-8 B cells transduced with knockdown vectors for luciferase (shControl) or BATF (shBATF) were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day as in Figure 4—figure supplement 1B, and their spleen cells were analyzed on day 4 after transfer. (D) qRT-PCR analysis of Aicda and Batf transcripts in the vector-transduced donor B cells (CD45.1+ GFP+ CD19+ CD138−) collected as in Figure 4—figure supplement 1C. (E) Representative flow cytometric plots of the transduced donor cells with the numbers indicating the percentage of IgG3+ cells (left) and the frequency of the IgG3+ cells among such cells (right) gated as in Figure 4—figure supplement 1C. (F and G) Prkcd B cells transduced with Ev or vectors expressing BATF or PKCδ were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day, and their spleen cells were analyzed 3 days after transfer. (F) qRT-PCR analysis of Aicda transcripts in the vector-transduced donor B cells. (G) Representative flow cytometric plots of the transduced donor cells with the numbers indicating the percentage of IgG3+ cells (left) and the frequency of the IgG3+ cells among such cells (right). Data are means ± standard deviations (SDs) of three technical replicates (A, B, D, and F). Samples were pooled from five to eight mice (D and F). Small horizontal bars are the means of four (E) or eight to nine (G) biological replicates. Each symbol represents an individual mouse (E and G). The data are representative of two independent experiments (A–F) or are pooled from two independent experiments (G). ***p < 0.001; ****p < 0.0001; p values were calculated by two-tailed unpaired Student’s t-test (E) or one-way analysis of variance (ANOVA) with Tukey’s test (G).

(A–C) Immunoblot analysis of Igk B cells stimulated with the indicated reagents for the indicated times (A and C) or 5 min (B). (D) qRT-PCR analysis of Batf transcripts in Prkcd+ Igk or Prkcd B cells cultured with the indicated reagents for 2 days. The data are representative of two independent experiments.

Figure 5—figure supplement 1.

The expression of BATF and the phosphorylation of protein kinase C (PKC)δ.

(A–C) Immunoblot analysis of Igk B cells stimulated with the indicated reagents for the indicated times (A and C) or 5 min (B). (D) qRT-PCR analysis of Batf transcripts in Prkcd+ Igk or Prkcd B cells cultured with the indicated reagents for 2 days. The data are representative of two independent experiments.

Protein kinase C (PKC)δ regulates IgG class switching by upregulating BATF expression.

(A) qRT-PCR analysis of the transcripts of the indicated genes in Prkcd or Prkcd donor B cells (CD45.1+CD19+CD138−) purified as in Figure 4—figure supplement 1A from the recipient mice immunized with NP-Ficoll 3 days previously. Shown is the relative expression of each gene in Prkcd cells to that in Prkcd cells. (B) qRT-PCR analysis of Batf transcripts in Prkcd+ Igk or Prkcd B cells cultured with medium alone (–) or with the indicated stimuli for 2 days. (C) Immunoblot analysis in Prkcd+ Igk or Prkcd B cells stimulated with NP-Ficoll for the indicated times. (D and E) B1-8 B cells transduced with knockdown vectors for luciferase (shControl) or BATF (shBATF) were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day as in Figure 4—figure supplement 1B, and their spleen cells were analyzed on day 4 after transfer. (D) qRT-PCR analysis of Aicda and Batf transcripts in the vector-transduced donor B cells (CD45.1+ GFP+ CD19+ CD138−) collected as in Figure 4—figure supplement 1C. (E) Representative flow cytometric plots of the transduced donor cells with the numbers indicating the percentage of IgG3+ cells (left) and the frequency of the IgG3+ cells among such cells (right) gated as in Figure 4—figure supplement 1C. (F and G) Prkcd B cells transduced with Ev or vectors expressing BATF or PKCδ were transferred into B6 mice that had been immunized with NP-Ficoll on the previous day, and their spleen cells were analyzed 3 days after transfer. (F) qRT-PCR analysis of Aicda transcripts in the vector-transduced donor B cells. (G) Representative flow cytometric plots of the transduced donor cells with the numbers indicating the percentage of IgG3+ cells (left) and the frequency of the IgG3+ cells among such cells (right). Data are means ± standard deviations (SDs) of three technical replicates (A, B, D, and F). Samples were pooled from five to eight mice (D and F). Small horizontal bars are the means of four (E) or eight to nine (G) biological replicates. Each symbol represents an individual mouse (E and G). The data are representative of two independent experiments (A–F) or are pooled from two independent experiments (G). ***p < 0.001; ****p < 0.0001; p values were calculated by two-tailed unpaired Student’s t-test (E) or one-way analysis of variance (ANOVA) with Tukey’s test (G).

The expression of BATF and the phosphorylation of protein kinase C (PKC)δ.

(A–C) Immunoblot analysis of Igk B cells stimulated with the indicated reagents for the indicated times (A and C) or 5 min (B). (D) qRT-PCR analysis of Batf transcripts in Prkcd+ Igk or Prkcd B cells cultured with the indicated reagents for 2 days. The data are representative of two independent experiments. It was reported that BATF binds to a regulatory region of the Aicda gene to directly promote its expression and that IgG3 production against TNP-Ficoll was impaired in Batf mice (Ise et al., 2011). Therefore, we next asked whether the defect of BATF expression is responsible for the suppression of AID expression and IgG3+ cell generation in PKCδ-deficient mice. First, we knocked down BATF in B1-8 B cells and transferred them into mice immunized with NP-Ficoll. Both the expression of Aicda and the frequency of IgG3+ cells were significantly decreased in BATF knockdown cells compared with the mock-transduced control cells (Figure 5D and E). Conversely, forced expression of BATF in B1-8 B cells partially but significantly restored Aicda expression and the generation of IgG3+ cells in the recipient mice immunized with NP-Ficoll (Figure 5F and G). Taken together, these data indicate that PKCδ mediates expression of AID and class switching to IgG3 through upregulation of BATF expression in B cells undergoing a TI-2 response.

PKCδ is required for homeostatic antibacterial IgG3 production and protection against bacteremia

Recent works have revealed that commensal microbes induce an IgG response and confer protection against systemic bacterial infection (Zeng et al., 2016). Among antibacterial IgG, IgG3 is most abundant and produced in a TI manner (Ansaldo et al., 2019; Koch et al., 2016). Therefore, we assessed the contribution of PKCδ in IgG-mediated antibacterial responses. To standardize the microbiota, we cohoused control and Cd19 mice over 4 weeks and serum antibodies against fecal bacteria were titrated. Production of serum antibacterial IgM, IgG1, and IgG2b was not changed significantly, but that of IgG3 was severely impaired in Cd19 mice (Figure 6A). Antibacterial IgG2c was undetectable in both mouse groups (data not shown). Given that PKCδ was required for production of all IgG subclasses in the anti-NP TI-2 response (Figure 3), the PKCδ-independent production of antibacterial IgG1 and IgG2b may be attributable to TD responses, as reported for IgG1 (Ansaldo et al., 2019), while antibacterial IgG3 is mainly produced by the TI-2 response.
Figure 6.

Protein kinase C (PKC)δ is required for protective antibacterial IgG3 production.

Cd19 and Cd19 mice were cohoused for at least 4 weeks and treated with 3 % dextran sodium sulfate (DSS) for 7 days. (A) Serum IgM, IgG1, IgG2b, and IgG3 against fecal bacteria after cohousing were quantified by enzyme-linked immunosorbent assay (ELISA). AU, arbitrary units. (B) Colony-forming unit (CFU) of aerobes and anaerobes in the blood 7 days after DSS treatment. (C) Kaplan–Meier survival plot of 16 (Cd19) and 12 (Cd19) mice at indicated days. Small horizontal bars are the means of 7 (A), or 15 (Cd19) or 11 (Cd19) in (B), biological replicates. Data were obtained from 16 (Cd19) or 12 (Cd19) mice in (C). Each symbol represents an individual mouse (A and B). The data are representative of two independent experiments (A) or pooled from two independent experiments (B and C). **p < 0.01; ***p < 0.001; p values were calculated by two-tailed unpaired Welch’s t-test (A), unpaired multiple t-test (B), or log-rank test (C).

Protein kinase C (PKC)δ is required for protective antibacterial IgG3 production.

Cd19 and Cd19 mice were cohoused for at least 4 weeks and treated with 3 % dextran sodium sulfate (DSS) for 7 days. (A) Serum IgM, IgG1, IgG2b, and IgG3 against fecal bacteria after cohousing were quantified by enzyme-linked immunosorbent assay (ELISA). AU, arbitrary units. (B) Colony-forming unit (CFU) of aerobes and anaerobes in the blood 7 days after DSS treatment. (C) Kaplan–Meier survival plot of 16 (Cd19) and 12 (Cd19) mice at indicated days. Small horizontal bars are the means of 7 (A), or 15 (Cd19) or 11 (Cd19) in (B), biological replicates. Data were obtained from 16 (Cd19) or 12 (Cd19) mice in (C). Each symbol represents an individual mouse (A and B). The data are representative of two independent experiments (A) or pooled from two independent experiments (B and C). **p < 0.01; ***p < 0.001; p values were calculated by two-tailed unpaired Welch’s t-test (A), unpaired multiple t-test (B), or log-rank test (C). We further asked whether regulation of commensal bacteria is defective in the PKCδ-deficient mice. Dextran sodium sulfate (DSS) treatment is known to disrupt the gut epithelium and to allow intestinal bacteria to translocate throughout the body. Subsequently, it leads to fatal bacteremia in the absence of microbiota-specific IgG (Zeng et al., 2016). After the treatment with DSS, Cd19 mice exhibited increased numbers of aerobic and anaerobic bacteria in the blood compared to control mice (Figure 6B). Accordingly, the mortality of Cd19 mice was significantly higher than that of control mice (Figure 6C). Collectively, these results suggest that IgG3 production by a TI-2 response via PKCδ prevents lethal bacteremia.

Discussion

Although previous reports showed that proximal BCR signal molecules such as BLNK or Btk are necessary for B-cell activation and subsequent IgM and IgG production in the TI-2 response in mice (Xu et al., 2000; Ellmeier et al., 2000), it was not clear whether there are any specific BCR signaling pathways inducing CSR. Here, we demonstrated that BCR stimulation with a TI-2 Ag (NP-Ficoll), but not a TD Ag (NP-CGG), both sharing the same BCR epitope, promoted transcription of Aicda and induced IgG3 CSR in the presence of a secondary stimulation. BCR engagement with a TI-2 Ag induced the phosphorylation of PKCδ and PKCδ was required for upregulation of BATF expression, thereby mediated the induction of Aicda transcription and subsequent CSR to the IgG subclasses (Figure 7). By contrast, PKCδ was dispensable for TI-2 Ag-mediated B-cell proliferation, IgM production, as well as for B-cell development and the TD response. Thus, we have found for the first time, as far as we know, a BCR signaling molecule that is selectively required for CSR in the TI-2 response.
Figure 7.

Working model of the protein kinase C (PKC)δ-mediated induction of class-switch recombination (CSR) in the T-cell-independent type-2 (TI-2) response.

B-cell receptor (BCR) stimulation with a TI-2 antigen (Ag) activates PKCδ signaling and induces the expression of BATF, which works cooperatively with secondary signals induced by IL-1α/β, IFNα, or TLR ligands and drives the transcription of activation-induced cytidine deaminase (AID) to induce IgG CSR.

Working model of the protein kinase C (PKC)δ-mediated induction of class-switch recombination (CSR) in the T-cell-independent type-2 (TI-2) response.

B-cell receptor (BCR) stimulation with a TI-2 antigen (Ag) activates PKCδ signaling and induces the expression of BATF, which works cooperatively with secondary signals induced by IL-1α/β, IFNα, or TLR ligands and drives the transcription of activation-induced cytidine deaminase (AID) to induce IgG CSR. TI-2 Ags such as NP-Ficoll can induce antibody response in the absence of major histocompatibility complex class II-restricted T cell help or MyD88-mediated TLR receptor signaling (Gavin et al., 2006; Hou et al., 2011). Thus, it has been unclear whether any costimulation is necessary for B-cell activation in a TI-2 response. We demonstrated that NP-Ficoll, but not NP-CGG, was able to activate NP-specific naive B cells to induce proliferation, antibody production, and potentiation for CSR in vitro. Thus, despite sharing the same antigenic epitope (NP) at a similar average number per molecule, these Ags appear to elicit disparate BCR signal transduction. After Ag binding, the BCR is clustered and recruited to lipid microdomains, in which signaling proteins are localized that trigger B-cell activation signaling (Niiro and Clark, 2002). Ag structure probably affects such BCR dynamics or membrane organization of signal components. Consistently, it was previously reported that a high-valency TI-2 Ag induces the formation of large BCR clusters in the lipid microdomains (Puffer et al., 2007). We have revealed that, in the TI-2 response, BCR-downstream signaling through PKCδ is critical for CSR and generation of IgG. PKCδ is known to control Ag-induced tolerance in immature B cells (Mecklenbräuker et al., 2002; Limnander et al., 2011). However, a possible alteration of the mature B-cell repertoire in PKCδ-deficient mice is not attributable to the defective class switching to IgG3, since the defect was obvious in the NP-Ficoll response by PKCδ-deficient, B1-8VH-knock-in B cells with a monoclonal anti-NP repertoire. Here, we demonstrated that PKCδ mediated the expression of AID to induce CSR. BCR engagement with a TI-2 Ag induced the expression of BATF via PKCδ and BATF was required for the transcription of the Aicda gene in a TI-2 response, as reported previously (Ise et al., 2011). Forced expression of BATF in PKCδ-deficient B cells restored the expression of AID and IgG3 class switching significantly, but less effectively, than that of PKCδ itself. In this regard, various transcription factors have been reported to cooperatively induce the transcription of AID in the TD response (Vaidyanathan et al., 2014; Crouch et al., 2007; Tran et al., 2010). Although we have not assessed the contribution of other transcription factors in the TI-2 response, since the expression of other candidate genes was intact in PKCδ-deficient B cells (Figure 5A), PKCδ signaling might regulate other transcription factors in addition to BATF to fully upregulate the expression of AID to induce CSR in the TI-2 response. PKCδ contains several phosphorylation sites, whose phosphorylation pattern affects its enzymatic activity and possibly the selection of downstream targets (Salzer et al., 2016; Steinberg, 2004). Although the phosphorylation of Thr 505 and Ser 647 of PKCδ is known to be important for its enzymatic activity, phosphorylation of these sites was constitutive in unstimulated naive B cells and did not increase after NP-Ficoll stimulation (data not shown). This observation and a previous report that PKCδ exerts proapoptotic activity in peripheral B cells through nuclear translocation, unless BAFF signaling reverses it (Mecklenbräuker et al., 2004), indicate a constitutive PKCδ activity in B cells irrespective of Ag stimulation. Augmented IgM production after immunization with TI-2 as well as TD Ags in PKCδ-deficient mice (Figure 3A and D and Figure 3—figure supplement 1B) may reflect the lack of the general proapoptotic function of PKCδ. On the other hand, phosphorylation of PKCδ at Tyr 311, shown here to be selectively augmented by TI-2 Ag stimulation, is known to alter its intracellular localization and the substrate specificity (Rybin et al., 2004; Steinberg, 2004) and to be involved in various cellular responses (Balasubramanian et al., 2006; Nakashima et al., 2008). Thus, to understand the mechanism of TI-2 Ag-specific BCR signaling that induces the expression of BATF and AID, it would be necessary to identify a specific substrate of the phosphorylated PKCδ at Tyr 311. In contrast to TI-2 response, PKCδ was not required for IgG production in the TD response, like other proximal BCR molecules (Khan et al., 1995; Xu et al., 2000). In vitro stimulation with a TD Ag alone induced only a marginal level of phosphorylation of PKCδ and other signaling molecules (Figure 2A and data not shown) and did not induce proliferation, IgM production, and the expression of BATF. Accordingly, we assume that the TD Ag-mediated BCR signaling cannot exceed an activation threshold to induce gene expression leading to functional B-cell response including class switching. Instead, other stimuli such as CD40L would meet the demand for B-cell activation in TD response. Supporting this view, it was reported that BCR signaling does not enhance the class switching induced by CD40 signaling (Pone et al., 2012). The synergistic effect of TLR and BCR on the induction of AID has been shown previously (Pone et al., 2012). Here, we found that IL-1α/β, IFNα, and TLR ligands costimulate B cells with TI-2 Ag to induce Aicda expression and class switching to IgG3 and perhaps other IgG subclasses, while other cytokines tested barely induced IgG3 production in vitro. In the context of TD response, the recruitment of NF-κB and STAT6 to the 5′ upstream enhancer region of Aicda locus, in addition to BATF recruitment to the 3′ downstream region, is required for the transcription of Aicda (Tran et al., 2010; Vaidyanathan et al., 2014). Since the in vitro stimulation by TI-2 Ag induced the expression of BATF but not of Aicda without the additional stimulation, such costimulation may signal the recruitment of transcription factors to the 5′ upstream enhancer region. In this regard, it was reported that IL-1 and IFNα induce the transcription of Aicda through activation of NF-κB in hepatocytes during hepatitis B virus infection (Watashi et al., 2013). IL-1 and IFNα have also been reported to activate STAT proteins, if not STAT6 (Biffi et al., 2019; Du et al., 2007). However, further study would be necessary to understand the overall mechanism for the induction of Aicda expression in B cells in the TI-2 response. Consistent with our in vitro data, previous reports showed the contribution of IL-1α/β, IFNα, and TLR ligands in several types of TI-2 responses: IgG production upon immunization with NP-Ficoll was dampened in IL-1α/β double-deficient mice (Nakae et al., 2001), and IgG2c production with NP-Ficoll plus poly(I:C) was dependent on the IFNα receptor on B cells (Swanson et al., 2010). While IgG production against NP-Ficoll did not require MyD88-mediated TLR signaling (Gavin et al., 2006; Hou et al., 2011), IgG production against pneumococcal polysaccharides requires TLR signaling (Sen et al., 2005). Compared to NP-Ficoll, physiological TI-2 Ags are more complex (Snapper, 2006) and may contain pathogen-associated molecular patterns (PAMPs) that mediate TLR signaling. Therefore, any of IL-1α/β, IFNα, and TLR ligands could function as costimulation for an in vivo TI-2 response, depending on the type of Ag. Our data revealed that PKCδ is generally required for IgG production in response to TI-2 Ags such as NP-Ficoll and PPS3. Given the predominant role of IgG3 in antipneumococcal responses (McLay et al., 2002), PKCδ seems to be needed for protection from pneumococcal infection. Furthermore, we found that PKCδ is required to produce IgG3 against commensal bacteria in the steady state and the prevention of bacteremia after epithelial barrier disruption. As commensal bacteria have been shown to contain various Ags and stimulate multiple immune pathways (Belkaid and Harrison, 2017), our result suggests that some commensal bacteria express TI-2 Ag-like repetitive structures that elicit IgG3 production. It has been shown that such IgG against symbiotic bacteria also plays a protective role in systemic infection by pathogens (Zeng et al., 2016). Taken together, IgG production in the TI-2 response seems to be critical for regulation of various types of bacteria. Several reports uncovered the potential contribution of the dysregulated microbiome in SLE pathogenesis together with genetic risk factors (Silverman, 2019). Translocation of a gut pathobiont to the liver and other systemic tissues causes a lupus-like disease in genetically autoimmune-prone mice owing to induction of a systemic type I interferon response and autoantibody production (Manfredo Vieira et al., 2018). Prevention of this bacterial translocation and autoimmune response by vaccination against the pathobiont indicated a role of antibodies for the prevention. Thus, besides the defect of B-cell tolerance (Miyamoto et al., 2002; Mecklenbräuker et al., 2002), the low serum antibacterial IgG3 in PKCδ-deficient mice may lead to the pathobiont invasion and autoantibody production through intact TD response. Loss-of-function PKCδ mutations in humans also cause SLE-like autoimmunity (Salzer et al., 2016). Some of these patients show reduced IgG-positive B cells in the peripheral blood and have recurrent infections for unknown reasons (Kiykim et al., 2015; Salzer et al., 2013; Kuehn et al., 2013). Taken together, PKCδ-mediated IgG production by the TI-2 response appears to be critical also in humans for host defense against certain bacteria and the regulation of autoimmunity.

Materials and methods

Mice and immunizations

C57BL/6NCrSlc (B6) mice were purchased from Japan SLC. All the following mice were backcrossed to the B6 or B6-CD45.1 strain: B1-8 mice (Lam et al., 1997), B1-8 mice (Shih et al., 2002), Igk mice (Chen et al., 1993), Cd19 mice (Rickert et al., 1995), and Prkcd mice (Miyamoto et al., 2002). Prkcd mice on the B6 background were developed by Drs. Niino, Shioda, and Sakimura (Niino et al., 2021) and purchased from the RIKEN BioResource Center (RBRC06462). Mice were immunized i.p. with 100 µg of NP46-Ficoll (F-1420; Biosearch Technologies), 1 µg of PPS3 (169 X; American Type Culture Collection) or 100 µg of NP40-CGG in alum (Haniuda et al., 2016) unless otherwise noted. For flow cytometry of spleen cells, mice were immunized i.v. with 100 µg of NP46-Ficoll. Sex-matched 7–14-week-old mice were used for all experiments. All mice were maintained in the Tokyo University of Science (TUS) mouse facility under specific pathogen-free conditions. Mouse procedures were performed under protocols approved by the TUS Animal Care and Use Committee (Approval No. S19017 and S20011).

B-cell culture

Spleen cells were stained with a cocktail of biotinylated Abs for CD4, CD8, CD43, CD49b, Ter119, and Streptavidin Particles Plus DM, from which naive B cells were purified by magnetic negative sorting using the IMag system (BD Biosciences) and MACS system (Miltenyi Biotec), as described previously (Nojima et al., 2011). B cells were cultured in RPMI-1640 medium (Wako) supplemented with 10% heat-inactivated fetal bovine serum, 10 mM HEPES pH 7.5, 1 mM sodium pyruvate, 50 mM 2-mercaptoethanol, 100 U/ml penicillin, and 100 mg/ml streptomycin (GIBCO). Typically, B cells were cultured at 2 × 105 /ml in the presence of the following stimuli at the indicated doses, unless otherwise noted: NP46-Ficoll (10 ng/ml), NP40-CGG (10 ng/ml), LPS (1 µg/ml, L2880; Sigma), R-848 (1 µg/ml, tlrl-r848; InvivoGen), CpG ODN 1826 (1 µg/ml, tlrl-1826; InvivoGen), IL-1α (1 ng/ml, 211–11 A; Pepro Tech), IL-1β (1 ng/ml, 211-11B; Pepro Tech), or IFNα (100 ng/ml, 752802; Biolegend). Concentrations of cytokines used in Figure 1—figure supplement 1D are shown in Supplementary file 1.

Retroviral transduction

To produce retrovirus, pSIREN- or pMXs-based plasmids were cotransfected together with pVSVG into Plat-E cells (kindly provided by T. Kitamura, University of Tokyo) using PEI Max (Mw 40,000, 24765-1; Polysciences). The virus-containing supernatant was harvested 2 days after transfection. For retroviral transduction, B cells were preactivated in vivo: B1-8 mice were injected i.p. with 50 µg of NP-Ficoll, and then B cells were purified from the spleens of these mice on the next day. These B cells were mixed with the virus-containing supernatant and spin infected at 2000 rpm, 37°C for 90 min with 10 mg/ml DOTAP Liposomal Transfection Reagent (11202375001; Sigma). One day later, the cells were harvested and 5 × 105 cells were transferred into B6 mice that had been immunized i.v. with NP-Ficoll on the previous day. This strategy is summarized in Figure 4—figure supplement 1B.

Proliferation assay

The proliferation assay was performed as described previously (Fukao et al., 2014). Naive B cells were cultured at 5 × 104 cells/well in 96-well plates for 72 hr, with the last 8 hr in the presence of [3H] thymidine (1 mCi/well, NET027001MC; PerkinElmer). Incorporated [3H] thymidine was counted by a BetaPlate scintillation counter (Wallac, Gaithersburg, MD).

Flow cytometry

Single-cell suspensions from spleen or peritoneal cavity were prepared, red blood cells were lysed with ammonium chloride buffer and then cells were incubated with anti-CD16/32 Ab (2.4G2) to block FcγRs. Cultured B cells were collected in MACS buffer (phosphate-buffered saline [PBS] supplemented with 0.5 % BSA, 2 mM ethylenediaminetetraacetic acid [EDTA]) at the indicated days of culture. Cells were stained with Abs and reagents on ice (for splenocytes) or at room temperature (for cultured B cells). For the staining of IgM, IgG, and NP-binding Ig, Fixation/Permeabilization Solution Kit (554714; BD Biosciences) was used according to the manufacturer’s protocol to detect total (surface and intracellular) proteins, after surface staining of other molecules. NP-binding Ig was stained with NP14-BSA-Alexa Fluor 647 (Haniuda et al., 2016). Dead cells were stained with Fixable Viability dye eFluor 506 (65-0866-18; Thermo Fisher Scientific) before cell fixation and excluded from analysis. All samples were analyzed using FACSCanto II, FACSAria II or III (BD Biosciences) with FlowJo software (Tree Star, Inc).

Cell division analysis

Naïve B cells were resuspended in PBS at 5 × 106 cells/ml and labeled with 5 µM of CTV Cell proliferation Kit (C34557; Thermo Fisher Scientific) at 37 °C for 20 min according to the manufacturer’s protocol. Collected cells were analyzed by flow cytometry as described above. Cell divisions were determined using the proliferation platform of FlowJo.

Adaptive transfer and donor B-cell purification

1 × 106 CD45.1 B1-8 naive B cells were transferred into B6 mice, which were then immunized i.v. with NP-Ficoll on the next day. Donor B cells were magnetically enriched from pooled spleens of recipient mice using APC-conjugated anti-CD45.1 and anti-APC MicroBeads (130-090-855; Miltenyi Biotec), with the MACS system (Miltenyi Biotec). After enrichment, cells were further stained with respective Abs and sorted using FACSAria II or III (BD Biosciences) as shown in Figure 4—figure supplement 1A. Rv-transduced donor B cells were enriched as described above and sorted as shown in Figure 4—figure supplement 1C.

RT-PCR and qPCR

TRI Reagent (T9424; Sigma) or RNeasy Micro (74004; QIAGEN) was used to isolate total RNA from B cells. cDNA was generated from total RNA using ReverTra Ace (TRT-101; TOYOBO) with an oligo(dT)20 primer (18418020; Thermo Fisher Scientific) according to the manufacturer’s protocols. For the analysis of a small number of cells, cDNA was generated from cell lysates with SuperPrep II Cell lysis & RT Kit for qPCR (SCQ-401; TOYOBO) according to the manufacturer’s protocols. Quantitative real-time PCR (qPCR) was performed using Thunderbird SYBR qPCR Mix (QPS-201; TOYOBO) with the 7500 fast Real-time PCR system or Quant-Studio 3 (Applied Biosystems). For quantification of gene expression levels, each sample was normalized to the expression of a control housekeeping gene, Gapdh or Rps18. The relative fold change in expression of each gene compared to a control sample, set as 1.0, was calculated with the 2-ddCT method. Primers used in this study are listed in Supplementary file 1. The germline and postswitched transcripts were analyzed with the following primer sets: germline Iµ-Cµ transcripts: Iµ Fw1 and Cµ Rv; Iγ3-Cγ3 transcripts: inner Iγ3 Fw and Cγ3 Rv; postswitched Iµ-Cγ3 transcripts: Iµ Fw2 and Cγ3 Rv. For the measurement of the circle Iγ3-Cµ transcript, cDNA was generated with external Cµ Rv primer from total RNA as described above, and preamplified with external Iγ3 Fw primer and Cµ Rv primer using GoTaq Green Master Mix (M712B; Promega). Preapplication products were purified with QIAquick PCR Purification Kit (28104; QIAGEN) and circle Iγ3-Cµ transcript was quantified with inner Iγ3 Fw primer and Cµ Rv primer by qPCR as described above. Specific amplification of the circle Iγ3-Cµ transcript was confirmed by analyzing the sequence of the qPCR products in advance. The expression of the Iγ3-Cµ transcript was normalized to the expression of Rps18 in cDNA generated with oligo(dT)20 primer from the same RNA sample.

Enzyme-linked immunosorbent assay

Concentrations of total IgM, IgG, or IgG subclasses and of Ag-specific Igs (where indicated) were assessed by titration of culture supernatants or sera by enzyme-linked immunosorbent assay (ELISA). Total and NP-specific antibodies were measured as described previously (Fukao et al., 2014; Nojima et al., 2011), with NP13.6-BSA used for coating plates for the latter. PPS3-specific IgM and IgG3 were detected using 96-well plates coated with PPS3. Bacteria-specific antibody was detected as described previously (Zeng et al., 2016). Heat-killed fecal bacteria isolated from Prkcdmice and Prkcdmice cohoused at least for 4 weeks were mixed and used for plate coating.

Immunoblotting

Cells were lysed with 1% NP-40 lysis buffer or RIPA buffer (40 mM Tris–HCl pH 7.5, 150 mM NaCl, 1% NP-40, 1 % sodium deoxycholate, 0.1 % SDS, and 1 mM EDTA) supplemented with protease and phosphatase inhibitors. Lysates were sonicated and mixed with sample buffer and dithiothreitol and boiled. Lysates were resolved on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore), followed by immunoblotting as previously described (Haniuda et al., 2020).

DSS-induced bacteremia

Prkcdmice and Prkcd female mice were cohoused at 1:1 ratio from 4 weeks of age. After at least 4 weeks, cohoused mice were administered 3 % DSS (9011-18-1; MP Biomedicals) in drinking water for 7 days and then switched to regular water. On the day of the last DSS administration, blood samples were collected from mice and cultured on Brain Heart Infusion Agar (221570; BD Bioscience) under aerobic or anaerobic conditions for 24 hr to measure CFU.

Statistical analysis

Biological replication is derived from multiple biological samples (mouse or cell). Technical replication consisted of multiple samples derived from one biological sample. All statistical analyses were performed using GraphPad Prism eight software. Comparisons between two groups were performed by a two-tailed unpaired Student’s t-test, Welch’s t-test (in case F-test is significant: p < 0.05), or multiple t-test (for grouped data). Comparisons between multiple groups were performed by one or two-way analysis of variance with Tukey’s multiple comparison. Survival of DSS-treated mice was analyzed by Kaplan–Meier survival plot using log-rank test. In all cases, *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant (p > 0.05). Although how structurally different antigens can activate B-lymphocytes to produce IgG with or without T cell help has been a long-standing question, this manuscript provides a clue to this important issue. Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work. Decision letter after peer review: Thank you for submitting your article "Protein kinase Cδ is essential for the IgG response against T cell-independent type 2 antigens and commensal bacteria" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Carla Rothlin as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Tomoharu Yasuda (Reviewer #1); Jurgen Wienands (Reviewer #2). The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Essential revisions: 1) As PKCδ is known as a key signaling molecule suppressing autoimmune diseases. Important role of PKCδ in TI-2 response may suggest that homeostatic TI-2 response possibly influence on suppression of autoimmune diseases. Though authors briefly mentioned about autoimmunity in p 24, line 430-434, discussion may not be enough. For example, Michel Nussenzweig's group reported that critical role of Lyn in the regulation of clonal expansion and terminal differentiation of B cells in TI-2 responses (Shih et al., Role of antigen receptor affinity in T cell-independent antibody responses in vivo., Nat. Immunol., 3, 399, 2002). Since Lyn-deficient mice show autoimmune diseases similar to PKCδ-deficient mice (Nishizumi et al., Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice., Immunity, 3, 549, 1995), both Lyn and PKCδ may regulate same signaling pathway. Including further discussion related between TI-2 antigen/BCR signal and autoimmunity will enhance discussion. 2) Why and how is PKCδ required differently downstream of TI-2 BCR crosslinking but not in TD antigen exposure? It would be nice if authors discuss about this point. 3) How do IL-1α/β and IFNα regulate Aicda gene expression in synergy with BATF? It would be nice if authors discuss about transcriptional regulation of Aicda based on past reports. 4) How do TI-2 antigens engage PKC-δ? Is it solely the configuration or clustering of the BCR (as hypothesized in the Discussion part) or do secondary signals add to this and to the BATF-AID axis as suggested by the results of the forced expression of BATF to substitute for the loss of PKC-δ? Reviewer #1 (Recommendations for the authors): 1) PKCδ is known as a key signaling molecule suppressing autoimmune diseases. Important role of PKCδ in TI-2 response may suggest that homeostatic TI-2 response possibly influence on suppression of autoimmune diseases. Though authors briefly mentioned about autoimmunity in p 24, line 430-434, discussion may not be enough. For example, Michel Nussenzweig's group reported that critical role of Lyn in the regulation of clonal expansion and terminal differentiation of B cells in TI-2 responses (Shih et al., Role of antigen receptor affinity in T cell-independent antibody responses in vivo., Nat. Immunol., 3, 399, 2002). Since Lyn-deficient mice show autoimmune diseases similar to PKCδ-deficient mice (Nishizumi et al., Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice., Immunity, 3, 549, 1995), both Lyn and PKCδ may regulate same signaling pathway. Including further discussion related between TI-2 antigen/BCR signal and autoimmunity will enhance discussion. 2) Why and how is PKCδ required differently downstream of TI-2 BCR crosslinking but not in TD antigen exposure? It would be nice if authors discuss about this point. 3) How do IL-1α/β and IFNα regulate Aicda gene expression in synergy with BATF? It would be nice if authors discuss about transcriptional regulation of Aicda based on past reports. 4) Figure 1C, 2B; Concentration unit should be converted to ng/ml same with other figures for IgM and IgG. 5) Figure 1C-E; NP-Ficoll stimulation in the absence of cytokines will be helpful to know background levels otherwise it is difficult to know the impact of IL-1 and IFNα in class switch recombination and antibody secretion. Reviewer #2 (Recommendations for the authors): 1) A key aspect of this manuscript is the specificity with which PKC-δ is involved in TI-2 antigen responses as opposed to TD-dependent responses. In fact, Figure 2A and others suggest that PKC-δ activation is not an all-or-nothing event. Hence, the specificity or kinetic of PKC-δ activation could be corroborated. One important set of data is shown in Supplementary Figure 3. Why is the IgM response so strongly increased in the absence of PKC-δ? 2) How do TI-2 antigens engage PKC-δ? Is it solely the configuration or clustering of the BCR (as hypothesized in the Discussion part) or do secondary signals add to this and to the BATF-AID axis as suggested by the results of the forced expression of BATF to substitute for the loss of PKC-δ? The arrow head downstream of cytokine and TOLL-like receptors ends diffusely somewhere at the BATF-Aicda axis (Figure 7). 3) In other publications that describe the generation and analysis of PKC-δ-deficient mouse mutants such differences were not observed or less obvious. Is there an explanation to these differences? Essential revisions: 1) As PKCδ is known as a key signaling molecule suppressing autoimmune diseases. Important role of PKCδ in TI-2 response may suggest that homeostatic TI-2 response possibly influence on suppression of autoimmune diseases. Though authors briefly mentioned about autoimmunity in p 24, line 430-434, discussion may not be enough. For example, Michel Nussenzweig's group reported that critical role of Lyn in the regulation of clonal expansion and terminal differentiation of B cells in TI-2 responses (Shih et al., Role of antigen receptor affinity in T cell-independent antibody responses in vivo., Nat. Immunol., 3, 399, 2002). Since Lyn-deficient mice show autoimmune diseases similar to PKCδ-deficient mice (Nishizumi et al., Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice., Immunity, 3, 549, 1995), both Lyn and PKCδ may regulate same signaling pathway. Including further discussion related between TI-2 antigen/BCR signal and autoimmunity will enhance discussion. We assume that dysregulation of microbiota due to the defective TI-2 response may cause autoimmunity, in conjunction with the defect of B-cell tolerance in PKCδ-deficient mice, as previously suggested in another mouse model (Manfredo Vieira et al., 2018); the defect of homeostatic production of the anti-bacterial IgG3 (Figure 6) may allow tissue translocation of some gut bacteria, which may in turn trigger autoantibody production in PKCδ-deficient mice. We have now included further discussion about this possibility (page 16, line 362-375). It was shown that PKCδ is dispensable for BCR-stimulated activation and proliferation of B cells but is necessary to make self-reactive B cells unresponsive to the BCR stimulation (Mecklenbräuker et al., 2002). It was also reported that PKCδ exerts pro-apoptotic activity in normal peripheral B cells through nuclear translocation, unless BAFF signaling reverses it (Mecklenbräuker et al., 2004). On the other hand, Src-family tyrosine kinases including Lyn are redundantly required for BCR signal transduction, such as phosphorylation of key signaling molecules such as Igα/β and CD19. In addition, Lyn is also responsible for phosphorylation and activation of inhibitory co-receptors for BCR such as CD22 and FcγRIIb, which is the basis for spontaneous activation and exaggerated responses of B cells leading to autoimmunity in Lyn-deficient mice. Therefore, the mechanism for the induction of autoimmunity in PKCδ-deficient mice appears quite different from that in Lyn-deficient mice. Also, IgG production in response to TI-2 Ag or bacteria has not been studied in Lyn-deficient mice. Thus, we have not referred to Lyn-deficient mice in this manuscript. 2) Why and how is PKCδ required differently downstream of TI-2 BCR crosslinking but not in TD antigen exposure? It would be nice if authors discuss about this point. As previously appreciated, a role of BCR signaling is substantially different between TI-2 and TD responses: Tyrosine kinases Btk and an adaptor molecule BLNK, for example, are necessary for TI-2, but not TD, immune response (as we wrote in page 2, the second paragraph). Unlike TI-2 antigen, TD antigen alone cannot induce proliferation, IgM production, and Batf expression in naive B cells, as we demonstrated in in-vitro study (Figures 1A, 1B, 5B, Figure 5 —figure supplement 1A). Thus, it appears that TD antigen-mediated BCR signaling cannot exceed a threshold for B-cell activation including sufficient phosphorylation of PKCδ (Figure 2A) required for class switching to IgG; T-cell-derived signals are known to compensate for the defective BCR signaling in the TD response. We have now included this discussion in the Discussion section (page 14, line 313-321). We still don’t know how PKCδ is activated and exert its function after BCR crosslinking by TI-2 antigen. The phosphorylation of Thr 505 and Ser 647 of PKCδ, known to be important for its enzymatic activity, was observed in unstimulated naïve B cells and unchanged by TI-2 antigen stimulation in our in-vitro system (data not shown), but that of Tyr 311 was augmented, which is known to alter its intracellular localization and the substrate specificity (Rybin et al., 2004; Steinberg, 2004). Thus, identification of the substrate of PKCδ in B cells after stimulation with TI-2 antigen would be an important next step. We have now included this discussion (page 13, line 290 – page 14, line 312). 3) How do IL-1α/β and IFNα regulate Aicda gene expression in synergy with BATF? It would be nice if authors discuss about transcriptional regulation of Aicda based on past reports. It has been shown that the transcription of Aicda requires the activation of the 5’ upstream enhancer region of Aicda locus, in addition to the recruitment of BATF to the 3’ downstream region in the context of TD response (Tran et al., 2010; Vaidyanathan et al., 2014). Therefore, we consider that the secondary stimulation such as IL-1α/β and IFNα might signal to activate the 5’ upstream enhancer region and induce the transcription of Aicda in synergy with BATF induced by TI-2 antigen stimulation. We have now described about this hypothesis in detail in the Discussion section (page 14, line 325 – page 15, line 340). 4) How do TI-2 antigens engage PKC-δ? Is it solely the configuration or clustering of the BCR (as hypothesized in the Discussion part) or do secondary signals add to this and to the BATF-AID axis as suggested by the results of the forced expression of BATF to substitute for the loss of PKC-δ? We have not investigated how TI-2 antigen-bound BCR engages PKCδ. It would be challenging to study the relation between the configuration or clustering of BCR and the engagement/activation of PKCδ, which would require a specialized technology such as TIRF microscopy. As we have shown in the revised manuscript, TI-2 antigen alone could induce PKCδ phosphorylation and Batf expression, but IL-1α/β or IFNα alone could not, nor they could augment the TI-2 antigen-induced these responses (Figure 5B, the newly added ‘Figure 5 —figure supplement 1B-D’). Therefore, we consider that TI-2 antigen activates the PKCδ-BATF axis solely through BCR. We suppose that this signaling axis and the secondary signals may merge on the Aicda locus to induce AID expression as described in our response to the Essential Revisions 3. We have mentioned about the new data in the Result section (page 10, line 204-206). Reviewer #1 (Recommendations for the authors): 1) As I commented in Public review, PKCδ is known as a key signaling molecule suppressing autoimmune diseases. Important role of PKCδ in TI-2 response may suggest that homeostatic TI-2 response possibly influence on suppression of autoimmune diseases. Though authors briefly mentioned about autoimmunity in p 24, line 430-434, discussion may not be enough. For example, Michel Nussenzweig's group reported that critical role of Lyn in the regulation of clonal expansion and terminal differentiation of B cells in TI-2 responses (Shih et al., Role of antigen receptor affinity in T cell-independent antibody responses in vivo., Nat. Immunol., 3, 399, 2002). Since Lyn-deficient mice show autoimmune diseases similar to PKCδ-deficient mice (Nishizumi et al., Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice., Immunity, 3, 549, 1995), both Lyn and PKCδ may regulate same signaling pathway. Including further discussion related between TI-2 antigen/BCR signal and autoimmunity will enhance discussion. This is the same comment as in the Essential Revisions 1, to which we have answered. 2) Why and how is PKCδ required differently downstream of TI-2 BCR crosslinking but not in TD antigen exposure? It would be nice if authors discuss about this point. This is the same comment as in the Essential Revisions 2, to which we have answered. 3) How do IL-1α/β and IFNα regulate Aicda gene expression in synergy with BATF? It would be nice if authors discuss about transcriptional regulation of Aicda based on past reports. This is the same comment as in the Essential Revisions 3, to which we have answered. 4) Figure 1C, 2B; Concentration unit should be converted to ng/ml same with other figures for IgM and IgG. We have revised the Figure 2B to use ng/ml for IgM concentration. To measure IgG3 titers in the experiments shown in Figure 1C and other figures, we used serum of a C57BL/6 mouse as a standard, and therefore the values were shown as relative units (AU). It would not mean anyway if we had measured absolute values of the IgG3 concentrations; the values cannot be compared among the figures, since the number of cultured cells and the culture period varied among the figures, depending on the situation of each experiment such as the number of available mice. 5) Figure 1C-E; NP-Ficoll stimulation in the absence of cytokines will be helpful to know background levels otherwise it is difficult to know the impact of IL-1 and IFNα in class switch recombination and antibody secretion. We have added back the data of stimulation with antigen alone in the revised Figure 1C-E. Consequently, the data previously shown as Figure 1 —figure supplement 1F has been removed since it has been integrated into the new Figure 1E. Reviewer #2 (Recommendations for the authors): 1) A key aspect of this manuscript is the specificity with which PKC-δ is involved in TI-2 antigen responses as opposed to TD-dependent responses. In fact, Figure 2A and others suggest that PKC-δ activation is not an all-or-nothing event. Hence, the specificity or kinetic of PKC-δ activation could be corroborated. One important set of data is shown in Supplementary Figure 3. Why is the IgM response so strongly increased in the absence of PKC-δ? As this comment is essentially integrated in the Essential Revisions 2, please look at our response written there. In particular, we admit that TD-antigen stimulation modestly and transiently increased the PKCδ phosphorylation at Tyr 311 (Figure 2A) but did not induce Batf expression at all (Figure 5B, Figure 5 —figure supplement 1A). Therefore, the extent of PKCδ phosphorylation might not be enough to exceed the activation threshold. We think the increased IgM response in the TD immune response of PKCδ-deficient mice reflects the reported constitutive pro-apoptotic activity of PKCδ in the peripheral B cells (Mecklenbräuker et al., 2004) that may normally limit the initial proliferation of B cells in the TD immune response. We have mentioned this possibility in the Discussion section (page 13, line 294 – page 14, 307). 2) How do TI-2 antigens engage PKC-δ? Is it solely the configuration or clustering of the BCR (as hypothesized in the Discussion part) or do secondary signals add to this and to the BATF-AID axis as suggested by the results of the forced expression of BATF to substitute for the loss of PKC-δ? The arrow head downstream of cytokine and TOLL-like receptors ends diffusely somewhere at the BATF-Aicda axis (Figure 7). This is the same comment as in the Essential Revisions 4, to which we have answered. 3) In other publications that describe the generation and analysis of PKC-δ-deficient mouse mutants such differences were not observed or less obvious. Is there an explanation to these differences? Although we have carefully searched for the literature, we could not find any studies analyzing immune responses or class-switching in PKCδ-deficient mice. Most of the studies were focused on B cell tolerance.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (M. musculus)C57BL/6NCrSlc (B6)Japan SLC Inc
Genetic reagent (M. musculus)C57BL/6 CD45.1RIKEN BRCRBRC00144
Genetic reagent (M. musculus) B1-8flox/+ doi:10.1016/S0092-8674(00)80373–6.
Genetic reagent (M. musculus) B1-8hi doi:10.1038/ni776.JAX stock #007775
Genetic reagent (M. musculus) Cd19cre/+ doi:10.1038/376352a0.JAX stock #006785
Genetic reagent (M. musculus) Prkcd−/− RIKEN BRCRBRC00457
Genetic reagent (M. musculus) Prkcdf/f RIKEN BRCRBRC06462
Genetic reagent (M. musculus) Igk−/− doi:10.1002/j.1460–2075.1993.tb05722.x.
AntibodyAPC-Cy7 anti-mouse CD19 (Rat monoclonal)BioLegendCat# 115,530Flow cytometry (1/200)
AntibodyBiotin Rat Anti-Mouse CD43 (Rat monoclonal)BD BiosciencesCat# 20,737Flow cytometry (1/300)
AntibodyBV421 anti-mouse CD138 (Rat monoclonal)BioLegendCat# 142,508Flow cytometry (1/500)
AntibodyBV421 Rat Anti-Mouse IgG3 (Rat monoclonal)BD BiosciencesCat# 565,808Flow cytometry (1/300)
AntibodyCD45.1 Monoclonal Antibody (A20), APC (Mouse monoclonal)InvitrogenCat# 17-0453-82Flow cytometry (1/200)
AntibodyFITC anti-mouse CD21/CD35 (CR2/CR1) Antibody (Rat monoclonal)BioLegendCat# 123,407Flow cytometry (1/300)
AntibodyFITC anti-mouse CD5 Antibody (Rat monoclonal)BioLegendCat# 100,605Flow cytometry (1/300)
AntibodyGoat Anti-Mouse IgG2c, Human ads-FITC (Goat Polyclonal)SouthernBiotechCat# 1079-02Flow cytometry (1/300)
AntibodyGoat F(ab')2 Anti-Mouse IgG2b, Human ads-FITC (Goat Polyclonal)SouthernBiotechCat# 1092-02Flow cytometry (1/300)
AntibodyGoat F(ab')2 Anti-Mouse IgG3, Human ads-FITC (Goat Polyclonal)SouthernBiotechCat# 1102-02Flow cytometry (1/300)
AntibodyPE anti-mouse CD23 Antibody (Rat monoclonal)BioLegendCat# 101,607Flow cytometry (1/300)
AntibodyPE anti-mouse IgG2b (Rat monoclonal)BioLegendCat# 406,707Flow cytometry (1/500)
AntibodyPE-Cy7 anti-mouse CD19 (Rat monoclonal)BioLegendCat# 115,520Flow cytometry (1/200)
AntibodyGoat Anti-Mouse IgG Fc-HRP (Goat Polyclonal)SouthernBiotechCat# 1033-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgG, Human ads-UNLB (Goat Polyclonal)SouthernBiotechCat# 1030-01ELISA (1/1000)
AntibodyGoat Anti-Mouse IgG1, Human ads-HRP (Goat Polyclonal)SouthernBiotechCat# 1070-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgG1, Human ads-UNLB (Goat Polyclonal)SouthernBiotechCat# 1070-01ELISA (1/1000)
AntibodyGoat Anti-Mouse IgG2b, Human ads-HRP (Goat Polyclonal)SouthernBiotechCat# 1090-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgG2b, Human ads-UNLB (Goat Polyclonal)SouthernBiotechCat# 1090-01ELISA (1/1000)
AntibodyGoat Anti-Mouse IgG2c, Human ads-HRP (Goat Polyclonal)SouthernBiotechCat# 1079-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgG3, Human ads-UNLB (Goat Polyclonal)SouthernBiotechCat# 1100-01ELISA (1/1000)
AntibodyGoat Anti-Mouse IgG3, Human/Bovine/Horse SP ads-HRP (Goat Polyclonal)SouthernBiotechCat# 1103-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgM, Human ads-HRP (Goat Polyclonal)SouthernBiotechCat# 1020-05ELISA (1/2000)
AntibodyGoat Anti-Mouse IgM, Human ads-UNLB (Goat Polyclonal)SouthernBiotechCat# 1020-01ELISA (1/1000)
AntibodyAnti-GAPDH mAb (Mouse monoclonal)MBLCat# M171-3WB (1/3000)
AntibodyAnti-SP1 antibody (Rabbit polyclonal)AbcamCat# ab227383WB (1/5000)
AntibodyBATF (D7C5) Rabbit mAb (Rabbit monoclonal)Cell Signaling TechnologyCat# 8638WB (1/2000)
AntibodyPhospho-PKCdelta (Tyr311) Antibody (Rabbit polyclonal)Cell Signaling TechnologyCat# 2055WB (1/2000)
AntibodyPKC δ Antibody (C-17) (Rabbit polyclonal)Santa Cruz BiotechnologyCat# sc-213WB (1/2000)
Recombinant DNA reagentpMXs-IRES-GFPotherDr. Kitamura (University of Tokyo)
Recombinant DNA reagentpMXs-BATF-IRES-GFPThis paperBATF (M. musculus)
Recombinant DNA reagentpMXs-AID-IRES-GFPThis paperAID (M. musculus)
Recombinant DNA reagentpMXs-PKCδ-IRES-GFPThis paperPKCδ (M. musculus)
Recombinant DNA reagentpSIREN-GFP shLuciferase (shControl)doi:10.1016/j.celrep.2020.108333.
Recombinant DNA reagentpSIREN-GFP shBATFThis paperTaget sequence (5′–3′): ACCCTGGACTGTCATGAATGA
Recombinant DNA reagentpVSV-GClontechCat# 631,530
Sequence-based reagentPrimersThis paperSee Supplementary file 1
Sequence-based reagentOligo(dT)20 PrimerThermo Fisher ScientificCat# 18418020
Peptide, recombinant proteinNP46-FicollBiosearch TechnologiesCat# F-1420
Peptide, recombinant proteinNP40-CGGdoi:10.1038/ni.3508.
Peptide, recombinant proteinNP14-BSA-Alexa Fluor 647doi:10.1038/ni.3508.
Peptide, recombinant proteinCytokinesSee Supplementary file 1
Commercial assay or kitFixation/Permeabilization Solution KitBD BiosciencesCat# 554,714
Commercial assay or kitQIAquick PCR Purification KitQIAGENCat# 28,106
Commercial assay or kitRNeasy MicroQIAGENCat# 74,004
Commercial assay or kitThunderbird SYBR qPCR MixTOYOBOCat# QPS-201
Commercial assay or kitSuperPrep II Cell lysis & RT Kit for qPCRTOYOBOCat# SCQ-401
Commercial assay or kitCellTraceTM Violet (CTV) Cell proliferation KitThermo Fisher ScientificCat# C34557
Chemical compound, drugPPS3ATCCCat# 169X
Chemical compound, drugLPSSigmaCat# L2880
Chemical compound, drugR-848InvivoGenCat# tlrl-r848
Chemical compound, drugCpG ODN 1826InvivoGenCat# tlrl-1826
Chemical compound, drugFixable Viability Dye eFluor 506Thermo Fisher ScientificCat# 65-0866-18
Chemical compound, drugDOTAP Liposomal Transfection ReagentSigmaCat# 11202375001
Chemical compound, drugTRI ReagentSigmaCat# T9424
Chemical compound, drugPEI Max (Mw 40,000)PolysciencesCat# 24765-1
Chemical compound, drugReverTra AceTOYOBOCat# TRT-101
Chemical compound, drugKOD Fx Neo DNA polymeraseTOYOBOCat# KFX-201
Chemical compound, drug[3 H] thymidinePerkinElmerCat# NET027001MC
Chemical compound, druganti-APC MicroBeadsMicroBeadsCat# 130-090-855
Chemical compound, drugGoTaq Green Master MixPromegaCat# M712B
Chemical compound, drugDSSMP BiomedicalsCat# 9011-18-1
Chemical compound, drugBrain Heart Infusion AgarBD BioscienceCat# 221,570
Software, algorithmFlowJo https://www.flowjo.com/solutions/flowjo RRID:SCR_008520
Software, algorithmGraphPad Prism https://graphpad.com RRID:SCR_002798
  63 in total

1.  Regulation of the T-independent humoral response by TACI.

Authors:  G U von Bülow; J M van Deursen; R J Bram
Journal:  Immunity       Date:  2001-05       Impact factor: 31.745

Review 2.  Non-conventional signal transduction by type 1 interferons: the NF-kappaB pathway.

Authors:  Ziyun Du; Lai Wei; Aruna Murti; Susan R Pfeffer; Meiyun Fan; Chuan He Yang; Lawrence M Pfeffer
Journal:  J Cell Biochem       Date:  2007-12-01       Impact factor: 4.429

3.  IL1-Induced JAK/STAT Signaling Is Antagonized by TGFβ to Shape CAF Heterogeneity in Pancreatic Ductal Adenocarcinoma.

Authors:  Giulia Biffi; Tobiloba E Oni; Benjamin Spielman; Yuan Hao; Ela Elyada; Youngkyu Park; Jonathan Preall; David A Tuveson
Journal:  Cancer Discov       Date:  2018-10-26       Impact factor: 39.397

4.  Metabolic Reprogramming Induces Germinal Center B Cell Differentiation through Bcl6 Locus Remodeling.

Authors:  Kei Haniuda; Saori Fukao; Daisuke Kitamura
Journal:  Cell Rep       Date:  2020-11-03       Impact factor: 9.423

Review 5.  T cell-independent antigens type 2.

Authors:  J J Mond; A Lees; C M Snapper
Journal:  Annu Rev Immunol       Date:  1995       Impact factor: 28.527

6.  Apigenin inhibition of involucrin gene expression is associated with a specific reduction in phosphorylation of protein kinase Cdelta Tyr311.

Authors:  Sivaprakasam Balasubramanian; Ling Zhu; Richard L Eckert
Journal:  J Biol Chem       Date:  2006-09-18       Impact factor: 5.157

7.  Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens.

Authors:  Melody Y Zeng; Daniel Cisalpino; Saranyaraajan Varadarajan; Judith Hellman; H Shaw Warren; Marilia Cascalho; Naohiro Inohara; Gabriel Núñez
Journal:  Immunity       Date:  2016-03-02       Impact factor: 31.745

8.  The microbiome in SLE pathogenesis.

Authors:  Gregg J Silverman
Journal:  Nat Rev Rheumatol       Date:  2019-02       Impact factor: 20.543

9.  Severe B cell deficiency in mice lacking the tec kinase family members Tec and Btk.

Authors:  W Ellmeier; S Jung; M J Sunshine; F Hatam; Y Xu; D Baltimore; H Mano; D R Littman
Journal:  J Exp Med       Date:  2000-12-04       Impact factor: 14.307

10.  Innate lymphoid cells integrate stromal and immunological signals to enhance antibody production by splenic marginal zone B cells.

Authors:  Giuliana Magri; Michio Miyajima; Sabrina Bascones; Arthur Mortha; Irene Puga; Linda Cassis; Carolina M Barra; Laura Comerma; Aleksey Chudnovskiy; Maurizio Gentile; David Llige; Montserrat Cols; Sergi Serrano; Juan Ignacio Aróstegui; Manel Juan; Jordi Yagüe; Miriam Merad; Sidonia Fagarasan; Andrea Cerutti
Journal:  Nat Immunol       Date:  2014-02-23       Impact factor: 25.606

View more
  1 in total

1.  Associations between food-specific IgG antibodies and intestinal permeability biomarkers.

Authors:  Alexandra Adorno Vita; Heather Zwickey; Ryan Bradley
Journal:  Front Nutr       Date:  2022-09-06
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.