| Literature DB >> 34686347 |
Mario de la Fuente Revenga1, Bohan Zhu2, Christopher A Guevara3, Lynette B Naler2, Justin M Saunders4, Zirui Zhou2, Rudy Toneatti4, Salvador Sierra4, Jennifer T Wolstenholme5, Patrick M Beardsley6, George W Huntley3, Chang Lu7, Javier González-Maeso8.
Abstract
Clinical evidence suggests that rapid and sustained antidepressant action can be attained with a single exposure to psychedelics. However, the biological substrates and key mediators of psychedelics' enduring action remain unknown. Here, we show that a single administration of the psychedelic DOI produces fast-acting effects on frontal cortex dendritic spine structure and acceleration of fear extinction via the 5-HT2A receptor. Additionally, a single dose of DOI leads to changes in chromatin organization, particularly at enhancer regions of genes involved in synaptic assembly that stretch for days after the psychedelic exposure. These DOI-induced alterations in the neuronal epigenome overlap with genetic loci associated with schizophrenia, depression, and attention deficit hyperactivity disorder. Together, these data support that epigenomic-driven changes in synaptic plasticity sustain psychedelics' long-lasting antidepressant action but also warn about potential substrate overlap with genetic risks for certain psychiatric conditions.Entities:
Keywords: 5-HT2A receptor; GPCR; depression; epigenomics; hallucinogens; psychedelics; psychosis; schizophrenia; serotonin (5-HT); synaptic plasticity
Mesh:
Substances:
Year: 2021 PMID: 34686347 PMCID: PMC8582597 DOI: 10.1016/j.celrep.2021.109836
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1.Post-acute effects of DOI on passivity and fear extinction
(A–H) Behavior was tested 24 h (A-G) or 7 days (H) after a single injection (i.p.) of DOI (2 mg/kg) or vehicle.
(A and B) Lack of effect of DOI on exploratory behavior in an open field (n = 6 mice per group). Time-course (A, F[1,10] = 0.006, p > 0.05) and total horizontal activity (B, t10 = 0.07, p > 0.05).
(C and D) Lack of effect of DOI on dark-light choice test (n = 5 mice per group). Time (s) spent in the light zone (C, F[1,8] = 0.08, p > 0.05) and total exploratory time during the 15-min test (D, t8 = 1.14, p > 0.05).
(E) Lack of effect of DOI on the novel-object recognition test (n = 6 mice per group, acquisition versus recognition, F[1,20] = 13.06, p < 0.01; vehicle versus DOI, F[1,20] = 0.16, p > 0.05).
(F) Lack of effect of DOI on the PPI of startle (n = 5 mice per group, F[1,24] = 0.41, p > 0.05).
(G) Reduction of immobility time (s) during the last 4 min of the 6-min forced swimming test (10 mice per group, t18 = 3.80; p < 0.01).
(H) Reduction of immobility time (s) during the last 4 min of the 6-min forced swimming test (5 mice per group, t8 = 2.96; p < 0.05).
(I–K) Effect of DOI on contextual fear extinction in 5-HTR (J) and 5-HTR (K) mice. Timeline of the experimental design (I). Fear conditioning (J, n = 26 mice, F[6, 175] = 73.69, p < 0.001; K, n = 12 mice, F[6, 77] = 58.76, p < 0.001), generalization (J, n = 11–15 mice per group, t24 = 0.24, p > 0.05; K, n = 6 mice per group, t10 = 3.04, p < 0.05), extinction (J, n = 11–15 mice per group, F[1, 96] = 5.51, p < 0.05; K, n = 6 mice per group, F[1, 40] = 2.29, p > 0.05).
(L and M) Effect of DOI on fear acquisition. Timeline of the experimental design (L). Fear conditioning (n = 14–15 mice per group; conditioning, F[6,189] = 95.86, p < 0.001; vehicle versus DOI, F[1,189] = 0.91, p > 0.05), expression (n = 14–15 mice per group, t27 = 1.61, p > 0.05), generalization (n = 14–15 mice per group, t27 = 2.34, p < 0.05), extinction (n = 14–15 mice per group; extinction, F[3,104] = 20.17, p < 0.001; vehicle versus DOI, F[1,104] = 10.65, p < 0.01) (M).
Statistical analysis was performed using two-way repeated-measures ANOVA (A), two-way ANOVA with Sidak’s multiple comparison test (C, E, F, J, K, and M), or Student’s t test (B, D, G, H, J, K, and M). *p < 0.05, **p < 0.01, ***p < 0.001, n.s., not significant. Error bars represent SEM.
Figure 2.Post-acute effects of DOI on frontal cortex synaptic plasticity
(A–E) Effect of DOI on synaptic structural elements in the frontal cortex of 5-HTR and 5-HTR mice (n = 17–25 dendrites from independent neurons from both hemispheres in 3–4 mice per group). Samples were collected 24 h after a single injection (i.p.) of DOI (2 mg/kg) or vehicle. Representative three-dimensional reconstructions of AAV-injected cortical dendritic segments (A). Total (B), 5-HTR versus 5-HTR mice, F[1,78] = 5.72, p < 0.05; vehicle versus DOI, F[1,78] = 7.31, p < 0.01), stubby (C), 5-HTR versus 5-HTR mice, F[1,78] = 13.56, p < 0.001; vehicle versus DOI, F[1,78] = 9.65, p < 0.01), thin (D), 5-HTR versus 5-HTR mice, F[1,78] = 5.27, p < 0.05; vehicle versus DOI, F[1,78] = 4.28, p < 0.05), mushroom (E), 5-HTR versus 5-HTR mice, F[1,78] = 0.03, p > 0.05; vehicle versus DOI, F[1,78] = 2.90, p > 0.05).
(F–H) A single dose (i.p) of DOI (2 mg/kg) significantly enhanced cortical LTP in comparison with saline-injected mice assayed 24-h post-injection. Normalized EPSC amplitudes obtained from whole-cell patch-clamp recordings of L2/3 neurons from either DOI-injected (n = 5 neurons from 5 mice) or vehicle-injected (n = 6 neurons from 5 mice) animals. LTP was induced by a protocol that pairs extracellular presynaptic stimulation of L4 neurons with brief (10 min) postsynaptic depolarization of overlying L2/3 neurons to 0 mV (gray bar). Symbols represent EPSCs averaged by 1-min bins (vehicle versus DOI, F[1,10] = 9.84, p < 0.05) (F). Average magnitude of LTP (normalized EPSCs recorded over the 15- to 40-min post-induction period) from DOI-treated mice and controls (t9 = 3.05, p < 0.05) (G). Representative traces of EPSCs recorded from L2/3 neurons from DOI- or vehicle-treated mice at baseline and following induction of LTP (H).
Statistical analysis was performed using two-way ANOVA with Sidak’s multiple comparison test (B–E), two-way repeated-measures ANOVA (F), or Student’s t test (G). *p < 0.05, **p < 0.01, ***p < 0.001, n.s., not significant. Error bars represent SEM.
Figure 3.Post-acute effects of DOI on frontal cortex epigenomic and transcriptomic variations
(A) Effect of DOI on time-lapse epigenomic variations in neuronal nuclei of the mouse frontal cortex. K-means clustering of differential enhancers based on normalized H3K27ac signal (n = 3,995; Cluster sizes from top to bottom: 852, 718, 585, 419, 700, and 721). The top-five enriched biological process gene ontology (GO) terms identified by clusterprofiler are listed next to each cluster, and the top four motifs enriched in each cluster are listed next to the GO terms together with their sequences (n = 6 mice per group).
(B) K-means clustering of normalized gene expression (n = 13,605). Cluster sizes from top to bottom: 604, 2,120, 3,748, 708, 497, 1,507, 4,421.
(C) Significance of overlaps between differential and static H3K27ac peaks and NHGRI-EBI GWAS SNP sets. Significance is calculated using a null distribution and is shown as uncorrected –log(p value). The red dotted line denotes p < 0.05 cutoff. GWAS sets are ordered according to significance associated with the differential peaks.
Figure 4.Two gene co-expression modules (blue and yellow) associated with administration of DOI
(A and D) Heatmap of normalized gene expression profiles in the co-expression module (top). The module eigengene values across samples in four experimental groups (bottom).
(B and E) Selected top categories from GO enrichment analysis.
(C and F) Visualization of the intramodular connections among the top 100 hub genes in each module. The top 5 genes are in large size and colored orange. The genes involved in the top 15 GO terms are labeled.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| Alexa 488 conjugated anti-NeuN | Millipore | Cat# MAB377X; RRID: AB_2149209 |
| anti-H3K27ac | Active Motif | Cat# 39135; RRID: AB_2614979 |
|
| ||
| Bacterial and virus strains | ||
|
| ||
| AAV8.CamKIIα.eYFP | UNC Vector Core | Custom order |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| (±) DOI (1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane hydrochloride) | Sigma Aldrich | Cat# D101 |
| Isoflurane | Henry Schein | Cat# 1182097 |
| Protease Inhibitor Cocktail | Sigma Aldrich | Cat# P8340–5ML |
| Recombinant Ribonuclease Inhibitor | Takara Bio | Cat# 2313B |
| OptiPrep Density Gradient Medium | Sigma Aldrich | Cat# D1556–250ML |
| Normal Goat Serum (10%) | Life Technologies | Cat# 50062Z |
| Micrococcal Nuclease | Thermo Scientific | Cat# PI88216 |
| SPRIselect beads | Beckman Coulter | Cat# B23317 |
| Superscript II reverse transcriptase | Life Technologies | Cat# 18064014 |
| KAPA HiFi HotStart ReadyMix | KAPA Biosystems | Cat# KK2601 |
| dNTP mix | Life Technologies | Cat# 18427088 |
|
| ||
| Critical commercial assays | ||
|
| ||
| Locomotor activity monitoring | Omnitech Inc | Fusion V5.3 |
| Pre-pulse inhibition of the startle | San Diego Instruments | SR-LAB Startle Response System |
| Fear acquisition and extinction | Med Associates | MED-VFCNIR-M |
| Confocal microscopy | Carl Zeiss | CLM710 |
| Voltage-clamp recording | Molecular Devices | Multiclamp 700B amplifier, Digitizer 1140A, Cornerstone S-900 stimulator |
| Cell Sorter | BD Biosciences | BD FACSAria III |
| RNAeasy mini kit | QIAGEN | Cat #74104 |
| RNase-Free DNase Set | QIAGEN | Cat #79254 |
| Nextera XT DNA Library Prep kit | Illumina | Cat# FC-131–1024 |
| ACCEL-NGS 2S Plus DNA library kit | Swift Biosciences | Cat# 21024 |
| 2S Indexing Kit | Swift Biosciences | Cat# 26396 |
| Sequencing platform | Illumina | Illumina Hi-seq 4000 |
| High Sensitivity DNA analysis kit | Agilent | Cat# 5067–4626 |
| TapeStation | Agilent | Ca# 2200 |
| KAPA library quantification | Kapa Bio | Cat# KK4809 |
|
| ||
| Deposited data | ||
|
| ||
| ChIP-seq and RNA-seq raw and processed data | Gene Expression Omnibus | GEO: GSE161626 |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| Mouse 129S6/SvEv | Taconic Farms | Cat #129SVE-M |
| Mouse C57BL/6NTac | Taconic Farms | Cat # B6-M |
| Mouse |
| N/A |
| Mouse C57BL/6J | JAXS | Cat #00064 |
|
| ||
| Oligonucleotides | ||
|
| ||
| TSO: AAGCAGTGGTATCAACGCAGAG TACATrGrG+G (rG: riboguanosines; +G: LNA-modified guanosine) | Integrated DNA Technologies | N/A |
| Oligo-dT30VN: AAGCAGTGGTATCAACG CAGAGTACT30VN (N: any base; V: T, C or G) | Integrated DNA Technologies | N/A |
| ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT | Integrated DNA Technologies | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| NeuronStudio | Mount Sinai Imaging Center | v0.9.92 |
| Prism | GraphPad | v9 |
| Voltage-clamp recording | Molecular Devices | clampex 10.2 |
| Voltage-clamp offline analysis | Molecular Devices | Campfit 10.2 |
| Trim Galore! | N/A |
|
| Bowtie2 | ( |
|
| MACS2 |
|
|
| SAMTools |
|
|
| BEDTools | ( |
|
| SeqMonk | N/A | |
| HISAT2 |
|
|
| FeatureCounts | ( |
|
| DESeq2 |
|
|
| WGCNA | ( |
|
|
| ||
| Other | ||
|
| ||
| KIMBLE Dounce tissue grinder set | Sigma aldrich | Cat# D9063 |