Effect of piper extract mouthwash as postprocedural rinse on levels of Porphyromonas gingivalis in periodontitis patients.

BACKGROUND: Dental biofilm plays a crucial role in periodontal disease development. Mouth rinse is used to enhance oral hygiene after scaling and root planning (SRP). The aim of the study was to evaluate the clinical and microbiological effectiveness of a piper extract mouthwash against Chlorhexidine (CHX) in periodontitis patients.
MATERIALS AND METHODS: Sixty patients with Stage II periodontitis participated in this study and were randomly divided into two groups (Group I - Stage II Grade A periodontitis patients were provided with prepared piper extract mouthwash and Group II - Stage II Grade A periodontitis patients were provided with 0.2% CHX). Plaque index, gingival index, sulcus bleeding index, probing pocket depth, and clinical attachment level were recorded at baseline and 30 days after SRP. Subgingival plaque samples were taken for microbial examination (colony-forming unit), quantification of Porphyromonas gingivalis using the real-time polymerase chain reaction at baseline, and 30 days after SRP.
RESULTS: Intragroup comparison for the clinical parameters showed statistically significant reduction in both the groups (P < 0.0001). Intergroup comparison for clinical parameters, there was no statistical significance seen after 30 days. Intragroup comparison for microbial analysis showed significant reduction in both the groups after 30 days (P < 0.0001). On intergroup comparison for microbial analysis, both the groups showed reduction after 30 days without significance.
CONCLUSION: Piper extract mouthwash (Group I) showed similar antimicrobial activity against P. gingivalis when compared to 0.2% CHX mouthwash (Group II) that could be used as a substitute to CHX. Copyright:

INTRODUCTION

Periodontitis is an inflammatory disease caused by pathogenic microorganisms in dental plaque, resulting in periodontal pocket formation, loss of attachment, and alveolar bone around the tooth.[1] Scaling and root planing (SRP) is a gold-standard treatment for periodontitis that is performed to reduce the subgingival microbial load and disrupt microbial biofilm. SRP can be supplemented with mouthwash, subgingival irrigation, systemic antibiotics, or local drug delivery to improve the treatment outcome.[2] Maintenance phase is the most important phase in the treatment sequence. Supportive care plays a major role in the treatment plan. Postprocedural care is more essential to maintain oral hygiene and improve treatment result. Preprocedural care helps in reducing the surgical load, whereas postprocedural care is important for posttreatment outcome. Mouthwash helps to maintain oral hygiene when used along with mechanical cleaning procedures.[3] Chlorhexidine (CHX), a bisguanide is considered hallmark of antimicrobial rinses due to its high substantivity and wide range of activity. Studies have demonstrated the effectiveness of rinsing with CHX antimicrobial mouthrinse in significantly reducing bacterial biofilm.[4] Due to the ill-effects of CHX, plant extracts are used as alternatives.[5] Recently, herbal products are incorporated in dentifrice, mouthwash, gum paints, gum astringents, and oral gels to forfend biofilm formation.[6] Piper betle is an edible plant in Family Piperaceae that has been used as a main active composition in many Asian folk medicinal remedies for a very long time. The extracts of P. betle have been reported to have several pharmacological effects such as anti-inflammatory, anti-allergic, wound healing, antiplatelet, antioxidant including antibacterial and antifungal activities.[7] Thus, the aim of the study was to evaluate the clinical and anti-microbial efficacy of piper extract as postprocedural mouthwash against commercially available CHX mouthwash in periodontitis patients after SRP.

MATERIALS AND METHODS

The study was registered in the University Research Committee. This study was approved by the human subject ethics board of the University and was conducted in accordance with the Helsinki Declaration of 1975, as revised in 2013. Single blinding of the patients was done to prevent bias in the study. Piper extract mouthwash was formulated at Faculty of Pharmacy, and microbiological analysis was done in the department of microbiology.

A total of 85 patients with Stage II Grade A periodontitis who came to the Department of Periodontics and Implantology were assessed and 60 patients satisfying the eligibility criteria were randomly selected by the coin toss method. Patients within the age group of 35–55 years (42 female and 18 male) with a minimum of 20 natural teeth were included in the study. Patients who underwent periodontal therapy within a year, pregnant women, lactating mothers, smokers, patients with systemic diseases, patients who were under antibiotic and nonsteroidal anti-inflammatory drugs for the past 6 months were excluded from the study. All participants were motivated and described about the study protocol. Informed consent was obtained from all the participants. All patients reported promptly at the follow-up time. No patient developed allergy or burning sensation to mouthwash. Participants were divided into two groups:

Group I: 30 patients underwent SRP and provided with piper extract mouthwash

Group II: 30 patients underwent SRP and provided with 0.2% CHX mouthwash.

Plaque index (Silness J and Loe H, 1964), gingival index (Loe H and Silness J 1963), sulcus bleeding index (Muhlemann and son 1971), periodontal probing depth, and clinical attachment level (CAL) were recorded at baseline and 30 days after using the mouthwash. All the participants underwent subgingival SRP after baseline measurements. Subgingival plaque samples were collected with a sterile curette from the buccal surface of upper molar and lingual surface of lower molar at baseline and 30 days after SRP and were transported to the microbiology laboratory in phosphate-buffered saline for quantification of microorganisms in the sample by colony-forming units (CFUs).

Fresh Piper (betel) leaves were procured. The leaves were minced and extracted by hydro-alcohol solution (50:50) using a maceration technique for 3 days. The liquid extract was then concentrated by placing the petridish in an electric water bath at 40°C till remaining extract dried completely. Dried extract was scraped out and employed for the preparation of mouthwash. The prepared mouthwash contains Piper extract – 2% as main ingredient, Ethanol – 0.2%, glycerol – 2%, propylene glycol – 2% as solvent, sorbitol – 15% as sweetening agent, peppermint oil – 0.05% as flavoring agent, methyl paraben – 0.05% as preservative, amaranth –0.1% as coloring agent, and distilled water-100 ml as vehicle. Herbal extract was dissolved in ethanol using magnetic stirrer for 1 h. The final mouthwash was transferred into clean dry containers and stored at cool dry place until use.

After SRP, participants of Group I were provided with piper mouthwash (150 ml) (30 ml × 5 bottles for each patient) and were instructed to use 5 ml of the piper mouthwash (using measuring cap) without dilution twice a day, 30 min after brushing. While participants of Group II were provided with CHX mouthwash and were asked to rinse with 5 ml of the mouthwash twice a day for 30 days, 30 min after brushing. Participants were asked not eat or drink anything immediately after using mouthwash. In our study, patients were asked to use the mouthwash after SRP twice daily after brushing. They were asked to report for review after 30 days. No reminder or telephonic conversation was done with any of the patients to prevent Hawthorne effect. Re-evaluation of the patients was done after 30 days in both the groups according to Segelnick and Weinberg.[8]

Microbial analysis

The collected subgingival plaque samples were inoculated on blood agar plate by lawn culture method and incubated at 37° C for 24 h and analyzed using automated colony counter for CFU. Quantification of Porphyromonas gingivalis in the plaque sample was done using the real-time polymerase chain reaction (PCR). Quantification of P. gingivalis in the plaque sample was done using real-time PCR. The samples were collected, and DNA was isolated. Primer used in the study was PG13. The sequence used was CATCGGTAGTTGCTAACAGTTTTCGPGATGA CGTCAAATCAGCACGGCCCTTACAT. The reactions were carried out in a PE 7700 thermocycler, and the fluorescence was monitored throughout the reaction. DNA denaturation of samples was done by adding plaque sample to water and heating at 100uC for 1 min, followed by reagents. PCR was carried out under the following conditions: Initial cycle of denaturation at 94uC for 5 min and 35 cycles of denaturation at 95uC for 30 s, primer annealing at 64uC for 30 s, extension at 72uC for 1 min, and final extension at 72uC for 5 min. Aliquots of 15 ml of PCR reaction mixture were separated on 1.5% agarose gel in the presence of ethidium bromide and visualized using the GelDoc system (Bio-Rad, USA). Number of P. gingivalis was determined in 5 ml of originally extracted genomic DNA samples and calculated from the standard curve generated.

Statistical analysis

Data were analyzed using the Statistical Package for the Sciences software SPSS version 22 IBM SPSS Statistics for Windows, Version 22.0. Armonk, NY: IBM Corp. Intragroup comparison of clinical parameters and microbial analysis at baseline and on 30th day was analyzed using the Student's paired t-test. Intergroup comparison of clinical parameters and microbial analysis at baseline and after 30 days was analyzed using the independent t-test. P ≤ 0.05 was considered statistically significant.

RESULTS

Intragroup comparison of clinical parameters (plaque index, gingival index, sulcus bleeding index, periodontal probing depth, and CAL) showed statistically significant reduction in Group I and Group II patients (P < 0.0001) [Table 1]. Intergroup comparison of clinical parameters showed difference after 30 days without significance [Table 2]. Intragroup comparison for microbial analysis (CFU, Threshold Cycles) showed significant reduction after 30 days in both the groups (P < 0.0001) [Table 3]. Intergroup comparison showed a higher reduction of CFU and threshold cycle values in Group I patients compared to Group II patients without statistical significance [Table 4].

Table 1

Intragroup comparison of clinical parameters using paired t-test

	Mean±SD
	Plaque index	Gingival index	Sulcus bleeding index	Pocket depth	Clinical attachment level
Group I baseline	2.11±0.1	2.15±0.54	2.05±0.08	3.80±0.09	4.11±0.02
After treatment	0.78±0.08	0.85±0.65	1.01±0.05	2.42±0.04	3.05±0.01
P	0.001	0.001	0.001	0.001	0.0001
Group II baseline	2.15±0.11	2.11±0.05	2.08±0.07	3.85±0.04	4.15±0.24
After treatment	0.89±0.05	0.91±0.08	1.03±0.03	2.34±0.05	3.07±0.01
P	0.0005	0.0001	0.0001	0.0001	0.0001

P – Probability value. P<0.05 significant. SD – Standard deviation

Table 2

Intergroup comparison of parameters after treatment using independent t-test

Parameters	Groups	After treatment	P
Plaque index	Group I	0.78±0.08	0.064
	Group II	0.89±0.05
Gingival index	Group I	0.85±0.65	0.2143
	Group II	0.91±0.08
Sulcus bleeding index	Group I	1.01±0.05	0.1200
	Group II	1.03±0.03
Periodontal probing depth	Group I	2.42±0.04	0.290
	Group II	2.34±0.05
Clinical attachment level	Group I	3.05±0.01	0.081
	Group II	3.07±0.01

P – Probability value. P<0.05 significant

Table 3

Intragroup comparison of microbial analysis at baseline and after 1 month

Groups	CT		P	CFU		P
	Baseline	After 30 days		Baseline	After 30 days
Group 1	13.25±0.32	24.23±0.05	<0.0001 (significant)	46.42±6.22	10.2±1.42	<0.0001 (significant)
Group II	13.27±0.33	24.71±0.06	<0.0001 (significant)	45.13±6.46	9.9±1.60	<0.0001 (significant)

P – Probability value. P<0.05 significant. CT–Threshold cycle; CFU – Colony-forming units

Table 4

Intergroup comparison of microbial analysis at baseline and after 1 month

	Group I	Group II	P
CT
Baseline	13.25±0.32	13.27±0.33	0.1200
After 30 days	24.23±0.05	24.71±0.06	0.071
CFU
Baseline	46.42±6.22	45.13±6.46	0.061
After 30 days	10.2±1.42	9.9±1.60	0.120

P – Probability value. P<0.05 significant. CT – Threshold cycle; CFU – Colony-forming units

DISCUSSION

SRP is the gold standard management for periodontitis. Addition of mouthwash to oral hygiene practice after Phase I therapy is considered to improve the treatment effect. CHX is the most potent chemical for plaque control till date. Herbal products possess anti-inflammatory, antimicrobial, and antioxidant property that enhance oral hygiene similar to CHX.[7] Piper leaves are found to possess anti-inflammatory, anti-allergic, wound healing, antiplatelet, antioxidant including antibacterial and antifungal activities.[9] The bioactive compounds found in P. betle are several types such as allylpyrocatechol, eugenol, chavibetol, caryophyllene, and hydroxychavicol. Earlier studies showed that ethanolic extract had better efficacy compared to the aqueous extracts of herbs as aqueous extract had shorter shelf life and more prone for fungal growth.[10] Moreover, ethanol was found to penetrate the cellular membrane more easily to extract the intracellular ingredients from the plant material. It was also reported by Dwivedi and Tripathi that, the chavinol in betel leaf is an aromatic compound responsible for the spicy odor of the leaves.[11]

In this study, clinical parameters were recorded on day 0 and day 30. Subgingival plaque sample was collected to quantify CFU on day 0 and day 30. The result of the study showed significant difference in both the groups with regard to clinical parameters at baseline and after 30 days. Intragroup comparison with respect to microbial analysis showed significant difference in both the groups after 30 days, whereas intergroup comparison showed difference in microbial analysis without statistical significance.

Intragroup comparison of plaque index score in Group I showed reduction after 30 days (P < 0.0001) which could be due to antimicrobial effect of P. betle. This could be due to the flavonoids in piper. Flavonoids had been reported to have a major antimicrobial activity because they can interact with the bacterial cell wall. Moreover, lipophilic flavonoids could disrupt the microbial cell membranes.[12] CHX inhibits plaque as a result of an immediate bactericidal action and a prolonged bacteriostatic action. This could be the reason for significant reduction in plaque scores at baseline and after 30 days in Group II (P < 0.0001). In Group I, reduction in gingival index and sulcus bleeding index score could be due to the anti-inflammatory effect of flavanoids.[11] Reduction in probing pocket depth and improvement in CAL in both the groups were due to the effect of SRP.[13] P. gingivalis is a keystone pathogen and is found to be increased in periodontitis patients based on the severity. Gingipains is the main virulence factor possessed by P. gingivalis. Hydroxychavicol isolated from P. betle was studied for its inhibitory activity against oral cavity pathogens. Hydroxychavicol demonstrated bactericidal effects against all the bacteria tested including Streptococcus mutans, Enterococcus faecium, Enterococcus faecalis, Streptococcus sanguis, Actinomyces viscosus, Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Fusobacterium nucleatum, and P. gingivalis.[14] The microbial count and P. gingivalis levels in Group I showed significant reduction after 30 days. This could be due to the effect of hydroxychavicol. Group II also showed significant difference after 30 days. This is due to the effect of CHX mouthwash.[15] Our study showed that piper extract mouthwash was equally efficacious compared to CHX due its antimicrobial property. Studies have shown that CHX lack plaque inhibitory properties at lower concentrations.[16] Da Costa et al.[17] concluded that adjunctive use of CHX mouth rinse with mechanical SRP resulted in slightly greater PD reduction than did SRP alone. Considering the small additional gain in PD reduction, negligible effect on CAL, and potential for tooth staining when using CHX as an adjunct to SRP in treating chronic periodontitis. To the best of author's knowledge, this was the first study to test the effect of piper extract mouthwash as a post procedural rinse on levels of P. gingivalis in periodontitis patients. The result of the study could be majorly due to the effect of SRP and mouthwash could have an additional benefit with its anti-inflammatory and antioxidant properties. The study was conducted on lesser population for a shorter course of time which could not explain about long-term effectiveness of the herbal mouthwash. Substantivity of the herbal mouthwashes is not proven till today. Long-term study with the larger population on substantivity of the herbal mouthwashes could have provided better result and enhanced decision-making on mouthwash selection.

CONCLUSION

Although SRP plays a crucial role in periodontal management, supplementing with mouthwash postprocedurally has added benefit. Healing of periodontal tissue can be accelerated with herbal mouthwash due to its amorphous property. Within the limitations of the study, the newly formulated piper extract mouthwash when compared to 0.2% CHX mouthwash showed similar antimicrobial activity. Piper extract mouthwash could be supplemented after SRP for prolonged usage without side effects.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.