Literature DB >> 34645736

Steroidal but not embryonic regulation of mucin 1 expression in bovine endometrium.

Kaiyu Kubota1, Masafumi Miwa1, Ken-Go Hayashi2, Misa Hosoe2, Miki Sakatani1.   

Abstract

In cow herd management, inadequate embryo implantation leads to pregnancy loss and causes severe economic losses. Thus, it is crucial to understand the molecular mechanisms underlying endometrial receptivity and subsequent embryo implantation. Transmembrane glycocalyx mucin 1 (MUC1) has a large and highly glycosylated extracellular domain known to inhibit embryo implantation via steric hindrance. The role of MUC1 in the bovine endometrium remains to be explored. Herein, we used simple but reliable in vivo and in vitro experiments to investigate the expression and regulation of MUC1 in the bovine endometrium. MUC1 gene expression was analyzed in endometrial epithelial cells collected by the cytobrush technique using reverse transcription-quantitative polymerase chain reaction. MUC1 protein expression was evaluated by immunohistochemical analysis of endometrial samples collected from slaughtered cows. We used an in vitro cell culture model to study the regulation of MUC1 expression by treating cells with sex steroidal hormones or co-culturing cells with a blastocyst. The results revealed that MUC1 was expressed and localized to the apical surface of luminal epithelial cells in the bovine endometrium. MUC1 expression disappeared during the luteal phase of the estrous cycle and during pregnancy. 17β-estradiol induced MUC1 expression, whereas progesterone inhibited its increase and co-culturing with blastocysts did not affect the expression. A long postpartum interval is a known risk factor for reduced fertility, and MUC1 expression was higher in this compromised condition. Our results demonstrated the MUC1 regulation by steroid hormones in bovine endometrium for embryo implantation, and we observed a negative correlation between MUC1 expression and fertility.

Entities:  

Keywords:  Bovine endometrium; Embryonic implantation; MUC1; Mucin; Steroid hormone

Mesh:

Substances:

Year:  2021        PMID: 34645736      PMCID: PMC8668378          DOI: 10.1262/jrd.2021-087

Source DB:  PubMed          Journal:  J Reprod Dev        ISSN: 0916-8818            Impact factor:   2.214


The profitability of cow herd management depends greatly on the reproductive efficiency of cows [1]. Reproductive parameters such as the calving interval and percentage are often below the expected levels due to pregnancy loss, which occurs at various stages of pregnancy owing to a variety of causes [2,3,4,5]. Approximately half of the pregnancies are lost within the first month of gestation, and relatively fewer losses occur later than that [6, 7]. The key physiological events in the first month of gestation include ovulation, fertilization, embryonic development to blastocyst, elongation, and implantation in the maternal endometrium [8]. In the optimal scenario, fertilization rates are high, and may be as high as 95% [6, 7]. Embryo transfer bypasses the loss during early embryonic development, but the associated pregnancy rate remains similar to that achieved with artificial insemination [6, 7]. Thus, embryo implantation appears to be one of the potential pitfalls of pregnancy loss. Embryo implantation in cows relies largely on the functions of the uterine endometrium. The ovarian sex steroid hormone progesterone (P4) stimulates the endometrium to prepare for embryonic survival and growth [9]. The elongating embryo secretes the anti-luteolytic pregnancy recognition signal interferon tau (IFNτ) to prolong the lifespan of the functional corpus luteum (CL) for the concomitant maintenance of the P4 supply [10]. The maternal-fetal interaction is also mediated by not only IFNτ but also other factors, including integrins and placental lactogens [11, 12]. These steroidal and embryonic signals regulate the number of endometrial transcripts spatially and temporally to establish endometrial receptivity for the conceptus to grow and implant [13]. Understanding the molecular mechanisms underlying the acquisition of uterine receptivity is important for improving fertility, which leads to successful pregnancy. The apical surface of the luminal epithelium in hollow organs is covered by mucus for lubrication and hydration, as well as protection from microorganisms. The uterine endometrium has a unique mucus microenvironment that requires transient clearance during implantation of an embryo. Mucins (MUCs) are a major component of mucus; at least 20 mucin family members have been identified in mammals to date, classified into either cell surface-attached transmembrane glycoproteins or secretory glycoproteins [14, 15]. The MUC family member MUC1 is expressed in endometrial luminal epithelial cells in mammals, including humans, monkeys, pigs, sheep, mice, and rabbits [16,17,18,19,20,21]. Transmembrane MUC1 has a large and highly glycosylated extracellular domain, and is believed to inhibit embryo implantation via steric hindrance. MUC1 expression is abolished at the site of embryo implantation in the endometrium [21, 22]. Moreover, in vitro functional analyses demonstrated a negative effect of MUC1 on mouse endometrial cell attachment to the blastocyst and attachment of human endometrial cells to trophoblast cells [23, 24]. These findings emphasize the importance of MUC1 removal from the endometrium for the acquisition of endometrial receptivity and subsequent embryo implantation in mammals. However, the role of MUC1 in bovine endometrium remains to be explored. The objective of the present study was to clarify whether and how anti-adhesive MUC1 disappears in the bovine endometrium. We conducted experiments to (1) investigate the expression of MUC1 in the bovine endometrium with or without pregnancy, (2) determine the regulator(s) of MUC1 expression using in vitro primary bovine endometrial epithelial cells treated with sex steroids or co-cultured with a blastocyst, and (3) compare MUC1 expression level between the optimal fertile period and compromised conditions with a long postpartum interval.

Materials and Methods

All experiments were approved by the Institutional Animal Care and Use Committee (approval nos. 1911C005 and 20C022NILGS) and conducted at the Institute of Livestock and Grassland Science (NILGS), National Agriculture and Food Research Organization (NARO), Japan.

Animals

The experiments were conducted at two different institutional farms (Nasushiobara, Tochigi, Japan: eleven cows, average age 3.6 ± 1.5 years, average parity 1.7 ± 0.9, and Tsukuba, Ibaraki, Japan: six cows, average age 9.2 ± 1.6 years, average parity 4.2 ± 1.5). Japanese Black cows housed in the paddock were used for this study and randomly assigned to the experimental groups. All cows showed normal estrous cycles and no reproductive problems. The cows were given a concentrate (1.0–1.5 kg) twice daily (0900 h and 1600 h) and had free access to hay and water. The stage (day) of the estrous cycle was estimated by direct observation of the cow’s behavior and by a commercially available collar-type accelerometer (Farmnote Color, Obihiro, Japan), and the dominant follicle was then confirmed by rectal palpation and ultrasonography (SonoScape S6V, Shenzhen, China) before any procedure or by monitoring the appearance following slaughter.

Endometrial tissue sampling

The cows were sedated (Celactal 2% injection, Bayer, Leverkusen, Germany), deeply anesthetized (intravenous pentobarbital-Na administration), and slaughtered by exsanguination. The gravid uterine horn of pregnant cows and the ipsilateral uterine horn to the ovary containing the CL of non-pregnant cows were cut open longitudinally using scissors. Caruncular and intercaruncular areas of the endometrium were cut into rectangles with sides of 5–10 mm, embedded with OCT compound (Sakura Finetech, Tokyo, Japan), and stored at −80°C until further use in immunohistochemistry. For the analysis of the expression of MUC1 during pregnancy, cattle were bred by timed artificial insemination as described [25], and the endometrial tissues were collected on day 20 of gestation or day 20 of the non-pregnant estrous cycle (the day of estrus = day 0) from slaughtered cows (n = 3 each). For the analysis of the expression of MUC1 during the estrous cycle, endometrial tissues were collected at the luteal (days 10–15) or follicular (days 19–21) stages of the estrous cycle from slaughtered cows (n = 3 each).

Endometrial cell sampling

Endometrial cells were collected with a cytobrush, as described previously, with minor modifications [26]. The disposable cytobrush (Fujihira Industry, Tokyo, Japan) was covered with an accompanying metal sheath with a sanitary polyvinyl chloride (PVC) sheath cover (IMV Technologies, Rambouillet, France) on top. The apparatus was inserted into the cervix. The tip of the cytobrush was exposed and rotated to collect endometrial cells from the uterine body. The cytobrush was then removed and uncoupled from the apparatus. The collected cells were suspended in cold phosphate-buffered saline (PBS) and centrifuged at 300 ×g for 1 min to obtain a cell pellet. The supernatant was discarded and the cells were washed twice with PBS. Preliminary examination included evaluation of cell composition using Wright-Giemsa staining. With the exception of some red blood cells that lacked nuclei and potentially low transcripts, the vast majority of the cells were epithelial cells. The cells were used for gene expression analysis and cell culture. For gene expression analysis, the cells were treated with 1 ml of TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and stored at −80°C for later processing. For the analysis of MUC1 expression during the estrous cycle, endometrial cells were collected at the luteal (days 10–15, n = 5) or follicular stage (days 19–21, n = 6) of the estrous cycle (day of estrous = day 0). For the analysis of MUC1 expression in cows with a long postpartum interval, endometrial cells were collected at the follicular (day 20, n = 6) stage of the estrous cycle from cows with a postpartum interval of more than 500 days. These cows with long postpartum intervals showed normal estrous cycles and did not have any reproductive problems, but the extension of calving interval is a known risk that compromises the reproductive success rate [27]. Some of them received artificial inseminations for pregnancy or embryo collection. The failure of the reproductive trials was no more than three times consecutively, and thus they were not so-called repeat breeders but, at least, they were not pregnant for more than 500 days. Control cells were collected at the follicular stage (days 19–21, n = 13) of the estrous cycle from cows with a postpartum interval of 50–150 days. Some cows were sampled multiple times postpartum with different parities.

Cell culture

Endometrial epithelial cells were isolated using the cytobrush technique described above. After washing with PBS, cells were suspended in Dulbecco’s Modified Eagle’s Medium: Nutrient Mixture F-12 (DMEM/F12) medium (Life Technologies, Carlsbad, CA, USA) containing 10% fetal bovine serum (Biowest, Nuaillé, France) with antibiotics (penicillin/streptomycin/amphotericin B, Nacalai Tesque, Kyoto, Japan) and cultured at 37°C in a 5% CO2 and 95% air humidified incubator. The epithelial cells attached to the bottom of the culture vessel, whereas the unattached red blood cells and tissue debris were washed away with PBS. The remaining epithelial cells were maintained in culture and used for experiments within two passages. To analyze the steroidal regulation of MUC1 expression, cells were trypsinized (Life Technologies), plated in tissue culture-coated six-well plates (Corning, Kennebunk, ME, USA), and cultured until confluent. Cells were then treated with 100 nM 17β-estradiol (E2, Sigma Aldrich, St. Louis, MO, USA), 10 μM P4 (Sigma Aldrich), or both in serum-free conditions at 37°C in a 5% CO2 and 95% air humidified incubator (n = 7 each). E2 and P4 were dissolved in DMSO, and the concentrations used were based on previously published methods [28, 29]. After 48 h of incubation, the cells were processed for gene expression analysis. For the analysis of the embryonic effect of MUC1 expression, cells were trypsinized, plated in six-well plates, and cultured until confluent. A hatched blastocyst was introduced directly onto the cultured cells at 37°C in a 5% CO2 and 95% air humidified incubator. After 48 h of incubation, blastocyst survival was confirmed and then it was removed. The remaining endometrial epithelial cells were analyzed for interferon-stimulated gene 15 (ISG15), MX dynamin like GTPase 1 (MX1), and MUC1 gene expression (n = 6 each).

In vitro blastocyst production

Oocytes were harvested from the ovaries of various breeds of cows at the local abattoir, and 2–6 mm of follicles were aspirated and cumulus-encased oocytes (COCs) were collected. The COCs were matured and fertilized in vitro, as previously described [30]. Briefly, COCs were matured in TCM-199 medium for 20 h under 5% CO2 in air under humidified conditions. Frozen sperms were thawed and centrifuged at 800 ×g for 10 min over 90% Percoll (GE Healthcare, Little Chalfont, UK) to separate the live sperms from the dead fraction. The sperms were diluted with IVF-100 medium (Research Institute for the Functional Peptides, Yamagata, Japan) to a final concentration of 5.0 × 106 sperms/ml and used for fertilization under 5% CO2 conditions for 6 h (20 COCs/100 μl sperm drop covered with mineral oil [Nacalai Tesque, Kyoto, Japan]). Cumulus cells were removed by repeated pipetting, and putative zygotes were placed into microdrops (20 zygotes/50 μl drop) of Synthetic Oviduct Fluid-Bovine Embryo (SOF-BE1) [31] covered with mineral oil and cultured at 38.5°C in a humidified N2 atmosphere of 5% O2 and 5% CO2 through day 8 until a blastocyst was formed (day 0 = day of insemination).

Immunohistochemistry

Endometrial samples were sectioned into 10 μm thickness using a Leica CM1850 cryostat (Leica Biosystems, Wetzlar, Germany). Sections were fixed in 4% paraformaldehyde, permeabilized in PBS containing 0.25% Triton X-100, blocked with ImmunoBlock reagent (KAC, Kyoto, Japan) for 30 min, incubated with the MUC1 antibody (1:1000 dilution, #ab109185, Abcam, Cambridge, UK) overnight at 4°C, and subsequently incubated with goat anti-rabbit antibody conjugated with Alexa Fluor® 488 (Life Technologies) for an additional 30 min at room temperature. The nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Dojindo Molecular Technologies, Kumamoto, Japan). Images were captured using a fluorescence microscope (Olympus FSX 100; Olympus, Tokyo, Japan).

Reverse transcription and quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted using TRIzol reagent (Life Technologies), and cDNA was reverse transcribed from total RNA using the SuperScript® IV First-Strand Synthesis System (Life Technologies) according to the manufacturer’s instructions. PCR was performed using Brilliant II SYBR® Green QPCR Master Mix (Agilent, Santa Clara, CA, USA) in an AriaMX Real-Time PCR system (Agilent) under the conditions of an initial holding stage (95°C for 10 min) and 40 cycles of amplification (95°C for 10 sec and 60°C for 30 sec). The primers used for analysis are listed in Table 1. The comparative cycle threshold method (ΔΔCT) was used for the relative quantification of the mRNA and normalized to the endogenous control 18S ribosomal RNA (18S rRNA).
Table 1.

List of primer sequences

Target geneGenBank accession no.Forward (from 5’ to 3’)Reverse (from 5’ to 3’)
18S rRNANR_036642GCAATTATTCCCCATGAACGGGCCTCACTAAACCATCCAA
MUC1NM_174115CATTGCCCTGGTTGTGTGTCACCATTGCCTGCAGAAACCT
ISG15NM_174366TGCAGAACTGCATCTCCATCTTCATGAGGCCGTATTCCTC
MX1NM_173940GTCCCTGCTAACGTGGACATACCAGGTTTCTCACCACGTC

Statistical analysis

Values are presented as the mean ± standard error of the mean (SEM). All experiments were conducted at least in triplicate. Statistical differences between groups were analyzed using the unpaired Student’s t-test (Excel 2020, Microsoft, Redmond, WA, USA). Statistical differences among more than two groups compared to the control were analyzed using Dunnett’s multiple comparison test. Statistical significance was set at P < 0.05. All statistical analyses were performed using Microsoft Excel for Microsoft 365 MSO ver. 16.0 or SAS ver. 9.4 (SAS Institute, Cary, NC, USA).

Results

MUC1 expression in the bovine endometrium during pregnancy and estrous cycles

First, we investigated the expression of MUC1 in bovine endometrial luminal epithelium with or without pregnancy. The results of our immunohistochemical analysis demonstrated that MUC1 was expressed and localized in the apical surface of the luminal epithelium on day 20 of the estrous cycle, and the expression disappeared at the apical surface. Weak expression of MUC1 was observed in the cytoplasm on gestational day 20 (Fig. 1).
Fig. 1.

Loss of MUC1 expression in the bovine endometrium during early pregnancy. Representative images of MUC1 expression in the caruncular region of bovine endometrium at day 20 after estrus (E20, left) and day 20 of gestation (P20, right), detected by fluorescent immunohistochemistry (green). Nuclei are counterstained with DAPI (blue). Scale bar: 50 μm. LE: luminal epithelial cells, S: stromal cells.

Loss of MUC1 expression in the bovine endometrium during early pregnancy. Representative images of MUC1 expression in the caruncular region of bovine endometrium at day 20 after estrus (E20, left) and day 20 of gestation (P20, right), detected by fluorescent immunohistochemistry (green). Nuclei are counterstained with DAPI (blue). Scale bar: 50 μm. LE: luminal epithelial cells, S: stromal cells. Next, we investigated the expression of MUC1 in the bovine endometrial luminal epithelium during the estrous cycle. RT-qPCR analysis revealed that MUC1 expression was high in the follicular phase and low in the luteal phase (P < 0.05, Fig. 2A). Immunohistochemical analysis also confirmed that MUC1 expression at the apical surface was attenuated in the luteal phase (Fig. 2B).
Fig. 2.

Alteration of MUC1 expression in the bovine endometrium during the estrous cycle. Upper panel: MUC1 expression in the bovine endometrium was analyzed by RT-qPCR at the follicular (F, n = 5) and luteal (L, n = 6) phases. Values represent are mean ± standard error of mean (SEM). * P < 0.05 compared to the control (C). Lower panels: Representative images of MUC1 expression in the caruncular region of bovine endometrium at the follicular (F, left) and luteal (L, right) phases, detected by fluorescent immunohistochemistry (green). Nuclei are counterstained with DAPI (blue). Scale bar: 50 μm. LE: luminal epithelial cells, S: stromal cells.

Alteration of MUC1 expression in the bovine endometrium during the estrous cycle. Upper panel: MUC1 expression in the bovine endometrium was analyzed by RT-qPCR at the follicular (F, n = 5) and luteal (L, n = 6) phases. Values represent are mean ± standard error of mean (SEM). * P < 0.05 compared to the control (C). Lower panels: Representative images of MUC1 expression in the caruncular region of bovine endometrium at the follicular (F, left) and luteal (L, right) phases, detected by fluorescent immunohistochemistry (green). Nuclei are counterstained with DAPI (blue). Scale bar: 50 μm. LE: luminal epithelial cells, S: stromal cells.

MUC1 expression in cultured bovine endometrial epithelial cells in the presence of sex steroid hormones or a blastocyst

We used an in vitro cell culture model to corroborate the steroidal or embryonic regulation of MUC1 expression. We observed that MUC1 expression was increased following E2 treatment (P < 0.05, Fig. 3). P4 neither increased nor decreased MUC1 expression, but inhibited the E2-induced increase in MUC1 expression (Fig. 3). Co-culturing with a blastocyst induced the expression of ISG15 and MX1, which are known targets of conceptus-derived IFNτ, demonstrating that these cells are stimulated by the embryo, at least in part, via IFNτ (P < 0.05, Fig. 4). However, MUC1 expression was not altered by blastocyst co-culture (Fig. 4).
Fig. 3.

Sex steroidal hormone-mediated regulation of MUC1 expression in the bovine endometrial epithelial cells. MUC1 expression was analyzed by RT-qPCR in in vitro bovine endometrial epithelial cells treated with 100 nM 17β-estradiol (E), 10 μM progesterone (P), or both (E + P). n = 7 each. Values represent mean ± SEM. * P < 0.05 compared to the control (C).

Fig. 4.

Embryonic regulation of MUC1 expression in the bovine endometrial epithelial cells. ISG15, MX1, and MUC1 expression was analyzed by RT-qPCR in in vitro bovine endometrial epithelial cells cultured with a blastocyst (B). In the control (C), cells were cultured without a blastocyst. N = 6 each. Values represent mean ± SEM. * P < 0.05 compared with control (C).

Sex steroidal hormone-mediated regulation of MUC1 expression in the bovine endometrial epithelial cells. MUC1 expression was analyzed by RT-qPCR in in vitro bovine endometrial epithelial cells treated with 100 nM 17β-estradiol (E), 10 μM progesterone (P), or both (E + P). n = 7 each. Values represent mean ± SEM. * P < 0.05 compared to the control (C). Embryonic regulation of MUC1 expression in the bovine endometrial epithelial cells. ISG15, MX1, and MUC1 expression was analyzed by RT-qPCR in in vitro bovine endometrial epithelial cells cultured with a blastocyst (B). In the control (C), cells were cultured without a blastocyst. N = 6 each. Values represent mean ± SEM. * P < 0.05 compared with control (C).

MUC1 expression in the endometrium of cows with long postpartum interval

We investigated MUC1 expression in the endometrium at the follicular phase of cows with postpartum intervals of more than 500 days compared to that in cows in the follicular phase within 50–150 days postpartum. We observed that MUC1 expression was significantly higher in the compromised condition (P < 0.05, Fig. 5).
Fig. 5.

High MUC1 expression in the endometrium of cows with long postpartum interval. MUC1 expression was analyzed by RT-qPCR in the bovine endometrium at the follicular phase of the estrous cycle from cows with a postpartum interval of 50–150 days (control [C] n = 13) or postpartum interval more than 500 days (long postpartum interval [Long] n = 6). Values represent mean ± SEM. * P < 0.05 compared to the control (C).

High MUC1 expression in the endometrium of cows with long postpartum interval. MUC1 expression was analyzed by RT-qPCR in the bovine endometrium at the follicular phase of the estrous cycle from cows with a postpartum interval of 50–150 days (control [C] n = 13) or postpartum interval more than 500 days (long postpartum interval [Long] n = 6). Values represent mean ± SEM. * P < 0.05 compared to the control (C).

Discussion

Defective embryo implantation causes early embryonic loss, which leads to significant economic losses in the cattle industry. Therefore, it is imperative to determine the molecular mechanisms underlying embryonic implantation to address this important challenge, as well as to improve the reproductive performance of cows. In the present study, we initially found that MUC1 localized in the apical surface of the bovine luminal epithelium in the non-pregnant state and its disappeared in the pregnant bovine uterus, suggesting that MUC1 expression is regulated by either embryonic signals or sex steroid hormones. This prompted our investigation of MUC1 expression in the non-pregnant state to eliminate the embryo effect on MUC1 expression. We found alterations in MUC1 expression during estrous cycles. These results led us to hypothesize that MUC1 expression is independent of the presence of embryos, and sex steroid hormones regulate MUC1 expression. Thus, we used an in vitro cell culture model to test this hypothesis and confirmed the steroidal regulation of MUC1 expression in bovine endometrial epithelial cells. MUC1 is expressed in a wide variety of lumens in the reproductive epithelium. Its expression decreases in the endometrium during the peri-implantation window in pigs, sheep, monkeys, and mice [17,18,19,20]. Similarly, our present experiments revealed that MUC1 expression decreased in the luteal phase, which is equivalent to the receptive implantation window in the bovine endometrium. In contrast, MUC1 expression increases in the receptive endometrium of humans and rabbits [21, 22]. Nevertheless, MUC1 expression remains reduced locally below the embryo at the attachment phase, and it is subsequently lost globally in the endometrium once implantation is initiated in these species [21, 32]. Overall, MUC1 expression disappears at the site of embryo implantation in the endometrium during early pregnancy in all mammals that were investigated. In cows, E2 levels are high in the follicular phase, whereas P4 is dominant in the luteal phase. As we observed that MUC1 expression was high in the follicular phase and low in the luteal phase, we hypothesized that the expression of MUC1 is regulated by these sex steroid hormones. We observed that the co-culture with a blastocyst did not affect MUC1 expression, and E2 upregulated the expression of MUC1 in our in vitro study. In contrast, P4 itself did not decrease MUC1 expression, although it inhibited the E2-induced increase in MUC1 expression. Similar results were observed in porcine uterine epithelial cells both in vivo and in vitro [18, 33]. MUC1 expression was induced in porcine uterine epithelial cells cultured with E2, and it was reduced in cells maintained in P4 even in the presence of E2 in vitro. In addition, E2 was unable to overcome the suppressive effect of P4 on MUC1 expression in ovariectomized gilts that received both E2 and P4 in vivo. These observations are consistent with the proposed anti-adhesive role of MUC1 in the receptive phase of the endometrium during implantation. The mechanism by which P4 antagonizes E2-mediated MUC1 induction remains to be elucidated. E2 and P4 signals act through their cognate receptors, that is, estrogen and progesterone receptors, respectively. E2 and P4 mutually and intercompartmentally regulate each of their receptors in endometrial cells, and this has been studied in cultured bovine endometrial cells in vitro [34] and in ovariectomized mice in vivo [35]. Indeed, the actions of these hormones are emphasized or antagonized depending on the cellular context. For example, P4 antagonizes the effects of E2 on inflammatory influx in the mouse uterus [36], similar to the hormonal regulation of MUC1 expression. The hormonal response to MUC1 expression varies among species. In porcine and murine endometria, MUC1 expression is increased by E2 [18, 20]. In contrast, P4 upregulates MUC1 expression in human, monkey, and rabbit endometria [17, 21, 32]. Interestingly, pigs and mice showed low MUC1 expression in the receptive phase, whereas in humans, monkeys, and rabbits the expression of MUC1 was high in this phase. It should be noted that, in addition to hormonal regulation, the embryo also participates in inhibiting MUC1 expression only in the latter species [21, 32]. Taken together, these studies indicate that there are species-specific differences in the expression and regulation of MUC1, and investigation of each species is necessary. One of the important questions among reproductive scientists is mechanisms determining the site of embryo implantation. In multiple-pregnancy mammals, there is a spatial distribution among littermates. Even in monotocous species, the implantation site is strictly regulated; otherwise, the fetus faces a fatal risk (such as placenta previa in humans) [37]. In ruminant endometria, the conceptus trophectoderm binds to the caruncle to form a cotyledon but does not bind to the inter-caruncle area [38]. Thus, the question of whether MUC1 regulates the implantation loci arose. However, we observed the global expression of MUC1 in the follicular phase and a global loss of the expression in the luteal phase, rather than caruncle- or inter-caruncle-specific expression (Fig. 2 and data not shown). These results suggest that MUC1 may not be responsible for guiding the site of embryo implantation. In addition, even in the absence of MUC1 expression, the embryo does not begin to implant into the bovine endometrium at the luteal phase until the embryo fully elongates, and the endometrium differentiates into a receptive environment. Taken together, although P4 clearance of the MUC1 obstacle may be a prerequisite for the accomplishment of embryo implantation, it appears that other unknown molecules may be necessary to determine where and when the embryo initiates implantation. MUC1 is thought to be a negative regulator of embryo implantation. Although mice with Muc1 gene mutations showed no overt phenotype in terms of infertility, there may be functional redundancy or MUC1 may simply be unnecessary as it is an inhibitor of implantation [23, 39]. When these mutant mice were housed in a non-SPF conventional husbandry facility, they exhibited reduced litter sizes, which may be due to microbial challenge and not implantation failure [40]. The degradation of MUC1 hindrance by enzymatic digestion allows murine endometrial epithelial cells to attach to the blastocyst [23]. A similar treatment induced human endometrial epithelial cells to bind to human trophoblast cells [24]. These studies demonstrate an inhibitory role of MUC1 in embryo implantation, and a reduction in MUC1 may be a prerequisite for endometrial receptivity. Nevertheless, the inhibitory effect of MUC1 in the bovine endometrium has not yet been demonstrated, and thus needs to be elucidated in the future. Moreover, a recent study revealed that MUC1 expression is higher in repeat breeder cows [41]. Our present findings demonstrated higher expression of MUC1 in the endometrium of cows with a long postpartum interval. Prolongation of the postpartum interval has been reported to decrease the conception rate [27]. Taken together, these findings indicate that MUC1 expression levels may be negatively correlated with reproductive performance. Our next interest will be to investigate whether the difference in MUC1 expression is related to the success or failure of pregnancy. If such a relationship is revealed, MUC1 could be a useful molecular marker for reproductive performance to improve fertility. In the present study, we analyzed bovine endometria at the follicular phase, the timing of artificial insemination, and thus the results from this stage enabled us to judge the possibility of becoming pregnant prior to reproductive performance. On the other hand, the luteal phase is the time when the embryo starts to attach and, therefore, investigation of MUC1 expression in cows with compromised conditions in the luteal phase would generate further valuable information. In conclusion, we observed that the bovine endometrium had a putative MUC1 barrier, which disappeared during implantation. In vitro analysis demonstrated that E2 upregulated and P4 potentially inhibited MUC1 expression in bovine endometrial epithelial cells. P4 is strongly associated with embryonic survival and growth, and a low P4 concentration is associated with pregnancy loss [7.9]. Our observations suggest that an inappropriate reduction of the MUC1 barrier in the endometrium may cause pregnancy loss in cows with low P4 concentrations. Our experiments also revealed that the expression of MUC1 is negatively correlated with fertility, since MUC1 expression was high in the compromised conditions. Clinical studies, such as a comparison of MUC1 expression with outcomes of breeding, would generate valuable insights and determine whether MUC1 is a potential indicator of reproductive efficiency in breeding trials.

Conflict of interests

The authors declare there is no conflict of interest.
  41 in total

Review 1.  MUC-1 glycosylation in endometrium: possible roles of the apical glycocalyx at implantation.

Authors:  J D Aplin
Journal:  Hum Reprod       Date:  1999-12       Impact factor: 6.918

Review 2.  Selected diseases and conditions associated with bovine conceptus loss in the first trimester.

Authors:  R H BonDurant
Journal:  Theriogenology       Date:  2007-06-04       Impact factor: 2.740

3.  Histological studies of gene-ablated mice support important functional roles for natural killer cells in the uterus during pregnancy.

Authors:  B A Croy; A A Ashkar; R A Foster; J P DiSanto; J Magram; D Carson; S J Gendler; M J Grusby; N Wagner; W Muller; M J Guimond
Journal:  J Reprod Immunol       Date:  1997-11-15       Impact factor: 4.054

4.  Mucin (Muc-1) expression is differentially regulated in uterine luminal and glandular epithelia of the baboon (Papio anubis).

Authors:  S Hild-Petito; A T Fazleabas; J Julian; D D Carson
Journal:  Biol Reprod       Date:  1996-05       Impact factor: 4.285

5.  'Conceptualizing' the Endometrium: Identification of Conceptus-Derived Proteins During Early Pregnancy in Cattle.

Authors:  Niamh Forde; Fuller W Bazer; Thomas E Spencer; Pat Lonergan
Journal:  Biol Reprod       Date:  2015-05-06       Impact factor: 4.285

6.  Temporal expression and localization of vascular endothelial growth factor family members in the bovine uterus during peri-implantation period.

Authors:  Ken-Go Hayashi; Misa Hosoe; Shiori Fujii; Hiroko Kanahara; Ryosuke Sakumoto
Journal:  Theriogenology       Date:  2019-04-24       Impact factor: 2.740

Review 7.  Placenta previa, placenta accreta, and vasa previa.

Authors:  Yinka Oyelese; John C Smulian
Journal:  Obstet Gynecol       Date:  2006-04       Impact factor: 7.661

8.  Delayed mammary tumor progression in Muc-1 null mice.

Authors:  A P Spicer; G J Rowse; T K Lidner; S J Gendler
Journal:  J Biol Chem       Date:  1995-12-15       Impact factor: 5.157

9.  Modulation of Muc-1 mucin expression in the mouse uterus during the estrus cycle, early pregnancy and placentation.

Authors:  V M Braga; S J Gendler
Journal:  J Cell Sci       Date:  1993-06       Impact factor: 5.285

Review 10.  MUC1: a multifunctional cell surface component of reproductive tissue epithelia.

Authors:  Melissa Brayman; Amantha Thathiah; Daniel D Carson
Journal:  Reprod Biol Endocrinol       Date:  2004-01-07       Impact factor: 5.211

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.