Generation of a homozygous CIITA knockout iPS cell line using the CRISPR-Cas9 system.

Human induced pluripotent stem cells (iPSCs) have great promise in regenerative medicine. However, several limitations, including immune-incompatibility, have raised concerns regarding their clinical application. Recent studies have shown that human iPSCs and their derivatives lose their immunogenicity when major histocompatibility complex (MHC) class I and II genes are inactivated and CD47 is over-expressed. In this study, we used CRISPR-Cas9 technology to generate an isogenic iPSC line with a homozygous frameshift mutation in the MHC II transactivator (CIITA) gene. The CIITA-/- iPSCs exhibit typical morphology of pluripotent cells, normal karyotype, expression of pluripotency markers and differentiation capacity in the three germ layers.

Resource table

Resource utility

iPSCs have great potential in regenerative medicine, but allograft immune rejection is a serious obstacle to their clinical translation. Engineering iPSCs to be hypoimmunogenic, targeting MHC complexes, may provide a universal allogeneic “off-the-shelf” cell product for regenerating tissues and organs, accelerating the advancement of stem cell technology into clinics.

Resource details

Immune rejection is mediated by human leukocyte antigen system (HLA), which encodes MHC molecules in humans. It is located on the short arm of chromosome 6 (6p21.3) and consists of three regions designated as class I, II, and III based on the structure and function of gene products.

Researchers have explored different genome editing strategies to generate HLA-engineered hypoimmunogenic stem cells capable of escaping immune reaction, from the deletion of the β2-microglobulin (B2M) gene, whose expression is required to form the HLA-I functional complex, to that of CIITA, a master control factor essential for the expression of HLA-II genes (Deuse et al., 2019, Han et al., 2019, Mattapally et al., 2018, Wang et al., 2020, Xu et al., 2019).

Here, we generated a CIITA knockout iPSC line (IRFMNi001-B-1) using the CRISPR-Cas9 system (Table 1). We cloned a single guide RNA (sgRNA, 5′-GATATTGGCATAAGCCTCCC-3′) specific to the third exon of the human CIITA gene (Deuse et al., 2019; Fig. 1A) into a plasmid containing Cas9 from S. pyogenes and 2A-EGFP (pSpCAs9(BB)-2A-GFP, PX458; Addgene). Control iPSCs (IRFMNi001-B), derived from Normal Human Dermal Fibroblasts Neonatal (NHDF-Neo, CC-2609 L; Lonza) using Sendai virus technology, were nucleofected with pSpCas9(BB)-2A-GFP-sgCIITA. After transfection, GFP+ iPSCs were sorted using fluorescence-activated cell sorting (FACS) and were seeded on a mouse embryonic fibroblast (MEF)-feeder layer. Single cells were clonally expanded and analysed using Sanger sequencing. Among the colonies, we identified a homozygous CIITA knockout clone with an insertion of one nucleotide on both alleles (c.278_279insA; Fig. 1B and C) that changes reading frame, leading to a premature stop codon (p.A94Gfs*33; Supplementary Fig. S1). We further confirmed the homozygous mutation in IRFMNi001-B-1 cells through TOPO TA cloning. Additionally, mutations in the top six predicted potential off-target-sites of Cas9, identified using the free online Crispor (http://crispor.tefor.net/) software, including all those that fell within protein coding regions or next to intronic–exonic junctions (<1.000 bp) (Supplementary Table S1), were excluded via Sanger sequencing. In both the on- and off-target locuses, we looked for the presence of parental clone-specific heterozygous SNPs, which allowed us to be confident to have amplified both alleles ruling out the occurrence of allelic dropout (Supplementary Fig. S2).

Table 1

Characterisation and validation.

Classification(optional italicised)	Test	Result	Data
Morphology	Photography	Typical pluripotent human stem cell morphology	Fig. 1 panel D
Pluripotency status evidence for the described cell line	Qualitative analysis by Immunocytochemistry	Expression of the pluripotency markers OCT4, NANOG, TRA-1–60, TRA-1–81, SSEA-3, SSEA-4	Fig. 1 panel E
	Quantitative analysis by qRT-PCR	Expression of the pluripotency markers OCT4, NANOG and SOX2 at levels comparable to the parental iPSC line	Fig. 1 panel F
Karyotype	Karyotype (G-banding) and resolution	46XYResolution 550 bands	Fig. 1 panel G
Genotyping for the desired genomic alteration/allelic status of the gene of interest	PCR across the edited site or targeted allele-specific PCR	N/A	N/A
	Transgene-specific PCR	N/A	N/A
Verification of the absence of random plasmid integration events	PCR/Southern	PCR detection for PX458 backbones	Supplementary Fig. S4
Parental and modified cell line genetic identity evidence	microsatellite PCR (mPCR)	N/A
	STR analysis	14 sites tested; all match parental	Data available with authors and submitted in archive with journal
Mutagenesis / genetic modification outcome analysis	Sequencing (genomic DNA PCR or RT-PCR product)	Homozygous 1 bp insertion in CIITA exon 3	Fig. 1 panel B, C
	PCR-based analyses
	Southern Blot or WGS; western blotting (for knock-outs, KOs)	N/A	N/A
Off-target nuclease analysis-	PCR across top 5/10 predicted top likely off-target sites, whole genome/exome sequencing	Lack of NHEJ-caused mutagenesis in the top predicted off-target Cas nuclease activity
Specific pathogen-free status	Mycoplasma	Mycoplasma testing by RT-PCR. Negative	Supplementary Fig. S3
Multilineage differentiation potential	Embryoid body formation	Mesoderm: smooth muscle actin (α-SMA)Ectoderm: βIII-TUBULINEndoderm: α-feto protein (AFP)	Fig. 1 panel H
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype - additional histocompatibility info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

Fig. 1

Characterization of IRFMNi001-B-1 iPSC line.

The CIITA-/- iPSC line exhibited typical human pluripotent stem cell-like morphology (Fig. 1D). Pluripotency was assessed using immunofluorescence staining for specific protein markers (OCT4, NANOG, TRA1-81, TRA1-60, SSEA-3 and SSEA-4) (Fig. 1E). Furthermore, we used qRT-PCR to analyse the transcriptional expression of OCT4, NANOG and SOX2 compared to the H9 hESC line (Fig. 1F). Karyotype analysis found a normal karyotype (46, XY) without structural or numerical chromosomal abnormalities (Fig. 1G). The ability to differentiate into the three germ layers was demonstrated by in vitro embryoid body (EB) formation and immunofluorescence staining of ectodermal (βIII-TUBULIN), mesodermal (α-SMA) and endodermal (AFP) markers (Fig. 1H). Short tandem repeat analysis (STR) confirmed an IRFMNi001-B-1 line identity comparable with the original parental clone.

The CIITA-/- iPSC line was mycoplasma-negative and no transgene presence was revealed (Supplementary Fig. S3-S4).

Materials and methods

Cell culture

Cell cultures were maintained at 37 °C in a 5% CO2 humidified incubator. The iPSCs were cultured on hES-qualified Matrigel-coated plates (Corning) in mTeSR1 medium (STEMCELL Technologies) while MEFs in Dulbecco’s modified Eagle medium (DMEM; Gibco) containing 10% foetal bovine serum (FBS, Gibco) and 0.1 mM non-essential amino acids (NEAA; Gibco). MEFs were mitotically inactivated through mitomycin-c treatment (Sigma-Aldrich) 48 h before iPSCs seeding.

Mycoplasma detection

A Mycoplasma test was performed using the N-GARDE Mycoplasma Detection PCR Kit (Euroclone) following the manufacturer's instructions.

CRISPR/Cas9-mediated CIITA gene knockout

For CIITA knockout, 18x106 iPSCs were nucleofected with 72 μg pSpCas9(BB)-2A-GFP-sgCIITA and plated on matrigel-coated 6-well plates in mTeSR1 with 10 μM Y-27632 (Sigma-Aldrich). After 24 h, GFP+ single cells were isolated through cell sorting (FACSAria IIu; BD Bioscience), plated on MEF feeder-coated plates with a density of 500 cells/cm2 and then the single cell-derived colonies were expanded for another 8 days. Thirty emergent clones were picked manually and plated on matrigel-coated wells in mTeSR1 medium.

Genotyping and sequencing

Genomic DNA was extracted from cells using the DNeasy Blood and Tissue kit (Qiagen). The CIITA gene was amplified with PCR using TaKaRa LA Taq DNA Polymerase (Takara Bio) and primers in Table 2. The PCR products were Sanger sequenced using a BigDye® Terminator v3.1 sequencing kit on the 3730 DNA Analyzer (Applied Biosystems). Mutations were verified using the TIDE (Tracking of Indels by DEcomposition) online software tool () and further confirmed with TOPO TA cloning (Invitrogen) and Sanger sequencing. The results were aligned using SnapGene software.

Table 2

Reagents details.

Antibodies and stains used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency Markers	Mouse anti-OCT4	1:100	Santa Cruz Biotechnology Cat# sc-5279; RRID: AB_628051
	Rabbit anti-NANOG	1:100	Santa Cruz Biotechnology Cat# sc-33759; RRID: AB_2150401
	Mouse anti-TRA-1-60	1:200	Millipore Cat# MAB4360, RRID: AB_2119183
	Mouse anti-TRA-1-81	1:200	Millipore Cat# MAB4381, RRID: AB_177638
	Mouse anti-SSEA-4	1:100	Santa Cruz Biotechnology Cat# sc-21704, RRID: AB_628289
	Rat anti-SSEA-3	1:100	Santa Cruz Biotechnology Cat# sc-21703, RRID: AB_628288
Differentiation Markers	Mouse anti-Tubulin beta-III, clone TU-20, Alexa Fluor 488 Conjugated	1:100	Millipore Cat# CBL412X, RRID: AB_1977541
	Mouse anti-Actin, alpha-Smooth Muscle - Cy3	1:100	Sigma-Aldrich Cat# C6198, RRID: AB_476856
	AFP (AFP-11) antibody	1:100	Santa Cruz Biotechnology Cat# sc-51506, RRID: AB_626514
Secondary antibodies	Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546	1:300	Thermo Fisher Scientific Cat# A10040, RRID: AB_2534016
	Goat anti-Mouse IgM Heavy Chain Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	1:300	Thermo Fisher Scientific Cat# A-21042, RRID: AB_2535711
	Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546	1:300	Thermo Fisher Scientific Cat# A10036, RRID: AB_2534012
	Goat anti-Rat IgM (Heavy chain) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	1:300	Thermo Fisher Scientific Cat# A-21212, RRID: AB_2535798
Nuclear stain	DAPI	1 µg/mL	Sigma-Aldrich Cat# D9542
Site-specific nuclease
Nuclease information	Cas9 from S. pyogenes (pSpCas9(BB)-2A-GFP)
Delivery method	Nucleofection
Selection/enrichment strategy	Enrichment of GFP + clones
Primers and Oligonucleotides used in this study
	Target	Forward/Reverse primer (5′-3′)
Pluripotency Markers (qRT-PCR)	NANOG	Hs02387400_g1 (Thermo Fisher Scientific)
	OCT4	Hs00742896_s1 (Thermo Fisher Scientific)
	SOX2	Hs00602736_s1 (Thermo Fisher Scientific)
House-Keeping Genes (qRT-PCR)	GAPDH	Hs02758991_g1 (Thermo Fisher Scientific)
Genotyping	CIITA	Fwd: GCTTTCCCCAGCAAGAGCTARev: GAACACTGACACTCCAGGGG
Targeted mutation sequencing	CIITA	Fwd: TTCCAACACCCTGTGAGGTGRev: AGGGGTGTATGGTATGGGCT
gRNA oligonucleotide	GATATTGGCATAAGCCTCCC	Fwd: CACCGGATATTGGCATAAGCCTCCCRev: AAACGGGAGGCTTATGCCAATATCC
Genomic target sequence	CCAGGGAGGCTTATGCCAATATC	chr16:10895741–10895763
Random plasmid integration events	Primers for PX458	Fwd: GACTATCATATGCTTACCGTRev: CTTGCTATTTCTAGCTCT

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated through the TRIzol Reagent-based procedure (Invitrogen) and treated with DNAse (Promega). 2 μg RNA were reverse-transcribed into cDNA with the Vilo Superscript kit (Invitrogen). qRT-PCR reactions were performed using TaqMan gene expression assays (Applied Biosystems) with predesigned TaqMan probes for the genes of interest according to the supplier’s recommendations (Table 2). Human embryonic stem cell line H9 was taken as reference sample.

Immunofluorescence staining

Cells were fixed for 15 min with 4% paraformaldehyde (Società Italiana Chimici) at room temperature (RT), permeabilised with 0.3% Triton X-100 (Sigma-Aldrich) for 10 min and then blocked with 5% bovine serum albumin (BSA, Sigma-Aldrich) for 1 h. iPSCs were subsequently stained with primary antibodies overnight at 4 °C followed by the corresponding Alexa 546- or Alexa 488-conjugated secondary antibodies for 1 h at RT. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Images were taken using the Axio Observer Z1 fluorescence microscope (Zeiss). The antibodies information is listed in Table 2.

Embryoid body (EB) formation and in vitro differentiation

The iPSCs were detached using dispase (StemCell Technologies) and cultured in ultra-low adhesion six well plates in DMEM/F-12 medium, supplemented with 20% KO serum (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), 1X NEAA plus 10 μM Y-27632. After 24 h, Y-27632 was removed and EBs were cultured for another 6 days with medium changed every other day. Thereafter, EBs were transferred onto a gelatine-coated plate and cultured for another 8 days.

Karyotyping and cell identity

Karyotype analysis was performed in collaboration with the Genetic Medicine Laboratory of the Azienda Socio Sanitaria Territoriale Papa Giovanni XXIII, Bergamo (Italy). After the cells exhibited 70–80% confluency, they were treated with colcemid (Roche) for 3 h at 37 °C, then trypsinised and processed for karyotype analysis. 20 metaphase chromosome spreads were analysed with a G-band resolution of 550.

Cell line authentication was performed using the ATCC Human STR Profiling Cell Authentication Service.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Unique stem cell line identifier	IRFMNi001-B-1https://hpscreg.eu/cell-line/IRFMNi001-B-1
Alternative name(s) of stem cell line	CIITA-/-; Clone XI CIITAKO;
Institution	Istituto di Ricerche Farmacologiche Mario Negri (IRFMN) IRCCS
Contact information of the reported cell line distributor	Susanna Tomasonisusanna.tomasoni@marionegri.it
Type of cell line	iPSC
Origin	Human
Additional origin info	Sex: maleEthnicity: Caucasian
Cell Source	Normal Human Dermal Fibroblasts Neonatal (NHDF-Neo)
Method of reprogramming	Sendai Virus
Clonality	Clonal
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	Transgene free
Cell culture system used	mouse embryonic fibroblast (MEF)-feeder layer
Type of Genetic Modification	Induced mutation/ Insertion
Associated disease	N/A
Gene/locus	CIITA/16p13.13
Method of modification/site-specific nuclease used	CRISPR/Cas9 mediated gene knockout
Site-specific nuclease (SSN) delivery method	Plasmid nucleofection
All genetic material introduced into the cells	Cas9 expressing plasmid
Analysis of the nuclease-targeted allele status	Sanger sequencing of the targeted allele
Method of the off-target nuclease activity surveillance	Sanger sequencing of the potential off-target sites
Name of transgene	N/A
Eukaryotic selective agent resistance (including inducible/gene expressing cell-specific)	Negative
Inducible/constitutive system details	N/A
Date archived/stock date	March 2021
Cell line repository/bank	N/A
Ethical/GMO work approvals	Cell source (NHDF-Neo) was purchased from Lonza (https://bioscience.lonza.com/)
Addgene/public access repository recombinant DNA sources’ disclaimers (if applicable)	pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138) RRID: Addgene_48138