Laura Jenkins1, Sara Marsango1, Sarah Mancini1, Zobaer Al Mahmud1, Angus Morrison2, Stuart P McElroy2, Kirstie A Bennett3, Matt Barnes3, Andrew B Tobin1, Irina G Tikhonova4, Graeme Milligan1. 1. The Centre for Translational Pharmacology, Institute of Molecular, Cellular and Systems Biology, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ, United Kingdom. 2. BioAscent Discovery Ltd., Bo'Ness Road, Newhouse, Lanarkshire ML1 5UH, United Kingdom. 3. Sosei Heptares, Steinmetz Building, Granta Park, Great Abington, Cambridge CB21 6DG, United Kingdom. 4. School of Pharmacy, Medical Biology Centre, Queen's University Belfast, Belfast BT9 7BL, United Kingdom.
Abstract
GPR84 is a poorly characterized, nominally orphan, proinflammatory G protein-coupled receptor that can be activated by medium chain length fatty acids. It is attracting considerable interest as a potential therapeutic target for antagonist ligands in both inflammatory bowel diseases and idiopathic pulmonary fibrosis. Successful screening of more than 300 000 compounds from a small molecule library followed by detailed analysis of some 50 drug-like hits identified 3-((5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole as a high affinity and highly selective competitive antagonist of human GPR84. Tritiation of a di-iodinated form of the core structure produced [3H]3-((5,6-diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole, which allowed effective measurement of receptor levels in both transfected cell lines and lipopolysaccharide-treated THP-1 monocyte/macrophage cells. Although this compound series lacks significant affinity at mouse GPR84, homology modeling and molecular dynamics simulations provided a potential rationale for this difference, and alteration of two residues in mouse GPR84 to the equivalent amino acids in the human orthologue, predicted to open the antagonist binding pocket, validated this model. Sequence alignment of other species orthologues further predicted binding of the compounds as high affinity antagonists at macaque, pig, and dog GPR84 but not at the rat orthologue, and pharmacological experiments confirmed these predictions. These studies provide a new class of GPR84 antagonists that display species selectivity defined via receptor modeling and mutagenesis.
GPR84 is a poorly characterized, nominally orphan, proinflammatory G protein-coupled receptor that can be activated by medium chain length fatty acids. It is attracting considerable interest as a potential therapeutic target for antagonist ligands in both inflammatory bowel diseases and idiopathic pulmonary fibrosis. Successful screening of more than 300 000 compounds from a small molecule library followed by detailed analysis of some 50 drug-like hits identified 3-((5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole as a high affinity and highly selective competitive antagonist of human GPR84. Tritiation of a di-iodinated form of the core structure produced [3H]3-((5,6-diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole, which allowed effective measurement of receptor levels in both transfected cell lines and lipopolysaccharide-treated THP-1 monocyte/macrophage cells. Although this compound series lacks significant affinity at mouse GPR84, homology modeling and molecular dynamics simulations provided a potential rationale for this difference, and alteration of two residues in mouse GPR84 to the equivalent amino acids in the human orthologue, predicted to open the antagonist binding pocket, validated this model. Sequence alignment of other species orthologues further predicted binding of the compounds as high affinity antagonists at macaque, pig, and dog GPR84 but not at the rat orthologue, and pharmacological experiments confirmed these predictions. These studies provide a new class of GPR84 antagonists that display species selectivity defined via receptor modeling and mutagenesis.
Although
medium chain length
fatty acids (MCFAs) have been known for a considerable period of time
to be able to activate the G protein-coupled receptor (GPCR) GPR84,[1−3] this receptor remains classified as an “orphan”, i.e.
that the true activator(s) of the receptor remain undefined or uncertain.[4] Expressed by a variety of immune cells, including
monocytes, macrophages, and neutrophils in the periphery, and microglia
in the brain[2,3,5] as
well as tissues such as adipocytes[6] and
skeletal muscle,[7] GPR84 has recently attracted
considerable interest as a therapeutic target. In significant part,
this reflects that GPR84 transcript and protein level is upregulated
in many proinflammatory conditions and directly in response to proinflammatory
stimuli.[1,8−10] This suggests that blocking
the receptor might have value both in limiting the development of
inflammatory conditions and during their resolution. Despite the identification
and study of a significant number of predominantly lipid-like synthetic
compounds that have moderate to high agonist potency at GPR84,[2,11] the availability and variety of high affinity GPR84 antagonists
is much less extensive. Indeed, the only widely available high affinity
GPR84 antagonist is 9-cyclopropylethynyl-2-((S)-1-[1,4]dioxan-2-ylmethoxy)-6,7-dihydropyrimido[6,1-a]isoquinolin-4-one (GLPG1205).[12] This compound reduced disease activity index score and neutrophil
infiltration in a mouse dextran sodium sulfate-induced chronic inflammatory
bowel disease model[12] but failed to achieve
efficacy end points in clinical trials in ulcerative colitis.[12] By contrast, GLPG1205 has been reported to have
positive effects in mouse models of lung fibrosis[13] and is currently undergoing clinical trials in patients
with idiopathic pulmonary fibrosis (ClinicalTrials.gov Identifier:
NCT03725852), where it has shown an ability to lower lung function
decline in adults. These encouraging findings indicate that the availability
of a broader range of high affinity GPR84 antagonists would be of
considerable use in better understanding the therapeutic potential
to block this receptor in a range of conditions and might offer distinct
starting points for novel medicines. Herein, we report the discovery
and characterization of a novel series of high affinity and selective
antagonists of GPR84. In early studies, we noted that these molecules
were not active at mouse GPR84. However, from molecular modeling in
conjunction with mutagenesis, we delineate the molecular basis for
human versus mouse orthologue selectivity and subsequently confirm
the predicted activity or otherwise of this compound series at other
species orthologues of GPR84.
Results
Initial Screens
GPR84 is known to interact effectively
and selectively with pertussis toxin-sensitive Gi-family
G proteins and hence reduce levels of cAMP in cells.[1] In partnership with the European Lead Factory (https://www.europeanleadfactory.eu/) we successfully screened 301 665 drug-like small molecules[14] against human GPR84 expressed stably in Chinese
Hamster Ovary (CHO) cells (Figure a). A positive end point was suppression of the capacity
of the GPR84 agonist 2,5-dihydroxy-3-undecyl-1,4-benzoquinone (embelin)[2,11,15,16] to inhibit forskolin-mediated elevation of cAMP levels. Initial
hits that passed threshold were then retested in concentration–response
studies against both embelin and a second GPR84 agonist, 6-(octylamino)-2,4(1H,3H)-pyrimidinedione
(6-OAU)[2,8,9,11] (Figure a). This provided a preliminary hit list (PHL) of 260 compounds
(Figure b). Because
some of the hits possessed chemical similarity to cAMP phosphodiesterase
inhibitors, which would also be expected to elevate cAMP levels in
intact cells but in a manner independent of GPR84, we further assessed
the PHL compounds in an orthogonal assay using membrane preparations
generated from Flp-In TREx 293 cells stably expressing a human GPR84-Gαi2 fusion protein.[17] Here, we measured
the ability of compounds to prevent stimulation of binding of [35S]GTPγS induced by embelin (Figures a, 1b). Following
initial studies that were conducted at 3 μM (Figure b), concentration–response
curves of 98 compounds that were confirmed as actives in this distinct
assay resulted in a qualified hit list (QHL) of 49 compounds following
triage based on potency and chemical characteristics (Figure a). Such studies identified
compounds with IC50 (inhibitor concentration 50%) potency
of <100 nM against an EC80 (effective concentration
80%) of embelin, potentially indicative of low nanomolar affinity
at GPR84. Among these was the 1,2,4-triazine, designated compound
837, which was shown to have the highest potency. Synthesis of the
anticipated molecule (3-((5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole) (Figure c) confirmed its action as a high potency blocker of human
GPR84.
Figure 1
High throughput screening identifies a novel and potent GPR84 antagonist.
Ability of each of 301 665 compounds to prevent embelin-mediated
regulation of cAMP levels in CHO cells expressing human GPR84 was
assessed (a). 2866 compounds were taken forward into concentration–response
curves (CRCs) against both embelin and 6-OAU. Chemical- and potency-based
triage selected 260 compounds that formed the preliminary hit list
(PHL) (a). These compounds were further assessed in [35S]GTPγS binding assays performed on membranes of Flp-In TREx
293 cells induced to stably express a human GPR84-Gαi2 fusion protein (a, b). 98 compounds were taken forward into concentration–response
studies, and 49 designated a QHL (a). 3-((5,6-Diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole (compound 837) was resynthesized for detailed study
(c).
High throughput screening identifies a novel and potent GPR84 antagonist.
Ability of each of 301 665 compounds to prevent embelin-mediated
regulation of cAMP levels in CHO cells expressing human GPR84 was
assessed (a). 2866 compounds were taken forward into concentration–response
curves (CRCs) against both embelin and 6-OAU. Chemical- and potency-based
triage selected 260 compounds that formed the preliminary hit list
(PHL) (a). These compounds were further assessed in [35S]GTPγS binding assays performed on membranes of Flp-In TREx
293 cells induced to stably express a human GPR84-Gαi2 fusion protein (a, b). 98 compounds were taken forward into concentration–response
studies, and 49 designated a QHL (a). 3-((5,6-Diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole (compound 837) was resynthesized for detailed study
(c).
Pharmacological Characterization
of GPR84 Antagonists
2-(Hexylthiol)pyrimidine-4,6 diol (2-HTP)[2,10] is
a recently described and significantly more potent agonist of GPR84
than either 6-OAU or embelin. Compound 837 was able, in a concentration-dependent
manner, to fully block activation of human GPR84 promoted by each
of 2-HTP (Figure a)
and 6-OAU (Figure b) in [35S]GTPγS binding assays conducted in membranes
of Flp-In TREx 293 cells expressing a human GPR84-Gαi2 fusion protein. Both 2-HTP and 6-OAU are considered orthosteric
agonists of GPR84.[2,11] By contrast, 3,3′-diindolylmethane
(DIM) is an allosteric GPR84 activator[18] that binds at a site distinct from 2-HTP, 6-OAU and other orthosteric
agonists.[2,11,17,19] Compound 837 also fully reversed activation of human
GPR84 produced by DIM (Figure c). Moreover, compound 837 also fully blocked, in a concentration-dependent
manner, inhibition of forskolin-amplified cAMP levels produced by
both 2-HTP (Figure d) and 6-OAU (Figure e) in these same cells.
Figure 2
Compound 837 is a high potency antagonist of
both orthosteric and
allosteric activators of GPR84. Ability of varying concentrations
of compound 837 to inhibit the orthosteric GPR84 agonists 2-HTP (a,
d), 6-OAU (b, e), and the allosteric GPR84 activator DIM (c) was assessed
in [35S]GTPγS binding (a–c) and cAMP (d, e)
assays using Flp-In TREx 293 cells expressing the human GPR84-Gαi2 fusion protein (d, e) or membranes derived from these cells
(a–c). Concentration–response data for each agonist
are also displayed and used to assess EC80 concentrations
for the studies with 837.
Compound 837 is a high potency antagonist of
both orthosteric and
allosteric activators of GPR84. Ability of varying concentrations
of compound 837 to inhibit the orthosteric GPR84 agonists 2-HTP (a,
d), 6-OAU (b, e), and the allosteric GPR84 activator DIM (c) was assessed
in [35S]GTPγS binding (a–c) and cAMP (d, e)
assays using Flp-In TREx 293 cells expressing the human GPR84-Gαi2 fusion protein (d, e) or membranes derived from these cells
(a–c). Concentration–response data for each agonist
are also displayed and used to assess EC80 concentrations
for the studies with 837.Compound 837 acted as an orthosteric antagonist. Measured EC50 (effective concentration 50%) of 2-HTP was increased a concentration-dependent
manner by compound 837 in [35S]GTPγS binding studies
(Figure a), with estimated
affinity of compound 837 (pA2) 8.90 ± 0.08 (mean ±
SEM, n = 4), i.e. 1.26 nM. Compound 837 was also
competitive with 2-HTP because the inhibitory effect of compound 837
was fully overcome upon addition of increasing concentrations of the
agonist (Figure a).
Limited chemistry around the structure of compound 837 generated compounds
020 (4-(3-((1H-indol-3-yl)methyl)-6-phenyl-1,2,4-triazin-5-yl)benzyl
acetate) and 021 (4-(3-((1H-indol-3-yl)methyl)-5-phenyl-1,2,4-triazin-6-yl)benzyl
acetate)that remained competitive with 2-HTP but displayed even higher
affinity (020, pA2 = 9.19 ± 0.10, 021, pA2 = 9.31 ± 0.10, means ± SEM, n = 3) (Figures b, 3c).
Figure 3
Compound 837 and more potent analogues are competitive orthosteric
antagonists at human GPR84. Ability of varying concentrations of compound
837 (a), compound 020 (b), and compound 021 (c) (structures shown
below) to alter the concentration–response curve of 2-HTP in
[35S]GTPγS binding assays performed using membranes
of Flp-In TREx 293 cells induced to stably express a human GPR84-Gαi2 fusion protein. (d–f) Schild plots of the data shown
in panels a–c. Estimated Gaddum/Schild slopes from such plots
(d, 1.11 ± 0.04; e, 1.27 ± 0.03; f, 1.14 ± 0.03) were
not different from 1.0 (p > 0.05), consistent
with
a competitive mode of action.
Compound 837 and more potent analogues are competitive orthosteric
antagonists at human GPR84. Ability of varying concentrations of compound
837 (a), compound 020 (b), and compound 021 (c) (structures shown
below) to alter the concentration–response curve of 2-HTP in
[35S]GTPγS binding assays performed using membranes
of Flp-In TREx 293 cells induced to stably express a human GPR84-Gαi2 fusion protein. (d–f) Schild plots of the data shown
in panels a–c. Estimated Gaddum/Schild slopes from such plots
(d, 1.11 ± 0.04; e, 1.27 ± 0.03; f, 1.14 ± 0.03) were
not different from 1.0 (p > 0.05), consistent
with
a competitive mode of action.
The Molecular Basis of Species Orthologue Selectivity
Mouse
GPR84 displayed equal potency for the agonist 2-HTP (EC50 7.38 ± 0.06, mean ± SEM, n =
3) as the human orthologue (EC507.41 ± 0.10, mean
± SEM, n = 3). However, despite the high affinity
of compound 837 for human GPR84 this ligand displayed no significant
capacity to antagonize mouse GPR84 (Figure a), while compound 020 displayed only limited
effects at concentrations at least 1000-fold higher than required
to antagonize human GPR84 (Figure b). Indeed, using Gaddum/Schild analysis no measurable
pA2 could be recorded for compound 837 (Figure c), while pA2 <
6.0 was estimated for compound 020 at mouse GPR84 (Figure d).
Figure 4
The 1,2,4-triazine ligands
are not effective antagonists of mouse
GPR84. Ability of increasing concentrations of compound 837 (a) and
compound 020 (b) to antagonize effects of EC80 concentrations
of 2-HTP at human (circles) and mouse (squares) GPR84 in [35S]GTPγS binding assays performed on membranes of Flp-In TREx
293 cells induced to stably express either a human or mouse GPR84-Gαi2 fusion protein is shown. The low affinity of 837 (c) and
compound 020 (d) at mouse GPR84 was confirmed by their lack of ability
to substantially effect the observed EC50 of 2-HTP at the
mouse GPR84-Gαi2 fusion protein.
The 1,2,4-triazine ligands
are not effective antagonists of mouse
GPR84. Ability of increasing concentrations of compound 837 (a) and
compound 020 (b) to antagonize effects of EC80 concentrations
of 2-HTP at human (circles) and mouse (squares) GPR84 in [35S]GTPγS binding assays performed on membranes of Flp-In TREx
293 cells induced to stably express either a human or mouse GPR84-Gαi2 fusion protein is shown. The low affinity of 837 (c) and
compound 020 (d) at mouse GPR84 was confirmed by their lack of ability
to substantially effect the observed EC50 of 2-HTP at the
mouse GPR84-Gαi2 fusion protein.Mouse and human GPR84 are some 85% identical in the extracellular
(ECL) regions and transmembrane domains (TMDs) (Figure a). To attempt to define the basis for the
species selectivity of compound 837, we synthesized a series of gene
chimeras in which we introduced differences in these regions from
the human receptor into the mouse orthologue. Following expression,
each of these forms displayed similar potency for 2-HTP (Figure b). These included
a form in which all residues in the ECLs and TMDs that differ between
these orthologues were altered to the human sequence within the backbone
of mouse GPR84 (Figure b). Compound 837 displayed equal affinity at this chimera as at the
wild-type human receptor (Figure c), hence defining that the human-mouse difference
in affinity for 837 and related compounds must by imbued by residue(s)
within the ECLs and/or TMD regions. Interestingly, the only previously
described group of high affinity GPR84 antagonists are known to have
some 30–60 fold lower affinity for the mouse orthologue than
for human GPR84.[12,17] The affinity of the exemplar
member of this series, GLPG1205,[17] also
was equal at the chimera in which all ECL and TMD residues were from
the human sequence as at the wild-type human sequence (Figure d). Despite substantial efforts
to define the basis of selectivity for compound 837 more clearly using
a chimera approach, for example by altering all of extracellular loop
3 (ECL3) and transmembrane domain 7 (TMD7), that contains 4 amino
acid differences, TMD1 + ECL1 + TMD3 (6 differences), or the segments
TMD4 + ECL2 + TMD5 (9 differences), where each of these constructs
displayed similar potency for 2-HTP (Figure b), none of these regional chimeras gained
substantial affinity for compound 837 although the ECL3/TM7 gained
some affinity (pIC50 = 6.44 ± 0.1) (Figure e).
Figure 5
Chimeras of human/mouse
GPR84 demonstrate lack of a linear segment
responsible for the difference in antagonist affinity. Primary amino
acid sequence of mouse GPR84 is shown with predicted extracellular
regions and transmembrane domains boxed (a). Differences in these
regions in human GPR84 are highlighted (*). A series of synthetic
cDNA sequences able to encode chimeric human/mouse forms of GPR84
were generated and expressed stably in Flp-In TREx 293 cells. Humanized
mGPR84 corresponds to the form in which all the differing residues
were altered to the human residue. Each of the chimeras displayed
similar potency of response to 2-HTP (b). 2-HTP-mediated activation
of this “humanized” variant was antagonized by compound
837 as effectively as wild-type human GPR84 (c). This was also the
case for GLPG1205, which is known to have lower affinity at mouse
GPR84 compared to human[12] (d). By contrast,
synthetic chimeras that introduced various linear or discontinuous
segments of human GPR84 into the mouse orthologue, with the exception
of the ECL3/TM7 form, all failed to generate a form where the activity
of 2-HTP was blocked by compound 837 (e).
Chimeras of human/mouse
GPR84 demonstrate lack of a linear segment
responsible for the difference in antagonist affinity. Primary amino
acid sequence of mouse GPR84 is shown with predicted extracellular
regions and transmembrane domains boxed (a). Differences in these
regions in human GPR84 are highlighted (*). A series of synthetic
cDNA sequences able to encode chimeric human/mouse forms of GPR84
were generated and expressed stably in Flp-In TREx 293 cells. Humanized
mGPR84 corresponds to the form in which all the differing residues
were altered to the human residue. Each of the chimeras displayed
similar potency of response to 2-HTP (b). 2-HTP-mediated activation
of this “humanized” variant was antagonized by compound
837 as effectively as wild-type human GPR84 (c). This was also the
case for GLPG1205, which is known to have lower affinity at mouse
GPR84 compared to human[12] (d). By contrast,
synthetic chimeras that introduced various linear or discontinuous
segments of human GPR84 into the mouse orthologue, with the exception
of the ECL3/TM7 form, all failed to generate a form where the activity
of 2-HTP was blocked by compound 837 (e).To explore this further, we turned to homology modeling and molecular
dynamics (MD) simulations. In the absence of a GPR84 experimental
structure or a 3D template of the receptor with high sequence similarity
we built homology models of human and mouse GPR84 using a multitemplate
hybridization approach. In this approach, a template of a TMD with
the highest sequence similarity from GPCRs with available experimental
structures was selected to model each TMD of GPR84. This approach
provided a template with an average sequence similarity of 52% within
the TMDs, and this was used to model human and mouse GPR84 structures.
Once the TMD helices had been modeled, extracellular and intracellular
loops were generated (see Methods), where
ECL2 was modeled based on the rhodopsin template due to high sequence
similarity.[20] The location of nonconserved
residues between mouse and human orthologues on the GPR84 homology
model is shown in Figure a. To further establish the impact of these variations on
the 3D structure, we conducted 300 ns MD simulations of the human
and mouse GPR84 models in the empty form in a water–lipid bilayer.
The GPR84 models were stable in the simulations with average carbon
α atom root-mean-square deviation (RMSD) 3.0 ± 0.5A. From
such MD simulations we assessed the position and interactions of the
species nonconserved residues and noted that two of these, Thr102 (residue locator position 3.34[21] and Ser363 (residue locator position 7.46) of the mouse
receptor are engaged in interhelical hydrogen bonding. Specifically,
Thr102 forms a hydrogen bond with Gly148 (residue
locator position 4.53) while Ser363 interacts with Gln74 (residue locator position 2.58) (Figure b). Once formed these hydrogen bonds were
maintained throughout the simulated time. The hydrogen bond between
Ser363-Gln74 results in movement of the extracellular
side of TMD helix 7 closer to helix 2, reducing the extracellular
cavity involving helices 1, 2, and 7. In contrast, Gly at position
7.46 in human GPR84 increases mobility and causes slight outward movement
of helix 7. We also observed changes in the position of helices 3
and 5. Figure c shows
the average cavity in the extracellular side of the helical bundle
of human and mouse GPR84 models from MD simulations detected by the
MDpocket tool[22] and the putative docking
pose of compound 837 within human GPR84. As can be seen, the size
and the shape of the binding cavities in mouse and human GPR84 are
distinct, providing a potential structural basis as to why the compound
series was not capable of binding to mouse GPR84. No other notable
difference in interactions and conformations of other nonconserved
residues were observed during the simulations. Such studies suggested
that combined alteration (human to mouse) of Ala102Thr
and Gly363Ser might be sufficient to limit or prevent binding
of antagonists from this chemical series. As anticipated because,
as highlighted above, in contrast to these antagonists the potency
of agonist ligands is very similar at human and mouse GPR84, 2-HTP
potently activated Ala102Thr, Gly363Ser human
GPR84 (Figure d).
However, compound 837 was now unable to block this effect (Figure d). To extend these
studies, we performed the reverse mutations and generated Thr102Ala, Ser363Gly mouse GPR84. Now, although the
EC50 of 2-HTP at this variant was reduced by some 3-fold
compared to wild-type mouse GPR84, compound 837 was effective as an
antagonist and able to fully block activation by 2-HTP (Figure e). To gain further insights,
we assessed the affinity of compound 837 at both Thr102Ala, Ser363Gly mouse GPR84 and Ala102Thr, Gly363Ser human GPR84 by measuring the extent of displacement
of the EC50 of 2-HTP to higher concentrations in the presence
of increasing concentrations of compound 837 at both the residue swap
mutants and the corresponding wild-type orthologues. The affinity
of compound 837 at mouse GPR84 was immeasurably low (pA2 < 4.00, i.e. <100 μM) compared to human GPR84 (pA2 = 8.9, see above). However, at Thr102Ala, Ser363Gly mouse GPR84 the estimated pA2 of compound
837 was 7.78 ± 0.08 (mean ± SEM n = 3),
only some 13-fold lower than at wild-type human GPR84 and at least
5000-fold higher than at wild-type mouse GPR84. Reciprocally, although
Ala102Thr, Gly363Ser human GPR84 retained measurable
affinity for compound 837 (pA2 = 6.33 ± 0.15, mean
± SEM n = 3) this was 380-fold lower than at
wild-type human GPR84.
Figure 6
Dynamics of mouse and human GPR84 homology models helps
to predict
amino residues responsible for species selectivity of the 1,2,4-triazine
antagonists. Nonconserved residues between mouse and human orthologues
are shown on the human GPR84 homology model in space-filling representation
(a). The receptor model is shown in cartoon representation. Nonconserved
residues of the third intracellular loop are omitted. Amino acids
from human and mouse are shown in black and red and residue labels
respectively using Ballesteros–Weinstein residue location numbering.
Overlay of the average mouse (orange) and human (gray) GPR84 structures
from MD simulations shown from side and top (from the receptor extracellular
opening) views (b). Nonconserved residues and their counterparts in
interhelical hydrogen bonding are shown in stick-like representation.
Hydrogen bonds are shown as black dashed lines. Black arrows show
the difference in the position of helices 3, 5, and 7. The orthosteric
binding cavity of mouse (orange) and human (gray) GPR84 detected by
the MDpocket program[22] from MD simulation
trajectories shown in transparent surface representation (c). Human
GPR84 is shown bound to compound 837 (green). Ala102Thr-Gly363Ser human GPR84-Gαi2 and Thr102Ala-Ser363Gly mouse GPR84-Gi2α fusion
proteins were produced and expressed stably in Flp-In TREx 293 cells
(d, e). [35S]GTPγS binding assays performed on membranes
of these cells showed that, although compound 837 was unable to effectively
block activation of Ala102Thr-Gly363Ser human
GPR84 by 2-HTP (d), it did effectively and fully block activation
of Thr102Ala-Ser363Gly mouse GPR84 (e).
Dynamics of mouse and human GPR84 homology models helps
to predict
amino residues responsible for species selectivity of the 1,2,4-triazine
antagonists. Nonconserved residues between mouse and human orthologues
are shown on the human GPR84 homology model in space-filling representation
(a). The receptor model is shown in cartoon representation. Nonconserved
residues of the third intracellular loop are omitted. Amino acids
from human and mouse are shown in black and red and residue labels
respectively using Ballesteros–Weinstein residue location numbering.
Overlay of the average mouse (orange) and human (gray) GPR84 structures
from MD simulations shown from side and top (from the receptor extracellular
opening) views (b). Nonconserved residues and their counterparts in
interhelical hydrogen bonding are shown in stick-like representation.
Hydrogen bonds are shown as black dashed lines. Black arrows show
the difference in the position of helices 3, 5, and 7. The orthosteric
binding cavity of mouse (orange) and human (gray) GPR84 detected by
the MDpocket program[22] from MD simulation
trajectories shown in transparent surface representation (c). Human
GPR84 is shown bound to compound 837 (green). Ala102Thr-Gly363Ser human GPR84-Gαi2 and Thr102Ala-Ser363Gly mouse GPR84-Gi2α fusion
proteins were produced and expressed stably in Flp-In TREx 293 cells
(d, e). [35S]GTPγS binding assays performed on membranes
of these cells showed that, although compound 837 was unable to effectively
block activation of Ala102Thr-Gly363Ser human
GPR84 by 2-HTP (d), it did effectively and fully block activation
of Thr102Ala-Ser363Gly mouse GPR84 (e).
Production and Studies with a [3H]antagonist
To further explore the binding characteristics
of compounds from
this series to forms of GPR84 we took advantage of a di-iodinated
variant of the core structure. Although compound 441 (3-((5,6-bis(4-iodophenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole) displayed reduced potency compared to certain
other compounds (Table ), we rationalized that tritiation of this compound would generate
[3H]140, and compound 140 (3-((5,6-diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole) had already been characterized as a high affinity
(pA2 = 9.13 ± 0.07, mean ± SEM, n = 3) competitive antagonist of human GPR84 (Figure and Table ). Moreover, submission of compound 140 to a DiscoverX
panel of 167 GPCRs using the PathHunter β-arrestin enzyme fragment
complementation (EFC) technology resulted in no significant capacity
to either activate or antagonize any of these receptors (Supporting Information Table 1), indicating high
selectivity for GPR84.
Table 1
Affinity of Compounds 140 and 441
at Human GPR84a
compound
pA2
441
8.07 ± 0.02
140
9.13 ± 0.07
pA2 values
were calculated
by Gaddum/Schild analysis using shifts in the potency of 2-HTP induced
by varying concentrations of compound 140 or 441. Data are presented
as means ± SEM, n = 3.
Figure 7
Characterization of compounds 140 and 441. Ability of
varying concentrations
of compound 140 (a) and compound 441 (b) (structures shown as inserts)
to alter the concentration–response curve of 2-HTP in [35S]GTPγS binding assays performed using membranes of
Flp-In TREx 293 cells induced to stably express a human GPR84-Gαi2 fusion protein. See Table for details.
Characterization of compounds 140 and 441. Ability of
varying concentrations
of compound 140 (a) and compound 441 (b) (structures shown as inserts)
to alter the concentration–response curve of 2-HTP in [35S]GTPγS binding assays performed using membranes of
Flp-In TREx 293 cells induced to stably express a human GPR84-Gαi2 fusion protein. See Table for details.pA2 values
were calculated
by Gaddum/Schild analysis using shifts in the potency of 2-HTP induced
by varying concentrations of compound 140 or 441. Data are presented
as means ± SEM, n = 3.[3H]140 displayed rapid association (Figure a) and dissociation
(Figure b) kinetics
to membranes
of Flp-In TREx 293 cells expressing a human GPR84-Gαi2 fusion protein, allowing an estimate of Kd as 0.4 nM. Good specific to nonspecific binding ratios were observed,
and the specific binding component assessed using varying concentrations
of [3H]140 also was also consistent with sub-nM affinity
(Kd = 0.77 ± 0.10 nM, mean ±
SEM, n = 4) (Figure c). There was no evidence of high affinity off-target
binding sites in this cell line because no specific binding of [3H]140 was recorded in membranes from parental Flp-In TREx
293 cells. Unsurprisingly, in parallel studies we were unable to detect
specific binding of [3H]140 in membranes of Flp-In TREx
293 cells stably transfected to express a mouse GPR84-Gαi2 fusion protein (Figure d). The greatly reduced affinity of compound 837 at
Ala102Thr, Gly363Ser human GPR84 meant, however,
that as anticipated, it was also not possible to measure binding of
[3H]140 directly to this mutant (Figure e). By contrast, direct binding of [3H]140 to Thr102Ala, Ser363Gly mouse
GPR84 was both easily measured and of high affinity (Kd = 4.7 ± 0.8 nM, mean ± SEM, n = 3) (Figure f).
Figure 8
Characterization
of [3H]140 binding. Association (a)
and dissociation (b) kinetics of specific binding of 1.02 nM [3H]140 to membranes of Flp-In TREx 293 cells induced to express
a human GPR84-Gαi2 fusion protein are shown from
representative experiments. Dissociation was assessed in the presence
of 1 μM compound 020 to prevent reassociation of the radioligand.
Subsequently, the specific binding of a range of concentrations of
[3H]140 to membranes of Flp-In TREx 293 cells induced to
express the human GPR84-Gαi2 fusion protein was measured
(c). Similar studies were performed on membranes expressing Ala102Thr-Gly363Ser human GPR84-Gαi2 (d), mouse GPR84-Gαi2 (e), and Thr102Ala-Ser363Gly mouse GPR84-Gαi2 (f). Specific
binding with estimated Kd 4.7 ± 0.8
nM was observed to Thr102Ala-Ser363Gly mouse
GPR84-Gαi2.
Characterization
of [3H]140 binding. Association (a)
and dissociation (b) kinetics of specific binding of 1.02 nM [3H]140 to membranes of Flp-In TREx 293 cells induced to express
a human GPR84-Gαi2 fusion protein are shown from
representative experiments. Dissociation was assessed in the presence
of 1 μM compound 020 to prevent reassociation of the radioligand.
Subsequently, the specific binding of a range of concentrations of
[3H]140 to membranes of Flp-In TREx 293 cells induced to
express the human GPR84-Gαi2 fusion protein was measured
(c). Similar studies were performed on membranes expressing Ala102Thr-Gly363Ser human GPR84-Gαi2 (d), mouse GPR84-Gαi2 (e), and Thr102Ala-Ser363Gly mouse GPR84-Gαi2 (f). Specific
binding with estimated Kd 4.7 ± 0.8
nM was observed to Thr102Ala-Ser363Gly mouse
GPR84-Gαi2.
Further Predictions and Outcomes
Obvious sequalae of
the species selectivity of compound 837 and related molecules were
that while they should be effective blockers of function of GPR84
expressed endogenously in human-derived cell lines and tissue they
should not act this way in mouse-derived cells and tissues. Two cell
lines that have been well studied in relation to functions of GPR84
are the human monocytic/macrophage line THP-1[1,10,23] and the murine macrophage-like line RAW264.7.[1,10] Both show strong upregulation of GPR84 following exposure to lipopolysaccharide
(LPS). In membranes derived from LPS-treated THP-1 cells, binding
of [35S]GTPγS induced by 2-HTP was blocked in a concentration-dependent
and high potency manner by compound 837 (Figure a). By contrast 837 was unable to produce
such an effect in membranes of RAW264.7 stimulated with 2-HTP (Figure b). However, as anticipated
GLPG1205 ref (12) was
able to block response to 2-HTP in membranes of RAW264.7 cells (Figure b). Specific binding
of [3H]140 in membranes of LPS-treated THP-1 cells was
of high affinity (Kd = 1.3 ± 0.12
nM) with Bmax = 905 ± 93 fmol/mg
membrane protein (each mean ± SEM, n = 3) (Figure c).
Figure 9
Human-derived THP-1 cells
but not mouse-derived RAW-264.7 cells
display responses to 2-HTP that are blocked by compound 837. Membranes
were prepared from LPS-treated THP-1 cells and RAW-264.7 cells. In
both cases, 2-HTPstimulated binding of [35S]GTPγS
in a concentration-dependent manner (a, b). Only, however, in THP-1
cell membranes was this blocked by coaddition of compound 837. GLPG1205
was, however, able to block this effect of 2-HTPinRAW-264.7 cells
(b). In THP-1 membranes, specific binding of [3H]140 was
observed with Kd estimated as 1.3 ±
0.2 nM and Bmax = 866 fmol/mg membrane
protein (c).
Human-derived THP-1 cells
but not mouse-derived RAW-264.7 cells
display responses to 2-HTP that are blocked by compound 837. Membranes
were prepared from LPS-treated THP-1 cells and RAW-264.7 cells. In
both cases, 2-HTPstimulated binding of [35S]GTPγS
in a concentration-dependent manner (a, b). Only, however, in THP-1
cell membranes was this blocked by coaddition of compound 837. GLPG1205
was, however, able to block this effect of 2-HTPinRAW-264.7 cells
(b). In THP-1 membranes, specific binding of [3H]140 was
observed with Kd estimated as 1.3 ±
0.2 nM and Bmax = 866 fmol/mg membrane
protein (c).Alignment of sequences of GPR84
from human, macaque, pig, dog,
mouse, and rat indicated the amino acids at residue locations 3.34
and 7.46 were the same in macaque, pig, and dog as in human, and the
same in rat as in mouse (Figure ). A clear prediction was thus that compound 837 and
related molecules from this series would be effective antagonists
at each of macaque, pig, and dog GPR84, but not at the rat orthologue.
This prediction was upheld when tested directly and with the measured
affinity of such compounds being highly similar at the species orthologues
predicted to be effective targets (Table ).
Figure 10
Alignment of species orthologues of GPR84 predicts those able to
be blocked by the 1,2,4-triazines. GPR84 orthologues in human, mouse,
rat, pig, dog, and macaque are aligned with residues at position indicator
locations 3.34 and 7.46 highlighted. Based on the models of Figure , it was predicted
that dog, pig, and macaque GPR84 would be antagonized effectively
by the 1,2,4-trazine ligands, and direct assessment supported these
predictions (Table ).
Table 2
Potency of Compound
140 at Species
Orthologues of GPR84a
compound
140
human
mouse
rat
dog
pig
macaque
IC50 (M)
6.0 × 10–9
>1 × 10–5
8.7 × 10–6
8.1 × 10–9
5.6 × 10–9
6.4 × 10–9
IC50 versus EC80 of 6-OAU in cAMP regulation assays
performed in CHO cells expressing
the identified GPR84 species orthologue.
IC50 versus EC80 of 6-OAU in cAMP regulation assays
performed in CHO cells expressing
the identified GPR84 species orthologue.Alignment of species orthologues of GPR84 predicts those able to
be blocked by the 1,2,4-triazines. GPR84 orthologues in human, mouse,
rat, pig, dog, and macaque are aligned with residues at position indicator
locations 3.34 and 7.46 highlighted. Based on the models of Figure , it was predicted
that dog, pig, and macaque GPR84 would be antagonized effectively
by the 1,2,4-trazine ligands, and direct assessment supported these
predictions (Table ).
Discussion
Although
still classified as an orphan GPCR, GPR84 can be activated
by medium chain length fatty acids, with C9–C11 chain length
representing the peak of activity.[1,2,11] A significant range of synthetic agonists with relatedness
to fatty acids has been reported. These are hence considered as orthosteric
agonists. In addition, initially, the single molecule DIM,[18] and subsequently a substantial structure–activity
analysis based on DIM,[19] has defined a
group of allosteric agonists.[2,11] However, although there
is interest in the potential of agonists of GPR84 as therapeutic agents,[2,11,16] currently there is greater interest
in the potential of antagonists of this receptor.[2,11] Despite
this interest and potential opportunity, the only high affinity series
of GPR84 antagonists described previously is exemplified by GLPG1205.[12] This ligand has been assessed clinically in
both ulcerative colitis[12] and in early
studies in idiopathic pulmonary fibrosis.[13] Although clinical efficacy end-points in ulcerative colitis were
not achieved,[12] the reported outcomes from
the studies on idiopathic pulmonary fibrosis are encouraging (ClinicalTrials.gov
Identifier: NCT03725852). A second molecule that has antagonist activity
at GPR84 has also been studied in this condition,[24] but PBI-4050[25,26] and related molecules[27] have very modest affinity at GPR84 and also
have affinity at other GPCRs activated by fatty acids of varying chain
length.[25] It is thus clear that progress
in this area would be promoted by the availability of distinct and
selective high affinity antagonists of GPR84, and this was our rationale
in attempts to uncover new ligands.The current series was identified
in a high throughput screen conducted
in partnership with the European Lead Factory. Compound 837, with
approximately 1 nM affinity at human GPR84, was identified directly
from the more than 300 000 compounds assessed in the primary
screen, which measured regulation of cAMP levels in CHO cells transfected
to stably express the human receptor. Limited chemistry efforts identified
even more high affinity ligands in compounds 140, 020, and 021, and
a full description of the screen, medicinal chemistry and drug-like
characteristics of these ligands will be reported elsewhere. Interrogation
of the activity of these compounds in a broad panel screen, conducted
externally, showed no significant activity against any of 167 different
GPCRs, indicating the selectivity of this series for GPR84.Although compound 837 and others from this series were high affinity
antagonists of human GPR84, studies on the mouse orthologue indicated
a virtual complete lack of activity. Although we have previously noted
that available antagonists of receptors such as GPR35 are also highly
selective for the human over mouse orthologue,[28] orthologues of GPR35 are markedly different in primary
sequence.[28] By contrast, aside from the
long third intracellular loop, orthologues of GPR84 display high similarity.
Indeed, across the TMD domains and ECL regions, there is only modest
variation. Because all agonists we have tested have very similar potency
at the human and mouse orthologues we reasoned that it should be straightforward
to generate functionally active chimeras between the species orthologues
that would provide insight into both the location of binding of the
antagonist series and the basis of species selectively. This, however,
proved unsuccessful, although all the chimeras we did generate showed
similar agonist potency responses following expression. Importantly,
the basis for the selectivity clearly resided within the TMDs and/or
ECL regions because when we replaced every residue in these areas
of the mouse receptor with the equivalent amino acid from the human
orthologue this modified form displayed fully “human orthologue-like”
pharmacology.To understand this species selectivity, we employed
homology modeling
and MD simulations. In previous work GPR84 homology models were generated
based on each of the β2-adrenoceptor, dopamine D3 and orexin 2 receptors, that have average sequence similarities
of 44, 45, and 47%, respectively, to GPR84.[20,29,30] Here, we took advantage of recently published
GPCR crystal structures and built novel homology models of GPR84 based
on a hybrid template that gave overall sequence identity of 52% in
the transmembrane regions. These models and their subsequent refinement
with MD simulations helped us to predict two residues out of 12 nonconserved
residues within the GPR84 TMDs and extracellular loops as providing
the potential basis for species selectivity. Interactions involving
the residues at amino acid locator positions 3.34 and 7.46 in mouse
that did not exist in the human receptor were prioritized. MD simulations
suggested these could restrict a cavity into which the antagonist
might bind in the human orthologue. Generation of mutants in which
we swapped these two amino acids between species provided strong support
for this model. Introduction of the two residues from mouse into the
human receptor resulted in reduction of more than 1000-fold in the
affinity of exemplar ligands. Even more convincingly, introduction
of these residues from the human receptor into the mouse orthologue
resulted in a gain of affinity of some 5000-fold. An important consequence
of these outcomes was that simple alignment of the sequences of orthologues
of GPR84 from other species that are often important in pharmacological
studies and drug-development programmes, including macaque, dog and
rat, provided obvious predictions of the potential of high affinity
binding or otherwise of the chemical series on these species. This
reflected that rat was equivalent to mouse at residues 3.34 and 7.46,
while macaque, dog and pig orthologues conserved these amino acids
with human. Importantly, we then tested this prediction directly in
cells transfected to express each of these species orthologues and
the outcomes fully supported the model. Interestingly, although GLPG1205
and related molecules from that series do have substantial affinity
at mouse GPR84, they display somewhere between 30- and 60-fold. lower
affinity than at the human orthologue.[12,17] As such, it
appears that although the mode of binding of the GLPG1205 series compounds
must differ from those reported herein, there may well be similarities.
Direct structural insights into these probable differences would be
welcome and helpful.Although it is well established that mRNA
encoding GPR84 is upregulated
substantially and rapidly in cells and tissues in proinflammatory
settings and in cells exposed to specific proinflammatory stimuli,
including LPS,[1,9,10] whether
this results in a substantial and sustained increase in GPR84 protein
expression has been less well assessed. This reflects the relative
ease of PCR-based methods to detect and amplify mRNA and the relative
paucity of antisera or other protein-targeted probes for the receptor.
However, the availability of a [3H]radiolabeled ligand
related closely to GLPG1205[12] allowed Mancini
et al.,[10] to examine levels of expression
of GPR84 protein in cells including THP-1 monocytes with and without
pre-exposure to LPS.[10] We hence generated
[3H]140 in these studies, both to provide a chemically
distinct radiolabeled probe for the type of studies outlined above
and to allow more detailed pharmacological analysis of the binding
site for these ligands in GPR84. This is currently being investigated
directly.In conclusion, from an initial high throughput screen
we have identified,
developed and characterized a completely novel series of high affinity
GPR84 antagonists. Although these compounds display virtually complete
selectivity between human and each of mouse and rat forms of GPR84,
our analysis of sequence relatedness provides confidence over which
species orthologues these compounds will interact with in a high affinity
manner. They also highlight the minimal alterations that might be
introduced, via genome-editing for example,[31] to produce rodent models with nanomolar and subnanomolar affinity
for these compounds. These ligands are also likely to offer suitable
means to further assess the potential therapeutic targeting of GPR84
in a range of disease indications.
Methods
Materials
2,5-Dihydroxy-3-undecyl-1,4-benzoquinone
(embelin), 3,3′-diindolylmethane (DIM), 6-n-octylaminouracil (6-OAU) and 2-(hexylthio)-6-hydroxy-4(3H)-pyrimidinone
(2-HTP) were from Sigma-Aldrich (Dorset, UK). 9-cyclopropylethynyl-2-((S)-1-[1,4]dioxan-2-ylmethoxy)-6,7-dihydropyrimido[6,1-a]isoquinolin-4-one (GLPG1205)[12,17] were kindly provided by Galapagos NV. [35S]GTPγS
was from PerkinElmer Life Sciences (Beaconsfield, UK). Tissue culture
reagents were from Thermo Fisher Scientific (Loughborough, UK) and
molecular biology enzymes and reagents from Promega (Southampton,
UK). Polyethylenimine (PEI) [linear poly(vinyl alcohol) (MW-25000)]
was from Polysciences (Warrington, PA).
Chemistry
Preparation
of Compound 837, 3-((5,6-Bis(4-methoxyphenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole
2-(1H-Indol-3-yl)acetohydrazide
(100 mg, 0.58
mmol), 1,2-bis(4-methoxyphenyl)ethane-1,2-dione (156 mg, 0.58 mmol),
and ammonium acetate (445 mg, 5.77 mmol) were transferred to a 5 mL
microwave vial. Acetic acid (2.5 mL) was added and the resultant suspension
subjected to microwave radiation at 180 °C for 5 min. The reaction
mixture was concentrated to dryness under reduced pressure. Residue
partitioned between water (20 mL) and DCM (2 × 10 mL). Combined
extracts washed with brine, dried over Na2SO4, filtered, and concentrated to dryness under reduced pressure. The
residue was purified by flash chromatography eluting with 0–2.5%
methanol in DCM and then repurified by flash chromatography using
0–100% ethyl acetate in heptane to give a pale orange solid.
The solid was sonicated with ether (10 mL) and solid filtered off,
washed with ether and dried under suction to give the title compound,
47 mg.1H NMR (400 MHz, CHLOROFORM-d) δ 3.85
(d, J = 1.25 Hz, 6Η), 4.70 (σ, 2Η),
6.79–6.95 (μ, 4Η), 7.12–7.26 (μ, 2Η),
7.33–7.42 (μ, 2Η), 7.47–7.54 (μ, 2Η),
7.55–7.63 (μ, 2Η), 7.90–8.01 (μ, 1Η),
8.07–8.21 (μ, 1Η).
Compound 140: Preparation
of 3-((5,6-Diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole
2-(1H-Indol-3-yl)acetohydrazide
(100 mg, 0.58
mmol), 1,2-diphenylethane-1,2-dione (121. mg, 0.58 mmol) and ammonium
acetate (445 mg, 5.77 mmol) transferred to a 5 mL microwave vial.
Acetic acid (2.5 mL) was added and the resulting suspension subjected
to microwave radiation at 180 °C for 5 min. The reaction mixture
was concentrated to dryness under reduced pressure. Residue partitioned
between water (20 mL) and DCM (2 × 10 mL) and combined extracts
washed with brine, dried over Na2SO4, filtered,
and concentrated to dryness under reduced pressure. The residue was
purified by flash chromatography eluting with 0–30% ethyl acetate
in heptane to give a pale orange solid. The solid was sonicated with
ether (2 mL) and solid filtered off, washed with ether and dried under
suction to give the title compound, 79.7 mg.1H NMR
(400 MHz, CHLOROFORM-d) δ 4.73 (d, J = 0.9
Hz, 2H), 7.20 (dddd, J = 20.4, 8.1, 7.1, 1.2 Hz,
2H), 7.30–7.47 (m, 8H), 7.54 (ddd, J = 8.3,
7.5, 1.5 Hz, 4H), 7.96 (dd, J = 7.5, 1.4 Hz, 1H),
8.16 (s, 1H).
Preparation of 2-Hydroxy-1,2-bis(4-iodophenyl)ethan-1-one
To a stirred suspension of 4-iodobenzaldehyde (1000 mg, 4.31 mmol)
in 1 mL of water/methanol (2:3) in a 5 mL microwave vial was added
NaCN (42 mg, 0.862 mmol). The vial was capped and the mixture stirred
at 85 °C for 30 min and cooled to room temperature. The reaction
was worked up by partitioning mixture between water (20 mL) and ethyl
acetate (3 × 10 mL). Combined extracts washed with brine (20
mL), dried over Na2SO4, filtered, and concentrated
to dryness under reduced pressure. The resulting residue was purified
by flash chromatography eluting with 0–20% ethyl acetate in
heptane to give 2-hydroxy-1,2-bis(4-iodophenyl)ethan-1-one, 710 mg.1Η ΝΜR (400 MHz, CHLOROFORM-d) δ
4.42–4.52 (m, 1Η), 5.81–5.90 (m, 1Η), 7.03–7.10
(m, 2Η), 7.56–7.63 (m, 2Η), 7.66–7.72 (m,
2Η), 7.78–7.84 (m, 2Η).
Preparation of 1,2-Bis(4-iodophenyl)ethane-1,2-dione
A well stirred suspension of 2-hydroxy-1,2-bis(4-iodophenyl)ethanone
(710 mg, 1.53 mmol), ammonium nitrate (153 mg, 1.91 mmol) and copper(II)
acetate monohydrate (3.05 mg, 0.0153 mmol) in AcOH (4.00 mL)/water
(1.00 mL) was heated at reflux for 90 min resulting in a yellow suspension.
The mixture cooled to room temperature and the resultant pale-yellow
solid filtered off, washed with water (3 × 20 mL) and dried to
give 1,2-bis(4-iodophenyl)ethane-1,2-dione, 563 mg.1Η ΝΜR (400 MHz, CHLOROFORM-d) δ 7.67 (d, J = 8.53 Ηz, 4Η), 7.86–7.95 (m, 4Η).
H
2-(1-Indol-3-yl)acetohydrazide (231 mg, 1.22
mmol), 1,2-bis(4-iodophenyl)ethane-1,2-dione (563 mg, 1.22 mmol) and
ammonium acetate (939 mg, 12.2 mmol) were transferred to a 5 mL microwave
vial. Acetic acid (5 mL) was added and the resultant suspension subjected
to microwave radiation at 180 °C for 5 min. The reaction mixture
was concentrated to dryness under reduced pressure. The residue partitioned
between water (30 mL) and DCM (3 × 20 mL) and combined extracts
washed with brine, dried over Na2SO4, filtered,
and concentrated to dryness under reduced pressure to afford a gum.
The residue was purified by flash chromatography with 0–30%
ethyl acetate in heptane to afford the title compound; 394 mg.1Η ΝΜR (400 ΜΗz, DMSO-δ6)
δ 4.51–4.59 (m, 2Η), 6.95–7.03 (m, 1Η),
7.03–7.10 (m, 1Η), 7.27 (s, 6Η), 7.65–7.73
(m, 1Η), 7.75–7.84 (m, 4Η), 10.89–11.03
(m, 1Η).
Preparation of [4-(2-Phenylethynyl)phenyl]methyl
Acetate
(4-Bromophenyl)methyl acetate (960 mg, 4.19 mmol)
and ethynylbenzene
(460 μL, 4.19 mmol) were placed in a microwave vial and N,N-diisopropylethylamine (9 mL) added
and the solution degassed by bubbling argon for 5 min. The cap was
removed and copper(I) iodide (43 mg, 0.226 mmol) followed by bis(triphenylphosphine)palladium(II)
dichloride (150 mg, 0.214 mmol) added and the vessel purged with argon
before heating at 100 °C in the microwave for 1 h. The vial contents
were diluted with ethyl acetate and passed through a Celite plug which
was then washed with ethyl acetate. The organics were partitioned
with water (2×) and sat. NaCl solution (1×), dried over
Na2SO4, filtered, and concentrated. The resulting
residue was purified by flash chromatography using 0–15% ethyl
acetate in heptane to give [4-(2-phenylethynyl)phenyl]methyl acetate,
1.31 g contaminated with approximately 25% starting material. The
material was used without further purification.1H NMR (400 MHz, CHLOROFORM-d) δ 7.61–7.51 (m, 4H), 7.39–7.34
(m, 5H), 5.14 (s, 2H), 2.15 (s, 3H).
Preparation of [4-(2-Oxo-2-phenyl-acetyl)phenyl]methyl
Acetate
[4-(2-phenylethynyl)phenyl]methyl acetate (75.0%,
1310 mg, 3.93
mmol) was dissolved in acetone (50 mL) and water (25 mL) added. Potassium
permanganate (3102 mg, 19.6 mmol) was added, and the mixture stirred
at room temperature for 1.5 h. The reaction mixture poured through
a Celite pad which was washed with ethyl acetate and water. The filtrate
was diluted with water (200 mL) and ethyl acetate (200 mL) and the
phases mixed and separated. The organic layer separated and the aqueous
back extracted with ethyl acetate (2 × 100 mL). The combined
organics were washed with sat. NaCl solution, dried over Na2SO4, filtered, and concentrated to dryness. The residue
was purified by flash chromatography eluting with 0–25% ethyl
acetate in heptane to give [4-(2-oxo-2-phenyl-acetyl)phenyl]methyl
acetate, 475 mg.1H NMR (400 MHz, CHLOROFORM-d) δ
8.08–7.89 (m, 4H), 7.78–7.63 (m, 1H), 7.61–7.42
(m, 4H), 5.20 (s, 2H), 2.16 (s, 3H).[4-(2-Oxo-2-phenyl-acetyl)phenyl]methyl
acetate (475 mg, 1.68 mmol),
2-(1-indol-3-yl)acetohydrazide (0.353 mL, 1.68 mmol)
and ammonium acetate (1.30 g, 16.8 mmol) were dissolved in 10 mL acetic
acid and heated to 180 °C in the microwave for 10 min. The solution
was concentrated to dryness and partitioned between ethyl acetate
and sat. NaHCO3 and the phases mixed and separated. The
aq. phase was back extracted with ethyl acetate and organics combined,
dried over Na2SO4, filtered, and concentrated.
The resulting residue was purified by flash chromatography using 0–50%
ethyl acetate in heptane to give the regioisomeric mix. The regioisomers
were separated by SFC using a Daicel AD-H (10 × 250 mm, 40% methanol,
15 mL/min) to give:Compound 020, Daicel AD-H column 10 ×
250 mm, 40% methanol, 15 mL/min, retention time 4.55 min, 102 mg.1H NMP (400 ΜΗz, CHLOROFORM-d) δ 8.14–8.09
(m, 1Η), 7.97–7.94 (m, 1Η), 7.56–7.51 (m,
4Η), 7.45–7.29 (m, 7Η), 7.25–7.15 (m, 2Η),
5.13 (s, 2Η), 4.72–4.71 (m, 2Η), 2.14–2.14
(m, 3Η).Compound 021, Daicel AD-H column 10 × 250
mm, 40% methanol,
15 mL/min, retention time 6.57 min, 99 mg.1H NMR
(400 ΜΗz, CHLOROFORM-d) δ 8.13–8.10
(m, 1Η), 7.97–7.94 (m, 1Η), 7.56–7.52 (m,
4Η), 7.47–7.32 (m, 7Η), 7.25–7.15 (m, 2Η),
5.15–5.14 (m, 2Η), 4.72 (s, 2Η), 2.14 (s, 3Η).
Synthesis of [3H]140
[3H]140
(3-((5,6-diphenyl-1,2,4-triazin-3-yl)methyl)-1H-indole)
(40 Ci/mmol) was produced by Pharmaron (Cardiff, UK). It was synthesized
by reaction of a solution of compound 441 (3-((5,6-bis(4-iodophenyl)-1,2,4-triazin-3-yl)methyl)-1H-indole) (5 mg) in N,N-dimethylformamide (1 mL) and diisopropylethylamine (0.02 mL) with
tritium gas (5 Ci, 57.8 Ci/mmol) at 290 mbar pressure over 10% Pd/C
(10 mg) for 2 h at room temperature. The labile activity was removed
by rotary evaporation from ethanol three times before filtering through
a 0.45 um GMF filter. The filtrate was purified by C18 RP HPLC eluting
in a mixture of 0.1% TFA(aq) and MeCN. Concentration by rotary evaporation
and then solvation in ethanol afforded the desired product as a solution
(81 mCi) with 94.3% radiochemical purity by HPLC and an average molecular
mass of 365.83 (MH+) by EI.
Generation of Constructs
FLAG-human GPR84-eYFP, FLAG-human
GPR84-Gαi2, and FLAG-mouse GPR84-Gαi2 fusion proteins were constructed as described previously.[10,17] An HA epitope (amino acid sequence YPYDVPDYA) was introduced at
the C-terminal end of each of human and mouse GPR84 cDNA by PCR using
the following primers: sense, 5′ GATCGATCGGATCCGCCACCATGTGGAACAGCTCAGATGCCAACTTCTCCTGCTACCATGAG
3′, and antisense: 5′ GATCGATCCTCGAGTTAATGGGTATGCTACAAGGTCTAATGCGAATGGAACCGGCGGAAACTCTGTGGCCCGCG
3′. The resulting cDNA was subsequently cloned in-frame into
the BamHI and XhoI sites of an pcDNA5/FRT/TO plasmid.Chimeric human-mouse GPR84-HA constructs were generated using synthetic
DNA sequences purchased from Eurofins Genomics (Luxembourg), that
were then subcloned in-frame into the BamH1 and Xho1 sites of pcDNA5/FRT/TO.
Mutagenesis of FLAG-Human GPR84-Gαi2 and FLAG-Mouse
GPR84-Gαi2
The Stratagene QuikChange method
(Stratagene, Agilent Technologies, Santa Clara, CA) was used to introduce
alterations into FLAG-human GPR84-Gαi2 or FLAG-mouse
GPR84-Gαi2. Primers utilized for mutagenesis were
provided by MWG Operon (Acton, UK). Template DNA was digested with
DpnI to leave only the newly synthesized mutated plasmid, and sequencing
was carried out to confirm the introduction of the alterations.
Cell Culture, Transfection, and Generation of Cell Lines
THP-1 monocytes were maintained at a density of between 1 ×
105– 8 × 105 cells/mL in RPMI-1640
supplemented with 10% (v/v) heat inactivated FBS, 1% penicillin/streptomycin
mixture and 2 mM l-glutamine at 37 °C in a 5% CO2 humidified atmosphere. Cells seeded at a density of 4 ×
105 cells/mL were exposed to 100 ng/mL lipopolysaccharide
(LPS) (Sigma, Dorset, UK) for 24 h prior to membrane preparation.
RAW 264.7 mouse macrophages were maintained in DMEM (with 4.5 g/L d-glucose, 0.11 g/L sodium pyruvate) supplemented with 10% heat
inactivated FBS, 1% penicillin/streptomycin and 2 mM l-glutamine
at 37 °C and 5% CO2 humidified atmosphere. Cells were
treated with 100 ng/mL of LPS for 5 h prior to membrane preparation.
Flp-In TREx 293 cells (Invitrogen) were maintained in Dulbecco’s
modified Eagle’s medium without sodium pyruvate, supplemented
with 10% (v/v) FBS, 1% penicillin/streptomycin mixture, and 10 μg/mL
blasticidin at 37 °C in a 5% CO2 humidified atmosphere.To generate Flp-In TREx 293 cells able to express in an inducible
manner the various GPR84 receptor constructs, cells were transfected
with a mixture containing the desired cDNA in pcDNA5/FRT/TO vector
and pOG44 vector (1:9) by using 1 mg/mL PEI (MW-25000). Cells were
plated until 60 to 80% confluent then transfected with 8 μg
of required plasmid DNA and PEI (ratio 1:6 DNA/PEI), diluted in 150
mM NaCl, pH 7.4. After incubation at room temperature for 10 min,
the mixture was added to cells. After 48 h, the medium was changed
to medium supplemented with 200 μg/mL hygromycin B to initiate
the selection of stably transfected cells. After isolation of resistant
cells, expression of the appropriate construct from the Flp-In TREx
locus was induced by treatment with up to 100 ng/mL doxycycline for
24 h.
HTRF-Based cAMP Inhibition Assays
cAMP experiments
were performed using Flp-In T-REx293 cells induced to express the
receptor of interest or CHO-K1 cells stably expressing the orthologue
of interest. Experiments were carried out using a homogeneous time-resolved
FRET-based detection kit (CisBio, Codolet, France) according to the
manufacturer’s protocol. For the assay cells were plated at
5000 cells/well in low-volume 384-well plates. The ability of agonists
to inhibit 1 μM forskolin-induced cAMP production was assessed
following a preincubation for 15 min with antagonist compounds, then
a further 30 min incubation with agonist compounds. Reactions were
stopped according to the manufacturer’s instructions and the
output was measured with a PHERAstar FS plate reader (BMG Labtech,
Aylesbury, UK).
Membrane Preparation
Membranes were
generated from
LPS-treated THP-1 and RAW 264.7 cells or Flp-In T-Rex 293 cells following
100 ng/mL doxycycline treatment to induce receptor expression. Cells
were washed with ice-cold phosphate-buffered saline (PBS), removed
from dishes by scraping and centrifuged at 3000 rpm for 5 min at 4
°C. Pellets were resuspended in TE buffer (10 mM Tris-HCl, 0.1
mM EDTA; pH 7.5) containing a protease inhibitor mixture (Roche, West
Sussex, UK) and homogenized with a 5 mL hand-held homogenizer. This
material was centrifuged at 1500 rpm for 5 min at 4 °C and the
supernatant was further centrifuged at 50 000 rpm for 45 min
at 4 °C. The resulting pellet was resuspended in TE buffer and
protein content was assessed using a BCA protein assay kit (Thermo
Fisher Scientific, Loughborough, UK).
[35S]GTPγS
Incorporation Assay
Prepared
membrane protein (5 μg THP-1, 5 μg RAW-264.7, 3 μg
Flp-In T-REx 293 cells) was incubated in assay buffer (20 mM HEPES,
5 mM MgCl2, 160 mM NaCl, 0.05% fatty-acid-free bovine serum
albumin; pH 7.5) containing the indicated ligand concentrations. In
experiments designed to assess inhibition of agonist stimulation,
membrane preparations were preincubated with antagonist compound for
15 min at room temperature prior to addition of agonist. The reaction
was initiated by addition of [35S]GTPγS (50 nCi per
reaction) with 1 μM GDP, and incubated at 30 °C for 60
min. The reaction was terminated by rapid vacuum filtration through
GF/C glass fiber filter-bottom 96-well microplates (PerkinElmer Life
Sciences, Beaconsfield, UK) using a UniFilter FilterMate Harvester
(PerkinElmer). Unbound radioligand was removed from filters by three
washes with ice-cold PBS. MicroScint-20 (PerkinElmer) was added to
dried filters, and [35S]GTPγS binding was quantified
by liquid scintillation spectroscopy.
[3H]140 Binding
Assay
Assays were carried
out with increasing concentrations of [3H]140, binding
buffer (PBS with 0.5% fatty acid free bovine serum albumin; pH 7.4),
in a total assay volume of 500 μL in 96 deep-well blocks. Binding
was initiated by the addition of membranes (5 μg of protein
per tube). All assays were performed at 25 °C for 1 h before
termination by the addition of ice-cold PBS and vacuum filtration
through GF/C glassfibre filter-bottom 96-well microplates. Plates
were washed three times with ice-cold PBS then allowed to dry for
2–3 h at room temperature. MicroScint-20 was added to dried
filter plates, and radioactivity was quantified by liquid scintillation
spectrometry. Specific binding was defined as the difference between
binding detected in the presence and absence of 10 μM compound
020.
Studies on Species Orthologues of GPR84
Were performed
on CHO-K1 cells stably expressing the GPR84 species orthologues described
in the text.
Molecular Modeling
Homology models
of human and mouse
GPR84 were constructed using a multitemplate hybridization approach.
The 3D model of GPR84 transmembrane helices was generated using the
GPCR-SSFE 2.0 server.[32] This server identifies
templates for homology modeling based on key sequence and structural
motifs of Class A GPCRs. The server suggested to use mOPRD1 (4EJ4),
hDRD3 (3PBL), hFFAR1 (4PHU), hF2RL1 (5NDD), hS1PR1 (3 V2Y), hP2RY1
(4XNV), hF2RL1 (5NDD), hF2RL1 (5NDD) structures as templates for helices
1, 2, 3, 4, 5, 6, 7, and 8, respectively. The sequence similarity
between the corresponding helices of GPR84 and the selected templates
is 30, 57, 44, 46, 40, 53, 65, and 36%. Overall, the sequence similarity
is higher for the hybrid template than for any GPCR with available
experimental structures, suggesting that the hybrid template could
be the best option for modeling GPR84 at this stage. Next, the homology
model of the transmembrane helices was used to create the GPR84 models
containing loop regions using the Prime module of Schrodinger software
(2020–2021)[33] with the default energy-based
protocol. The second extracellular loop of GPR84 was modeled based
on the rhodopsin template as it has high sequence similarity and similar
sequence length.[20] The third intracellular
loop was partially reconstructed, where only ten residues from each
connecting helix end were maintained. The obtained homology models
of human and mouse GPR84 were subjected to MD simulations in a water–lipid
bilayer for refinement and stability analysis.The membrane-receptor
systems were built using the “Membrane Builder” module
of the CHARMM-GUI server.[34] The position
of the receptor molecule across the lipid bilayer was established
using the Orientation of Protein in Membranes (OPM) server.[35] Mouse or human GPR84 in the empty form was embedded
into a 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine
(POPC) lipid bilayer consisting of 103 and 100 lipid molecules in
the upper-leaflet and lower-leaflet of the membrane. TIP3P water molecules[36] were used to solvate the bilayer and counterions
were added at a concentration of 0.15 M NaCl. The final systems comprised
of ∼86 000 atoms with a box dimension of 90 × 90
× 114 Å3.All MD simulations were performed
using the Compute Unified Device
Architecture (CUDA) version of particle-mesh Ewald molecular dynamics
in Amber 18[37−39] on graphics processing units (GPUs). The FF14SB[40] and Lipid14[41] force fields were used in all the simulations.
The initial energy minimization of the entire systems used the steepest
descent (5000 steps) and conjugate gradient (5000 steps) methods.
The protein and bilayer were restrained using a potential of 10 and
2.5 kcal mol–1 Å2, respectively,
and only solvent and ions were relaxed. Initial velocities were sampled
from a Boltzmann distribution. Heating to 310 K was carried out in
the NVT ensemble for a total of 125 ps. Equilibration was performed
at 310 K and 1 bar in an NPT ensemble. During the equilibration, the
restraints for the protein and lipid head groups were gradually reduced
from 10 and 5 kcal mol–1 Å–2 for 125 ps; 5 and 2.5 kcal mol–1 Å–2 for 125 ps; 2.5 and 1.0 kcal mol–1 Å–2 for 125 ps; 1 and 0.5 kcal mol–1 Å–2 for 500 ps; 0.5 and 0.1 kcal mol–1 Å–2 for 500 ps; to 0.1 kcal
mol–1 Å–2 (just for the protein)
for 500 ps. The whole system was equilibrated without any restrains
for 10 ns. The final production step of 300 ns was run at 310 K and
1 bar in the NPT ensemble using the Langevin thermostat and Monte
Carlo barostat. The simulations were performed using a time step of
2 fs. Nonbonded interactions were cut off at 10.0 Å and long-range
electrostatic interactions were calculated using PMEMD.[39,42] The SHAKE algorithm was used to constrain bond lengths.[43] Three replica runs of 300 ns MD simulation each
were performed for all systems. The simulations were performed on
the Kelvin2 cluster of Queen’s University Belfast. The MD trajectories
were analyzed using the VMD 1.9.3[44] and MDpocket programs.[22] Compound 837 was docked to the human GPR84 model using a standard
precision docking protocol available in the Glide module of Schrodinger
software (2020–2021).[45] The docking
box was centered based on Asn104, Arg172 and Asn357 residues, which
are known to be important in the binding of orthosteric ligands.[17,29] The images for Figure were created in Maestro 2020-1.
Primary Compound Screening
For primary screening a
library of 301 665 compounds were tested in in a single-point
HitHunter cAMP assay (DiscovereX, Fremont, CA), at 3 μM against
3 μM embelin in CHO-K1 cells expressing human GPR84. A primary
hit list (PHL) of 260 compounds were selected and tested in a single-point
[35S]GTPγS assay at 10 μM against 3 μM
embelin. Basal wells containing assay buffer with 2.5% DMSO, and stimulation
wells containing only 3 μM embelin were included in all plates.
Data were analyzed using Microsoft Excel software, and the activity
of the compounds was calculated using the following formula: % inhibition
= (dpmstim – dpmcompound)/(dpmstim – dpmbasal) × 100, where dpmcompound is the dpm value obtained from wells treated with the test compound
and embelin, dpmbasal is the average of the dpm values
obtained from wells treated with assay buffer with 2.5% DMSO, and
dpmstim is the average of the dpm values obtained from
cells treated with only 3 μM embelin. Reliability of the assay
was estimated by calculating Z′ values for
each plate, using the formula: Z′ = 1 –
{[3 × σstim) + (3 × σbasal)]/(μstim – μbasal)}, where
σstim and σbasal are the SD values
of wells containing 3 μM embelin and assay buffer, respectively,
and μstim and μbasal are the means
for wells containing 3 μM embelin and assay buffer, respectively.
Data Analysis
All data are presented as means ±
SEM of at least three independent experiments. Data analysis and curve
fitting was carried out using the GraphPad Prism software package
version 8 (GraphPad, San Diego). For functional assays the concentration–response
data were plotted on a log axis, with the untreated vehicle control
plotted at 1 log unit lower than the lowest ligand concentration and
fitted to a three parameter sigmoidal curve with the Hill slope constrained
to equal 1. In case of inhibition experiments with antagonists, an
equivalent analysis was followed to fit an inverse sigmoidal curve.
To perform the statistical analysis of curve parameters, data from
multiple experiments were fitted independently and resulting curve
fit values were analyzed with indicated tests. Antagonism experiments
carried out with multiple defined concentrations of antagonist were
fit to a global Gaddum/Schild EC50 shift equation to estimate
pA2 values for the antagonist. For radioligand binding data, saturation
binding curves were generated by fitting the specific binding, which
was obtained by subtracting nonspecific from total binding, to a one
site specific binding model that allows calculation of Kd values for the radioligand at wild-type and mutant receptors.
Authors: Frédéric Labéguère; Sonia Dupont; Luke Alvey; Florilène Soulas; Gregory Newsome; Amynata Tirera; Vanessa Quenehen; Thi Thu Trang Mai; Pierre Deprez; Roland Blanqué; Line Oste; Sandrine Le Tallec; Steve De Vos; Annick Hagers; Ann Vandevelde; Luc Nelles; Nele Vandervoort; Katja Conrath; Thierry Christophe; Ellen van der Aar; Emanuelle Wakselman; Didier Merciris; Céline Cottereaux; Cécile da Costa; Laurent Saniere; Philippe Clement-Lacroix; Laura Jenkins; Graeme Milligan; Stephen Fletcher; Reginald Brys; Romain Gosmini Journal: J Med Chem Date: 2020-09-23 Impact factor: 7.446
Authors: Zobaer Al Mahmud; Laura Jenkins; Trond Ulven; Frédéric Labéguère; Romain Gosmini; Steve De Vos; Brian D Hudson; Irina G Tikhonova; Graeme Milligan Journal: Sci Rep Date: 2017-12-20 Impact factor: 4.379
Authors: Catherine L Worth; Franziska Kreuchwig; Johanna K S Tiemann; Annika Kreuchwig; Michele Ritschel; Gunnar Kleinau; Peter W Hildebrand; Gerd Krause Journal: Nucleic Acids Res Date: 2017-07-03 Impact factor: 16.971
Authors: Mario M Müller; Roland Lehmann; Tilman E Klassert; Stella Reifenstein; Theresia Conrad; Christoph Moore; Anna Kuhn; Andrea Behnert; Reinhard Guthke; Dominik Driesch; Hortense Slevogt Journal: Sci Rep Date: 2017-04-12 Impact factor: 4.379
Authors: Sara Marsango; Richard J Ward; Laura Jenkins; Adrian J Butcher; Zobaer Al Mahmud; Louis Dwomoh; Falko Nagel; Stefan Schulz; Irina G Tikhonova; Andrew B Tobin; Graeme Milligan Journal: J Biol Chem Date: 2022-04-12 Impact factor: 5.486
Authors: Amit Mahindra; Laura Jenkins; Sara Marsango; Mark Huggett; Margaret Huggett; Lindsay Robinson; Jonathan Gillespie; Muralikrishnan Rajamanickam; Angus Morrison; Stuart McElroy; Irina G Tikhonova; Graeme Milligan; Andrew G Jamieson Journal: J Med Chem Date: 2022-08-10 Impact factor: 8.039
Authors: Ni Ye; Jie Cai; Yulong Dong; Huiyao Chen; Zhiyuan Bo; Xiaogang Zhao; Mingyang Xia; Mei Han Journal: Front Genet Date: 2022-08-17 Impact factor: 4.772
Authors: Amadeus Samuel Schulze; Gunnar Kleinau; Rosanna Krakowsky; David Rochmann; Ranajit Das; Catherine L Worth; Petra Krumbholz; Patrick Scheerer; Claudia Stäubert Journal: iScience Date: 2022-09-06