Literature DB >> 34612699

Identification and Functional Characterization of Two Homologous SpoVS Proteins Involved in Sporulation of Bacillus thuringiensis.

Xinlu Liu1, Ruibin Zhang1, Shuo Hou1, Huanhuan Liu1, Jiaojiao Wang1, Qingyue Yu1, Qi Peng1, Fuping Song1.   

Abstract

Sporulation is an important part of the life cycle of Bacillus thuringiensis and the basis for the production of parasporal crystals. This study identifies and characterizes two homologous spoVS genes (spoVS1 and spoVS2) in B. thuringiensis, both of whose expression is dependent on the σH factor. The disruption of spoVS1 and spoVS2 resulted in defective B. thuringiensis sporulation. Similar to Bacillus subtilis, B. thuringiensis strain HD(ΔspoVS1) mutants showed delayed formation of the polar septa, decreased sporulation efficiency, and blocked spore release. Different from B. subtilis, B. thuringiensis HD(ΔspoVS1) mutants had disporic septa and failed to complete engulfment in some cells. Moreover, HD(ΔspoVS2) mutants had delayed spore release. The effect of spoVS1 deletion on polar septum delay and sporulation efficiency could be compensated by spoVS2. β-Galactosidase activity analysis showed that the expression of pro-sigE and spoIIE decreased to different degrees in the HD(ΔspoVS1) and HD(ΔspoVS2) mutants. The different effects of the two mutations on the expression of sporulation genes led to decreases in Cry1Ac production of different levels. IMPORTANCE There is only one spoVS gene in B. subtilis, and its effects on sporulation have been reported. In this study, two homologous spoVS genes were found and identified in B. thuringiensis. The different effects on sporulation and parasporal crystal protein production in B. thuringiensis and their relationship were investigated. We found that these two homologous spoVS genes are highly conserved in the Bacillus cereus group, and therefore, the functional characterization of SpoVS is helpful to better understand the sporulation processes of members of the Bacillus cereus group.

Entities:  

Keywords:  Bacillus thuringiensis; disporic septum; spoVS; sporulation; σH

Mesh:

Substances:

Year:  2021        PMID: 34612699      PMCID: PMC8510167          DOI: 10.1128/Spectrum.00881-21

Source DB:  PubMed          Journal:  Microbiol Spectr        ISSN: 2165-0497


INTRODUCTION

Sporulation is an important developmental process that enables Bacillus cells to resist harsh environments. In Bacillus subtilis, an important bacterial model, it has been confirmed that the sporulation process is divided into seven stages that are mediated by a series of sigma factors: σH, σF, σE, σG, and σK (1). Various cytological events occur during these seven stages, as follows: stage 0 to I, axial filamentation; stage II, polar septum formation; stage III, forespore engulfment; stage IV to stage V, cortex and coat assembly; and stage VI to VII, spore maturation and mother cell lysis (1–6). Forespore engulfment, mediated by σF and σE, is a key step in the compartmentalization of cell regions into forespore and mother cells. Septal thinning and membrane migration are important in the process of forespore engulfment. Septal thinning is blocked in spoIID, spoIIM, and spoIIP mutants (7–10), and membrane migration is blocked in the spoIIB spoVG double mutant. However, deletion of the spoVS gene, controlled by σH, allows the spoIIB spoVG double mutant to complete engulfment (11, 12). In addition, spoVS mutations delay polar septum development and block sporulation at stage V (11). The Bacillus cereus group is another important clade of Bacillus species. B. anthracis, B. cereus, and B. thuringiensis are the most well-studied members of this group (13). B. anthracis and B. cereus can produce toxins that are pathogenic to human beings (14–16), while B. thuringiensis can produce crystal inclusions toxic to specific insects, making it the most widely used microbial insecticide (17). For some members of the Bacillus cereus group, sporulation is not only a survival strategy to resist adversity but a prerequisite for virulence factor production. A typical example is that the insecticidal toxin from B. thuringiensis can only be produced after completion of forespore engulfment (18). The transcription of many cry genes, encoding insecticidal toxins such as cry1A (19), cry4A (20), cry8E (21), and cry11A, is controlled by σE and/or σK (22, 23). In addition, sporulation-specific transcription factors regulating toxins like Spo0A can positively regulate cry1Ac (24, 25). With progressive development of genomic data, it is found that there are differences in the functions of sporulation-related genes between the Bacillus cereus group and B. subtilis, and functional characterization of these genes may be the key to revealing differences in sporulation between these two groups (26). Among members of the Firmicutes, spoVS, an important sporulation-related gene, is found in sporulating bacilli and clostridia but not in nonsporulating lactobacilli, listeria, staphylococci, or streptococci. In addition to Firmicutes, the spoVS gene is found in members of the bacterial phyla Chloroflexi, Thermotogae, and Deinococcus-Thermus (27). The distribution of the spoVS gene in sporulating bacteria has been investigated, and the numbers of spoVS homologous genes have been found to differ. There is only one gene homologous to spoVS in some bacteria, such as B. subtilis, Lysinibacillus sphaericus, and Clostridium difficile. Three genes homologous to spoVS are present in a few bacteria, such as Bacillus megaterium and Thermoanaerobacter tengcongensis. We have often found two spoVS homologous genes in members of the Bacillus cereus group, such as B. cereus, B. anthracis, and B. thuringiensis (Table S1 in the supplemental material). It is not clear whether these differences in the numbers of homologous genes lead to differences in the role of spoVS genes in the Bacillus cereus group and B. subtilis. In this study, the two homologous spoVS genes were characterized in B. thuringiensis HD73. We found that different spoVS null mutant strains exhibited different phenotypes. In addition, the transcription of these two homologous spoVS genes was controlled directly by σH. Functional characterization of two homologous SpoVS proteins in B. thuringiensis will help to better elucidate the formation and development of spores and provide insight into the regulation of the expression of the sporulation-dependent cry genes.

RESULTS

Identification of SpoVS1 and SpoVS2 in B. thuringiensis.

BLASTP analysis revealed that there are two homologous spoVS genes in B. thuringiensis, whereas only one spoVS gene exists in B. subtilis. Two open reading frames (ORFs) for the SpoVS protein (HD73_RS20190 and HD73_RS12225) were identified in the B. thuringiensis HD73 genome (accession number NC_020238.1) and designated spoVS1 and spoVS2. The spoVS1 gene is located in the B. thuringiensis HD73 chromosomal genome between bp 3917898 and 3918158 and encodes a protein containing 86 amino acids (Fig. 1A). The amino acid identity between SpoVS1 in B. thuringiensis strain HD73 and SpoVS in B. subtilis strain PY79 is 92% (Fig. 1C). The spoVS2 gene is located in the B. thuringiensis HD73 chromosomal genome between bp 2274858 and 2275133 and encodes a protein containing 91 amino acids (Fig. 1B). The amino acid identity between SpoVS2 in B. thuringiensis HD73 and SpoVS in B. subtilis PY79 is 76% (Fig. 1C). The amino acid identity between SpoVS1 and SpoVS2 is 72% (Fig. 1C).
FIG 1

Basic description of spoVS genes in B. thuringiensis HD73. (A) Map of the RS20185–RS20195 locus in the B. thuringiensis HD73 genome. The deleted region represents the fragment deleted in the spoVS1 null mutant. P is the promoter region used in the β-galactosidase activity assay. The bent arrow represents the transcription start site. ORFs are indicated by large open arrows. The scale bar corresponds to 200 bp. (B) Map of the RS12220–RS12230 locus in the B. thuringiensis HD73 genome. The deleted region represents the fragment deleted in the spoVS2 null mutant. P is the promoter region used in the β-galactosidase activity assay. The bent arrow represents the transcription start site. ORFs are indicated by large open arrows. The scale bar corresponds to 200 bp. (C) Comparison of the amino acid sequences of three SpoVS proteins from B. thuringiensis HD73 and B. subtilis PY79. Sequence alignment of SpoVS1 in B. thuringiensis HD73 and SpoVS in B. subtilis PY79 reveals 92% identity between the two proteins. Sequence alignment of SpoVS2 in B. thuringiensis HD73 and SpoVS in B. subtilis PY79 reveals 76% identity between the two proteins. The amino acid identity between SpoVS1 and SpoVS2 is 72%.

Basic description of spoVS genes in B. thuringiensis HD73. (A) Map of the RS20185–RS20195 locus in the B. thuringiensis HD73 genome. The deleted region represents the fragment deleted in the spoVS1 null mutant. P is the promoter region used in the β-galactosidase activity assay. The bent arrow represents the transcription start site. ORFs are indicated by large open arrows. The scale bar corresponds to 200 bp. (B) Map of the RS12220–RS12230 locus in the B. thuringiensis HD73 genome. The deleted region represents the fragment deleted in the spoVS2 null mutant. P is the promoter region used in the β-galactosidase activity assay. The bent arrow represents the transcription start site. ORFs are indicated by large open arrows. The scale bar corresponds to 200 bp. (C) Comparison of the amino acid sequences of three SpoVS proteins from B. thuringiensis HD73 and B. subtilis PY79. Sequence alignment of SpoVS1 in B. thuringiensis HD73 and SpoVS in B. subtilis PY79 reveals 92% identity between the two proteins. Sequence alignment of SpoVS2 in B. thuringiensis HD73 and SpoVS in B. subtilis PY79 reveals 76% identity between the two proteins. The amino acid identity between SpoVS1 and SpoVS2 is 72%.

spoVS1 and spoVS2 are both σH-dependent genes.

To determine the transcriptional start sites of the spoVS1 and spoVS2 genes, the total RNA of a wild-type B. thuringiensis HD73 strain grown in Schaeffer’s sporulation medium (SSM) to T5 (time zero [T0] is the end of the exponential growth phase, and T is n hours after the end of the exponential growth phase) was extracted and 5′ rapid amplification of cDNA ends (RACE)-PCR experiment was performed. The results showed that the transcriptional start site of the spoVS1 gene was located 46 nucleotides upstream from the spoVS1 translational start codon (Fig. S1A). The transcriptional start site of the spoVS2 gene was located 100 nucleotides upstream from the spoVS2 translational start codon (Fig. S1B). To investigate whether the transcription of the spoVS1 and spoVS2 genes in B. thuringiensis was regulated by σH, we analyzed their promoter regions in the DBTBS database (http://dbtbs.hgc.jp/). Putative σH-dependent sequences of the −35 and −10 regions (RNAGGAWWW and RNNGAATWW) (21) were found in the promoter regions of the spoVS1 (Fig. S1A) and spoVS2 (Fig. S1B) genes. To clarify the transcriptional mechanism of the spoVS1 and spoVS2 genes, P (Fig. 1A) and P (Fig. 1B) were fused with the lacZ gene, and the transcriptional activities of the fusions were measured in the wild-type B. thuringiensis HD73 strain and the sigH null mutant HD(ΔsigH). The wild-type strain containing the P-lacZ or P-lacZ fusion displayed β-galactosidase activity from exponential phase to stationary phase and reached a maximum at T6, whereas the expression of P-lacZ and P-lacZ was completely blocked in the sigH null mutant (Fig. 2A). These results suggest that both spoVS1 and spoVS2 in B. thuringiensis HD73 are σH-dependent genes.
FIG 2

Transcriptional regulation of the spoVS1 and spoVS2 genes. (A) Effects of σH on P and P expression. β-Galactosidase activity was assessed in the wild-type B. thuringiensis HD73 (squares) and the sigH null mutant strains (circles) containing the plasmid-borne transcriptional fusion P-lacZ (red symbols) or P-lacZ (black symbols). The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. Time zero (T0) is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show standard errors of the means. (B) Electrophoretic mobility shift assay (EMSA) for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 50, 100, 200, and 300 ng/μl of SigH-His. (C) EMSA for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 50, 80, 120, 160, and 180 ng/μl of SigH-His. (D) EMSA for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 30, 90, 60, and 200 ng/μl of SigH-His.

Transcriptional regulation of the spoVS1 and spoVS2 genes. (A) Effects of σH on P and P expression. β-Galactosidase activity was assessed in the wild-type B. thuringiensis HD73 (squares) and the sigH null mutant strains (circles) containing the plasmid-borne transcriptional fusion P-lacZ (red symbols) or P-lacZ (black symbols). The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. Time zero (T0) is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show standard errors of the means. (B) Electrophoretic mobility shift assay (EMSA) for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 50, 100, 200, and 300 ng/μl of SigH-His. (C) EMSA for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 50, 80, 120, 160, and 180 ng/μl of SigH-His. (D) EMSA for detecting protein-DNA interactions using FAM-labeled P and increasing concentrations of recombinant SigH-His. The lanes contained 0, 30, 90, 60, and 200 ng/μl of SigH-His. To determine whether σH binds directly to the promoter regions of spoVS1 and spoVS2, we expressed and purified SigH-His protein in Escherichia coli strain BL21(DE3) (Fig. S1D) and then performed an electrophoretic mobility shift assay (EMSA). First, the 268-bp FAM (6-carboxyfluorescein)-labeled fragment (FAM-P) (Fig. S1C) without a conserved σH motif was used as the negative control. No matter how much the concentration of purified SigH-His protein increased, the FAM-P fragment could not bind to it (Fig. 2B). Then, the 256-bp FAM-labeled fragment (FAM-P) containing a conserved σH motif was incubated with increasing amounts of purified SigH-His protein. A complete shift in P DNA fragment mobility was induced by 180 ng/μl of SigH-His protein, and the addition of 150× unlabeled specific competitor DNA restored the initial mobility of the labeled probe (Fig. 2C). A 227-bp FAM-labeled fragment (FAM-P) containing a conserved σH motif was incubated with increasing amounts of purified SigH-His protein. An almost-complete shift in P DNA fragment mobility was induced by 200 ng/μl of SigH-His protein, and the addition of 200× unlabeled specific competitor DNA restored the initial mobility of the labeled probe (Fig. 2D). The results of these experiments suggest that SigH protein can bind directly to the promoters of the spoVS1 and spoVS2 genes.

Effects of spoVS1 deletion on spore development and sporulation efficiency.

Previous studies have shown that the spoVS mutant is delayed in the formation of polar septa but engulfs normally in B. subtilis (11). To determine the role of the spoVS1 gene of B. thuringiensis HD73 in spore development, the spoVS1 deletion mutant HD(ΔspoVS1) (Fig. 1A) was constructed by replacing the spoVS1 coding sequence with the kanamycin (Kan) resistance gene kan. The deletion of spoVS1 did not impact the growth curve of B. thuringiensis HD73 cells (Fig. S2). The polar septum formation and engulfment of wild-type B. thuringiensis HD73 and HD(ΔspoVS1) were observed by staining cells with the membrane-impermeable dye FM 4-64 (N-[3-triethylammoniumpropyl]-4-{6-[4-(diethylamino) phenyl] hexatrienyl} pyridinium dibromide) at T2 and T3 (or T8) and with membrane-permeable Mito-Tracker green at T8 (or T12) and examining them with a laser scanning confocal microscope. Cell membranes and polar septa can be dyed red using FM 4-64. Forespores can be dyed green by MitoTracker green FM dye (MTG) in the red mother cell. The results showed that polar septa were observed in many HD73 strains at T2 (Fig. 3A, yellow arrows). At this time point, only a very few cells in the HD(ΔspoVS1) mutants could produce the polar septum (Fig. 3D, yellow arrows). The polar septum existed in 83.4% of cells of the HD73 strain at T3 (Fig. 3B, white arrows; Table 1). During the engulfment stage, 93.5% of cells completed engulfment and formed forespores in the HD73 strain at T8 (Fig. 3C, blue arrow; Table 1). However, the polar septum formation was delayed in HD(ΔspoVS1). We observed polar septa in 15.1% of HD(ΔspoVS1) mutants at T3 (Table 1; Fig. S3A) and in 69.5% of HD(ΔspoVS1) mutants at T8 (Fig. 3E; Table 1), when the wild-type strain had completed engulfment (Fig. 3B), while 31.3% of the HD(ΔspoVS1) mutants had completed engulfment at T12 (Fig. 3F; Table 1). These results suggest that deletion of the spoVS1 gene in B. thuringiensis delayed the formation of polar septa and caused partial cells to fail to complete engulfment.
FIG 3

Observations of the sporulation process using a laser scanning confocal microscope. The polar septa and engulfment of B. thuringiensis HD73 (wild-type strain), HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS2), and HD(ΔspoVS2ΩspoVS1) were observed using a laser scanning confocal microscope at T2, T3/T8/T12, and T8/T12/T15 after incubation in SSM at 30°C with shaking at 220 rpm. Cell membrane is visible as red fluorescence. Red lines represent membranes stained with FM 4-64, and green lines represent forespores stained with MitoTracker green FM (MTG). Yellow arrows indicate straight polar septa. White arrows indicate curved polar septa. Blue arrows indicate forespores. Scale bars = 5 μm.

TABLE 1

Effects of spoVS1 and spoVS2 mutations on early spore formation

Phenotype% (no.) of sporangial cells out of total no. of cells scored in indicated strain at indicated time pointa
HD73
HD(ΔspoVS1)
HD(ΔspoVS2)
T 3 T 8 T 3 T 8 T 12 T 3 T 8
Straight and curved septa83.4 (681)0.9 (7)15.1 (90)69.5 (196)26.4 (60)84.1 (634)0.4 (3)
Engulfment2.2 (18)93.5 (702)0 (0)2.1 (6)31.3 (71)2.4 (18)93.6 (639)
Total no. of cells scored817751594282227754683

The percentages equal the number of cells with the indicated phenotype (sporangia with any sporulation-specific phenotype, from polar septa to engulfment) divided by the total number of cells (both vegetative cells and sporangia).

Observations of the sporulation process using a laser scanning confocal microscope. The polar septa and engulfment of B. thuringiensis HD73 (wild-type strain), HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS2), and HD(ΔspoVS2ΩspoVS1) were observed using a laser scanning confocal microscope at T2, T3/T8/T12, and T8/T12/T15 after incubation in SSM at 30°C with shaking at 220 rpm. Cell membrane is visible as red fluorescence. Red lines represent membranes stained with FM 4-64, and green lines represent forespores stained with MitoTracker green FM (MTG). Yellow arrows indicate straight polar septa. White arrows indicate curved polar septa. Blue arrows indicate forespores. Scale bars = 5 μm. Effects of spoVS1 and spoVS2 mutations on early spore formation The percentages equal the number of cells with the indicated phenotype (sporangia with any sporulation-specific phenotype, from polar septa to engulfment) divided by the total number of cells (both vegetative cells and sporangia). We used optical microscopy to observe the long-term culture. At T24, almost all of the spores were mature and had been released in wild-type B. thuringiensis HD73 (Fig. 4Aa); however, the release of spores was infrequently observed in the HD(ΔspoVS1) mutant at T24, T48, and T72 (Fig. 4Ad, e, and f). These results suggest that deletion of the spoVS1 gene in B. thuringiensis blocked spore release. In addition, consistent with the failure of some cells to complete engulfment, we observed that not all cells of HD(ΔspoVS1) were able to produce spores (Fig. 4Ad, e, and f). To determine the effect of deletion of spoVS1 on sporulation efficiency, we performed spore count experiments on the wild-type B. thuringiensis HD73 and the mutant strain HD(ΔspoVS1) at T24. We found that the total cell counts and spore counts for mutant strains HD(ΔspoVS1) were approximately 2 orders of magnitude lower than those of the wild-type strain [Fig. 5A, HD73 and HD(ΔspoVS1)]. The sporulation frequency of the wild type was 93.4% (Fig. 5B, HD73). The sporulation frequency of HD(ΔspoVS1) was a third of that of the wild type, 35.8% [Fig. 5B, HD(ΔspoVS1)]. These results suggest that deletion of the spoVS1 gene reduced total cell numbers, spore numbers, and sporulation frequency.
FIG 4

Observations of mother spore release under optical microscopy. (A) Spore release of HD73 (wild-type strain), HD(ΔspoVS1), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS2), HD(ΔspoVS1ΩspoVS1), and HD(ΔspoVS2ΩspoVS1). Observations were made using optical microscopy at T24, T48, and T72 after incubation in SSM at 30°C with shaking at 220 rpm. Scale bars = 10 μm. (B) Spore release of HD73 (wild-type strain) and HD(ΔspoVS2) mutant. Observations were made using optical microscopy at T24, T28, and T32 after incubation in SSM at 30°C with shaking at 220 rpm. Scale bars = 10 μm.

FIG 5

Comparison of the sporulation frequencies of HD73 (wild-type strain), HD(ΔspoVS2), HD(ΔspoVS1), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS1), and HD(ΔspoVS1ΩspoVS2). (A) The counts of total cells and spores in HD73, HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS1), and HD(ΔspoVS1ΩspoVS2). Deletion of the spoVS1 gene reduced the numbers of cells and spores, but deletion of the spoVS2 gene did not impact the numbers of cells and spores. Self-complement of spoVS1 reduced the numbers of cells and spores, but the complement of the spoVS2 gene to the HD(ΔspoVS1) mutant could restore the total numbers of cells and spores. Each bar represents the mean value from at least three independent replicates. The error bars represent standard deviations. (B) The sporulation frequencies of all strains whose total cell counts and spore counts are shown in panel A. The sporulation frequency was defined as the ratio of the number of spores to the total number of cells, multiplied by 100. The percentage represents the average sporulation frequency. The sporulation frequency of every spoVS-related strain was compared with that of the wild-type strain (HD73), and the data were analyzed with SPSS (version 19.0) using the t test (*, P ≤ 0.05; **, P ≤ 0.01). The error bars represent standard deviations.

Observations of mother spore release under optical microscopy. (A) Spore release of HD73 (wild-type strain), HD(ΔspoVS1), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS2), HD(ΔspoVS1ΩspoVS1), and HD(ΔspoVS2ΩspoVS1). Observations were made using optical microscopy at T24, T48, and T72 after incubation in SSM at 30°C with shaking at 220 rpm. Scale bars = 10 μm. (B) Spore release of HD73 (wild-type strain) and HD(ΔspoVS2) mutant. Observations were made using optical microscopy at T24, T28, and T32 after incubation in SSM at 30°C with shaking at 220 rpm. Scale bars = 10 μm. Comparison of the sporulation frequencies of HD73 (wild-type strain), HD(ΔspoVS2), HD(ΔspoVS1), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS1), and HD(ΔspoVS1ΩspoVS2). (A) The counts of total cells and spores in HD73, HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS1), and HD(ΔspoVS1ΩspoVS2). Deletion of the spoVS1 gene reduced the numbers of cells and spores, but deletion of the spoVS2 gene did not impact the numbers of cells and spores. Self-complement of spoVS1 reduced the numbers of cells and spores, but the complement of the spoVS2 gene to the HD(ΔspoVS1) mutant could restore the total numbers of cells and spores. Each bar represents the mean value from at least three independent replicates. The error bars represent standard deviations. (B) The sporulation frequencies of all strains whose total cell counts and spore counts are shown in panel A. The sporulation frequency was defined as the ratio of the number of spores to the total number of cells, multiplied by 100. The percentage represents the average sporulation frequency. The sporulation frequency of every spoVS-related strain was compared with that of the wild-type strain (HD73), and the data were analyzed with SPSS (version 19.0) using the t test (*, P ≤ 0.05; **, P ≤ 0.01). The error bars represent standard deviations.

Effects of spoVS2 deletion on spore development and sporulation efficiency.

To determine the role of the spoVS2 genes of B. thuringiensis HD73 in spore development, the spoVS2 deletion mutant HD(ΔspoVS2) (Fig. 1A) was constructed by replacing the spoVS2 coding sequence with the kanamycin (Kan) resistance gene kan. The deletion of spoVS2 did not impact the growth curve of B. thuringiensis HD73 cells (Fig. S2). Laser scanning confocal microscopy observation showed that the proportions of polar septa (T3) and forespores (T8) were 84.1% and 93.6%, respectively, in the HD(ΔspoVS2) strain. (Fig. 3H, white arrows, and I, blue arrows; Table 1). This was not different from the results for the wild type (Fig. 3B, white arrows and C, blue arrows; Table 1). These results suggest that deletion of the spoVS2 gene in B. thuringiensis did not affect the formation of polar septa. Optical microscopy observation showed that at T24, only a very small number of spores were released in HD(ΔspoVS2) (Fig. 4Bd), while the spores were almost completely released in the wild-type strain (Fig. 4Ba). Half of the spores of the HD(ΔspoVS2) strain were not released at T28 (Fig. 4Be), while all of the spores were released in HD(ΔspoVS2) at T32 (Fig. 4Bf). These results suggest that deletion of the spoVS2 gene in B. thuringiensis delayed spore release. The spore count results showed that the total cell and spore counts of HD(ΔspoVS2) were not different from those of the wild type [Fig. 5A, HD73 and HD(ΔspoVS2)]. The sporulation frequency of the HD(ΔspoVS2) mutant (93.3%) [Fig. 5B, HD(ΔspoVS2)] was also consistent with that of the wild type (93.4%) (Fig. 5B, HD73). These results suggest that deletion of the spoVS2 gene did not affect total cell numbers, spore numbers, or sporulation frequency. However, deletion of the spoVS2 gene in B. thuringiensis delayed the spore release.

The functions of SpoVS1 and SpoVS2 were partially redundant.

Prior to this analysis, we had a preliminary understanding of the functions of the spoVS1 and spoVS2 genes in B. thuringiensis and observed similarities and differences with spoVS in B. subtilis. To clarify the functional relationship of spoVS1 and spoVS2 in B. thuringiensis, the double mutant strain HD(ΔspoVS1ΔspoVS2) was constructed by deleting the spoVS2 coding sequence in the HD(ΔspoVS1) mutant. We introduced pHTspoVS1 and pHTspoVS2 vectors into the HD(ΔspoVS1) and HD(ΔspoVS2) mutants to obtain the recombinant strains HD(ΔspoVS1ΩspoVS1) and HD(ΔspoVS2ΩspoVS2). We further introduced pHTspoVS1 and pHTspoVS2 vectors into the HD(ΔspoVS2) and HD(ΔspoVS1) mutants to obtain the recombinant strains HD(ΔspoVS1ΩspoVS2) and HD(ΔspoVS2ΩspoVS1). The growth curves of the double mutant strain and the recombinant strains were similar to the growth curve of wild-type B. thuringiensis HD73 (Fig. S2). Laser scanning confocal microscopy showed that polar septa were present in 4.0% of the double mutant strain at T3 [at which time they were observed in 15.1% of HD(ΔspoVS1) cells] (Fig. 3J; Table 2). Engulfment was observed in 25.2% of the double mutant strain at T15 (Fig. 3L; Table 2). The engulfment of the double mutant (Fig. 3L) was later than that of the wild type, HD(ΔspoVS2), or HD(ΔspoVS1) (Fig. 3C, F, and I). Otherwise, polar septa were observed in 51.9% of HD(ΔspoVS1ΩspoVS2) at T3 (Fig. 3T; Table 2), and engulfment was observed in 48.6% of HD(ΔspoVS1ΩspoVS2) at T8 (Fig. 3U; Table 2). We found that the delay in polar septum formation was more apparent in the double mutant strain HD(ΔspoVS1ΔspoVS2) than in the single mutant strain HD(ΔspoVS1). The effect of spoVS1 deletion on polar septum delay may be compensated by spoVS2.
TABLE 2

Effects of HD(ΔspoVS1ΔspoVS2) and HD(ΔspoVS1ΩspoVS2) on early spore formation

Phenotype% (no.) of sporangial cells out of total no. of cells scored in indicated strain at indicated time pointa
HD(ΔspoVS1ΔspoVS2)
HD(ΔspoVS1ΩspoVS2)
T 3 T 15 T 3 T 8
Septa4.0 (9)51.9 (191)
Engulfment25.2 (58)48.6 (120)
Total no. of cells scored277230368247

The percentages equal the number of cells with the indicated phenotype (sporangia with any sporulation-specific phenotype, from polar septa to engulfment) divided by the total number of cells (both vegetative cells and sporangia).

Effects of HD(ΔspoVS1ΔspoVS2) and HD(ΔspoVS1ΩspoVS2) on early spore formation The percentages equal the number of cells with the indicated phenotype (sporangia with any sporulation-specific phenotype, from polar septa to engulfment) divided by the total number of cells (both vegetative cells and sporangia). Optical microscopy observation showed that the total cell and spore counts for double mutant HD(ΔspoVS1ΔspoVS2) were approximately 2 orders of magnitude lower than those of the wild-type strain [Fig. 5A, HD(ΔspoVS1ΔspoVS2)]. Only 21.9% spores were observed in the double mutant HD(ΔspoVS1ΔspoVS2) at T24, less than in the HD(ΔspoVS1) mutant (35.8%) [Fig. 5B, HD(ΔspoVS1ΔspoVS2) and HD(ΔspoVS1)], while 62.5% spores were observed in the HD(ΔspoVS1ΩspoVS2) strain at T24 [Fig. 5B, HD(ΔspoVS1ΔspoVS2)]. We found that the decrease of sporulation efficiency was more apparent in the double mutant strain HD(ΔspoVS1ΔspoVS2) than in the single mutant strain HD(ΔspoVS1). However, the sporulation frequency resulting from the absence of spoVS1 could be partially compensated by spoVS2 but could not be restored to the level of the wild type. Further evidence indicated that the functions of the two homologous spoVS genes were partially redundant in B. thuringiensis.

Mutation of spoVS1 or spoVS2 has an effect on the transcription activities of pro-sigE and spoIIE.

During laser scanning confocal microscopy observations, we found that some cells produced 13.9% disporic septa in the mutant strain HD(ΔspoVS1), 12.4% disporic septa in HD(ΔspoVS1ΔspoVS2), and 7.1% disporic septa in the complemented strain HD(ΔspoVS1ΩspoVS2) at T4 (Fig. 6Ab, c, and d; Table 3). Disporic septa are a typical feature of sigE mutants of B. subtilis (28). In addition, this phenomenon occurs when the regulons of σE, spoIID, spoIIM, and spoIIP are absent simultaneously (28). The sigE mutant of B. thuringiensis also had a disporic-septum phenotype (Fig. 6Aa). This drew our attention to the question of whether σE could work properly in a series of mutants of spoVS. In order to investigate whether this particular phenotype was caused by the decreased expression of pro-sigE in these strains, a plasmid containing the Ppro--lacZ fusion was introduced into the wild-type strain and the mutant strains HD(ΔspoVS1), HD(ΔspoVS2), and HD(ΔspoVS1ΔspoVS2). β-Galactosidase activity assays showed that the expression of pro-sigE in the wild-type strain started at T1, increased from T1 to T6, and then trended to stabilization (Fig. 6B, black circles). The expression of pro-sigE in the mutant strain HD(ΔspoVS2) was similar to that in the wild-type strain before T4, while it was lower than in the wild-type strain from T4 (Fig. 6B, green triangles). The expression of pro-sigE in the mutant strains HD(ΔspoVS1) and HD(ΔspoVS1ΔspoVS2) increased slowly from T1, and the transcription activity of pro-sigE was almost identical to that of the wild-type strain at T12 (Fig. 6, red squares and blue rhombuses). Our results confirm that the expression of pro-sigE decreased differently in the HD(ΔspoVS1) and HD(ΔspoVS2) strains. The expression of pro-sigE decreased from the initial stage of sporulation in HD(ΔspoVS1) and HD(ΔspoVS1ΔspoVS2). However, the decrease in the expression of pro-sigE in HD(ΔspoVS2) only manifested after the T4 stage of forespore engulfment.
FIG 6

Effects of various mutations on pro-sigE and spoIIE expression. (A) Disporic septa of HD(ΔsigE) mutant (a), HD(ΔspoVS1) mutant (b), HD(ΔspoVS1ΔspoVS2) double mutant (c), and HD(ΔspoVS1ΩspoVS2) mutant (d) were observed using a laser scanning confocal microscope at T4 after incubation in SSM at 30°C with shaking at 220 rpm. Cell membranes are visible as red fluorescence. Red lines represent membranes stained with FM 4-64. Blue arrows indicate disporic septa. Scale bars = 7.5 μm. (B) β-Galactosidase activities were assessed for HD73 (wild-type) (black circles), HD(ΔspoVS1) mutant (red squares), HD(ΔspoVS2) mutant (green triangles), and HD(ΔspoVS1ΔspoVS2) mutant (blue rhombuses) containing the plasmid-borne transcriptional fusion P--lacZ. The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. T0 is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show the standard errors of the means. (C) β-Galactosidase activity was assessed for HD73 (wild-type) (black circles), HD(ΔspoVS1) mutant (red squares), HD(ΔspoVS2) mutant (green triangles), and HD(ΔspoVS1ΔspoVS2) mutant (blue rhombuses) containing the plasmid-borne transcriptional fusion P-lacZ. The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. T0 is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show the standard errors of the means.

TABLE 3

Effects of spoVS1 mutations on polar septa

Phenotype% (no.) of cells with polar septa out of total no. of cells in indicated strain at T4a
HD(ΔspoVS1)HD(ΔspoVS1ΔspoVS2)HD(ΔspoVS1ΩspoVS2)
Straight and curved septa26.3 (85)19.7 (62)51.3 (225)
Disporic septa13.9 (45)12.4 (39)7.1 (31)
Total no. of cells scored323314439

The percentages equal the number of cells with polar septa of the indicated phenotype (straight and curved septa or disporic) divided by the total number of cells (both vegetative cells and sporangia).

Effects of various mutations on pro-sigE and spoIIE expression. (A) Disporic septa of HD(ΔsigE) mutant (a), HD(ΔspoVS1) mutant (b), HD(ΔspoVS1ΔspoVS2) double mutant (c), and HD(ΔspoVS1ΩspoVS2) mutant (d) were observed using a laser scanning confocal microscope at T4 after incubation in SSM at 30°C with shaking at 220 rpm. Cell membranes are visible as red fluorescence. Red lines represent membranes stained with FM 4-64. Blue arrows indicate disporic septa. Scale bars = 7.5 μm. (B) β-Galactosidase activities were assessed for HD73 (wild-type) (black circles), HD(ΔspoVS1) mutant (red squares), HD(ΔspoVS2) mutant (green triangles), and HD(ΔspoVS1ΔspoVS2) mutant (blue rhombuses) containing the plasmid-borne transcriptional fusion P--lacZ. The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. T0 is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show the standard errors of the means. (C) β-Galactosidase activity was assessed for HD73 (wild-type) (black circles), HD(ΔspoVS1) mutant (red squares), HD(ΔspoVS2) mutant (green triangles), and HD(ΔspoVS1ΔspoVS2) mutant (blue rhombuses) containing the plasmid-borne transcriptional fusion P-lacZ. The bacteria were grown at 30°C in SSM medium, and samples were taken at the indicated time points. T0 is the end of the exponential growth phase, and T is n hours after T0. Each data point represents the mean value from at least three independent replicates. Error bars show the standard errors of the means. Effects of spoVS1 mutations on polar septa The percentages equal the number of cells with polar septa of the indicated phenotype (straight and curved septa or disporic) divided by the total number of cells (both vegetative cells and sporangia). In addition, it has been reported that the disporic-septum phenomenon was also observed in the ΔspoIIE mutant of B. subtilis (29). Therefore, we also detected spoIIE expression in the wild-type strain and the mutant strains HD(ΔspoVS1), HD(ΔspoVS2), and HD(ΔspoVS1ΔspoVS2). β-Galactosidase activity assays showed that the expression of spoIIE in the wild-type strain started at T0, increased from T1 to T7, and then trended to stabilization (Fig. 6C, black circles), and the expression levels of spoIIE in the mutant strains HD(ΔspoVS1), HD(ΔspoVS2), and HD(ΔspoVS1ΔspoVS2) were lower than in the wild-type strain from T1 to T8 (Fig. 6C). The decrease of spoIIE expression was more significant in HD(ΔspoVS1) than in HD(ΔspoVS2) (Fig. 6C, red squares and green triangles). The expression of spoIIE in the HD(ΔspoVS1ΔspoVS2) mutant started at T3, and the transcription activity of spoIIE was almost identical to that of HD(ΔspoVS1) at T8 (Fig. 6C, blue rhombuses). Our results confirm that the expression of spoIIE decreased similarly in HD(ΔspoVS1) and HD(ΔspoVS2), but the decrease was more significant in the HD(ΔspoVS1). The initiation of spoIIE expression in the double mutant was delayed by 3 h compared with that in the two single mutants and the wild type, which should be due to the superimposed effects of spoVS1 and spoVS2 deletion. These results suggest that the disporic-septum phenotype is caused by significant inhibition of pro-sigE and spoIIE transcription in the HD(ΔspoVS1) and HD(ΔspoVS1ΔspoVS2) mutants.

DISCUSSION

We report the identification and characterization of two genes homologous to spoVS of B. subtilis in B. thuringiensis, spoVS1 and spoVS2. As in B. subtilis, both spoVS1 and spoVS2 in B. thuringiensis are controlled by the σH factor. In B. subtilis, the spoVS mutant is delayed in the formation of polar septa and is blocked in stage V of sporulation with a spore coat defect (10, 11). In B. thuringiensis, the deletion of the spoVS1 gene delays the formation of polar septa, reduces the numbers of total cells and spores, decreases the sporulation efficiency, and blocks spore release, while the effect of deletion of the spoVS2 gene on the spore development process is mainly reflected in the delay of spore release. The deletion of the spoVS1 gene produces a spore development phenotype similar to that of the spoVS mutant of B. subtilis. Different from the deletion of spoVS in B. subtilis, the deletion of the spoVS1 gene can cause the occurrence of disporic septa in a certain proportion of cells (Fig. 6Ab, c, and d; Table 3) and failure to complete engulfment in some cells (Table 1). Moreover, the delay in polar septum formation is more apparent in the double mutant strain HD(ΔspoVS1ΔspoVS2) than in the single mutant strain HD(ΔspoVS1). The effect of spoVS1 deletion on polar septum delay may be compensated by spoVS2 overexpression. The results suggest that the functions of the two homologous spoVS genes have a partial overlap in polar septum development and spore maturation. In addition, we fortuitously found that it was almost impossible to observe spore production in HD(ΔspoVS1ΩspoVS1) and HD(ΔspoVS2ΩspoVS1). It is possible that both high (overexpression) and low (deletion) levels of SpoVS1 expression can affect the expression of key genes in the sporulation network. The formation of the polar septum is the first significant change of cell morphology during spore formation. The mutations of stage II loci block morphological development from proceeding beyond the polar septum step (29). As suggested by the phenotypic analysis, we also examined the expression of several key sporulation genes in spoVS series mutants. σE regulates at least 253 genes with different functions in B. subtilis (7). These include pro-sigK and some genes related to forespore engulfment, such as spoIID, spoIIM, and spoIIP, causing cell growth to be blocked to stage II of sporulation when they are absent (7–9). Disporic septa are a typical feature of sigE mutants. Disporic septa also occur when spoIID, spoIIM, and spoIIP are absent simultaneously (28). In addition, σE regulates some proteins related to the synthesis of cortex and coat, such as spoVB, spoVD, and spoVE (30–32). The deletion of these genes affects the maturation and release of spores. SpoIIE is also involved in polar septum formation in B. subtilis (5). Mutations of spoIIE block sporulation at the stage of polar septum formation and prevent the activation of σF. In addition, spoIIE mutants produce different polar septum phenotypes, such as no septa, thick septa, and disporic septa (29). Our results show that the transcription levels of pro-sigE and spoIIE are greatly inhibited in the HD(ΔspoVS1) mutant. This provides a reasonable explanation for the phenotype caused by the deletion of spoVS1. However, the transcription level of spoIIE also decreases in the HD(ΔspoVS2) mutant, but the degree of decrease does not affect the role of spoIIE in polar septum formation. The expression of pro-sigE in the HD(ΔspoVS2) mutant is not affected before T4, but it is inhibited after T4. Combined with the phenotype experiments, the results show that the deletion of spoVS2 does not significantly inhibit genes associated with polar septum and forespore formation, but the cumulative effects result in a longer time for maturation of the spore. The production of Cry1Ac in spoVS1 and spoVS2 mutants is consistent with the effects of their mutations on sporulation. In B. thuringiensis, σE and σK directly determine the transcription of the cry1Ac gene under the guidance of the BtI and BtII promoters, respectively (33). Our results show that Cry1Ac production is reduced to different degrees in the HD(ΔspoVS1) and HD(ΔspoVS2) mutants (Fig. S3). In HD(ΔspoVS1), the transcription activities of pro-sigE (Fig. 6B, red squares) and pro-sigK (Fig. S4, red squares) are significantly reduced. Therefore, the very low Cry1Ac production may be caused by the decrease of σE and σK in HD(ΔspoVS1). However, the lower level of Cry1Ac production than in the wild-type strain may be related to the decrease of σE in HD(ΔspoVS2). In HD(ΔspoVS2), the transcription activity of pro-sigE was reduced after T4 (Fig. 6B, green triangles), while the transcription activity of pro-sigK was 1 h earlier than in the wild-type strain (Fig. S4, green triangles). It has been confirmed that production of σK about 1 h earlier than normal does negatively regulate sigE expression in B. subtilis (34). We found that these two homologous spoVS genes were highly conserved in the Bacillus cereus group. The amino acid sequence of SpoVS1 shared 100% identity with the homologous genes in the Bacillus cereus group, and the SpoVS2 showed 78% to 100% sequence identities with its homologous genes (Table S2). Therefore, our findings for spoVS1 and spoVS2 genes in B. thuringiensis can be extended to the entire Bacillus cereus group.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 4. E. coli strains were cultured at 37°C in Luria-Bertani (LB) medium (35). B. thuringiensis strains were cultured at 30°C in Schaeffer’s sporulation medium (SSM) (36). Time zero was defined as the beginning of the transition phase between the exponential and stationary phases. The antibiotic concentrations used for bacterial selection were as follows: 100 μg/ml ampicillin for E. coli and 5 μg/ml erythromycin or 100 μg/ml kanamycin for B. thuringiensis.
TABLE 4

Strains and plasmids used in this study

Strain or plasmidCharacteristic(s)Source
E. coli strains
 TG1Δ(lac-proAB) supE thi hsd-5 (F′ traD36 proA+ proB+ lacIq lacZΔM15) 40
 ETF dam-13::Tn9 dcm-6 hsdM-hsdR recF143 zjj-202::Tn10 galK2 galT22 ara14 pacY1 xyl-5 leuB6 thi-1 40
 BL21(DE3)F dcm ompT hsdS (rB mB) galλ(DE3) 48
 BL21(pETsigH)BL21(DE3) with pETsigH plasmidThis study
B. thuringiensis strains
 HD73Wild type containing cry1Ac gene
 HD(ΔsigH)HD73 ΔsigH mutant 21
 HD(PspoVS1-lacZ)HD73 strain containing plasmid PspoVS1-lacZThis study
 HD(PspoVS2-lacZ)HD73 strain containing plasmid PspoVS2-lacZThis study
 HDΔsigH(PspoVS1-lacZ)ΔsigH mutant containing plasmid PspoVS1-lacZThis study
 HDΔsigH(PspoVS2-lacZ)ΔsigH mutant containing plasmid PspoVS2-lacZThis study
 HD(ΔspoVS1)HD73 ΔspoVS1 mutantThis study
 HD(ΔspoVS2)HD73 ΔspoVS2 mutantThis study
 HD(ΔspoVS1ΔspoVS2)HD73 ΔspoVS1 ΔspoVS2 double mutantThis study
 HD(ΔspoVS1ΩspoVS1)HD73 ΔspoVS1 mutant containing plasmid pHTHFspoVS1This study
 HD(ΔspoVS2ΩspoVS2)HD73 ΔspoVS2 mutant containing plasmid pHTHFspoVS2This study
 HD(ΔspoVS1ΩspoVS2)HD73 ΔspoVS1 mutant containing plasmid pHTHFspoVS2This study
 HD(ΔspoVS2ΩspoVS1)HD73 ΔspoVS2 mutant containing plasmid pHTHFspoVS1This study
 HD(ΔsigE)HD73 ΔsigE mutant 24
 HD(PsigE-lacZ)HD73 strain containing plasmid PsigE-lacZ 44
 HDΔspoVS1(PsigE-lacZ)HD73 ΔspoVS1 mutant containing plasmid PsigE-lacZThis study
 HDΔspoVS2(PsigE-lacZ)HD73 ΔspoVS2 mutant containing plasmid PsigE-lacZThis study
 HDΔspoVS1ΔspoVS2(PsigE-lacZ)HD73 ΔspoVS1 ΔspoVS2 mutant containing plasmid PsigE-lacZThis study
 HD(PsigK-lacZ)HD73 strain containing plasmid PsigK-lacZ 44
 HDΔspoVS1(PsigK-lacZ)HD73 ΔspoVS1 mutant containing plasmid PsigK-lacZThis study
 HDΔspoVS2(PsigK-lacZ)HD73 ΔspoVS2 mutant containing plasmid PsigK-lacZThis study
 HDΔspoVS1ΔspoVS2(PsigK-lacZ)HD73 ΔspoVS1 ΔspoVS2 mutant containing plasmid PsigK-lacZThis study
Plasmids
 pHT304-18ZPromoterless lacZ vector, Eryr Ampr; 9.7 kb 39
 pET-21bExpression vector, Ampr; 5.4 kbNovagen
 pMADAmpr Eryr, temp-sensitive B. thuringiensis-E. coli shuttle vector 41
 PspoVS1-lacZpHT304-18Z carrying PspoVS1, Ampr EryrThis study
 PspoVS2-lacZpHT304-18Z carrying PspoVS2, Ampr EryrThis study
 PsigE-lacZpHT304-18Z carrying PsigE, Ampr Eryr 44
 PsigK-lacZpHT304-18Z carrying PsigK, Ampr Eryr 44
 pETsigHpET-21b containing sigH gene, AmprThis study
 pMADΩspoVS1::KmpMAD carrying partial spoVS1 deletion gene Ω Km geneThis study
 pMADΩspoVS2:: KmpMAD carrying partial spoVS2 deletion gene Ω Km geneThis study
 pMADΩspoVS2pMAD carrying partial spoVS2 deletion geneThis study
 pHT315B. thuringiensis-E. coli shuttle vector 43
 pHTspoVS1pHT315 carrying spoVS1, Ampr EryrThis study
 pHTspoVS2pHT315 carrying spoVS2, Ampr EryrThis study
Strains and plasmids used in this study

DNA manipulation and transformation.

Reagents and methods for PCR amplification and purification have been described previously (21). Chromosomal DNA was extracted from B. thuringiensis as described previously (37). Restriction enzymes and T4 DNA ligase (TaKaRa Biotechnology Corporation, Dalian, China) were employed according to the manufacturer’s instructions. Oligonucleotide primers (Table 5) were synthesized by Sangon (Beijing, China). Plasmid DNA was extracted from E. coli using a plasmid extraction kit (Axgen Biotechnology Corporation, Hangzhou, China). After agarose gel electrophoresis, all DNA fragments were isolated and purified using an AxyPrep DNA gel extraction kit (Axygen). All constructs were confirmed by PCR followed by DNA sequencing (BGI, Beijing, China). Standard procedures were used for E. coli transformation. B. thuringiensis cells were transformed using electroporation as previously described (38).
TABLE 5

Primers and sequences used in this study

PrimerSequence (5′–3′)
spoVS1RACE-R CGCTGGGATACAAATCAGGTCCAAACCACTAGGCGC
spoVS2RACE-R CCACTTGGAGCGACGAACCCTCTTGCAATCGC
spoVS1-a AGATCTATCGATGCATGCCATGGTACCCGGGAGCTTATCTTTGTGAACTGTAATGG
spoVS1-b CCTATCACCTCAAATGGTTCGCTGGTAGAACCTCGTTAAGTTTAAACAAC
S1Km-a GTTGTTTAAACTTAACGAGGTTCTACCAGCGAACCATTTGAGGTGATAGG
S1Km-b CTGCAAACAGGTTGTTTAAACTTAAAATTCCTCGTAGGCGCTCG
spoVS1-c CGAGCGCCTACGAGGAATTTTAAGTTTAAACAACCTGTTTGCAG
spoVS1-d GCGTCTGCAGAAGCTTCTAGAATTCGAGCTCCACGTGGGTGCTCGCAAAGTTTCA
spoVS2-a AGATCTATCGATGCATGCCATGGTACCCGGGAGTTTGAAGAATGATAGTATGAACCCAAA
spoVS2-b CCTCAAATGGTTCGCTGTTCCATGTAAGTTGCTCCCTCTATT
S2Km-a AATAGAGGGAGCAACTTACATGGAACAGCGAACCATTTGAGG
S2Km-b CCCTTATAGTAACGCTCTCTTCTACTAAAATTCCTCGTAGGCGCTCG
spoVS2-c CGAGCGCCTACGAGGAATTTTAGTAGAAGAGAGCGTTACTATAAGGG
spoVS2-d GCGTCTGCAGAAGCTTCTAGAATTCGAGCTCCAAGAATAAAGCTCTCATTCAACGC
spoVS1-F GCATGCCTGCAGGTCGACTCTAGAGCCATGCGGAGACTACAAGTGA
spoVS1-R TGTAAAACGACGGCCAGTGAATTCGTTGTTTAAACTTAACGAGGTTCTAC
spoVS2-F GCATGCCTGCAGGTCGACTCTAGAGCGAGTTTGAAGAATGATAGTATGAACCC
spoVS2-R TGTAAAACGACGGCCAGTGAATTCCCCTTATAGTAACGCTCTCTTCTA
PspoVS1-F AACTGCAGCCATGCGGAGACTACAAGTGA
PspoVS1-R AACTGCAGTTCCATTCCGCGTTTCCTCCTCGT
PspoVS2-F AACTGCAGATGAAGATGAATCACAATTGGCG
PspoVS2-R CGGGATCCTTCCATGTAAGTTGCTCCCTCTATT
EMspoVS1-F AGTGCAGTGTTAATTGATGTGG
EMspoVS1-R TTCCATTCCGCGTTTCCTCCTCGT
EMspoVS2-F GCTGTATGGATGTTATCATTTGGTG
EMspoVS2-R TTCCATGTAAGTTGCTCCCTCTATT
sigH-F CGGATCCGGTGGAAGCAGGCTTCGTAAG
sigH-R GTCGACTGAATTTAAAGTTGTACTTTC
pMAD-F GGTACCTACGTAGGATCGATCC
pMAD-R TTGCAGGCCATGCTGTCCA
HDspoVS1-F GTTAGAAACTGCGGTACAAAAGTG
HDspoVS1-R CTTTTTAGAGTGTGGGGCGCAGGC
HDspoVS2-F CGAAACTCTATAATCACCAGCTTG
HDspoVS2-R CACGAGGCCATACTTCCCTACCAG
Primers and sequences used in this study

Strain construction.

The putative promoter fragment of P (498 bp) was cloned from B. thuringiensis HD73 genomic DNA using the specific primers PspoVS1-F (with a PstI restriction site) and PspoVS1-R (with a BamHI restriction site). The putative promoter fragment of P (565 bp) was cloned from B. thuringiensis HD73 genomic DNA using the specific primers PspoVS2-F (with a PstI restriction site) and PspoVS2-R (with a BamHI restriction site). The PstI-BamHI fragments of the P promoter and P promoter were then integrated into vector pHT304-18Z containing a promoterless lacZ gene (39). The recombinant plasmids PspoVS1-lacZ and PspoVS2-lacZ were introduced into the wild-type strain and the sigH mutant strain (21). The resulting strains HD(PspoVS1-lacZ), HD(PspoVS2-lacZ), HDΔsigH(PspoVS1-lacZ), and HDΔsigH(PspoVS2-lacZ) were selected using erythromycin resistance and PCR identification. All primers for gene deletion were designed according to the B. thuringiensis HD73 genome sequence. The 653-bp fragment upstream from the start codon of spoVS1 (spoVS1 fragment A) was amplified using PCR with B. thuringiensis HD73 genomic DNA as the template and spoVS1-a and spoVS1-b as primers. Primers spoVS1-c and spoVS1-d were used to amplify the 679-bp fragment downstream (spoVS1 fragment B), and primers Km-a and Km-b were used to amplify a 1,473-bp kanamycin resistance gene (kan) cassette directed by the PaphA3 promoter from pDG780 (40). spoVS1 fragment A, kan, and spoVS1 fragment B were ligated together using overlapping PCR with primers SpoVS1-a and SpoVS1-d. The resulting fragment (2,805 bp) was inserted into the BamHI-SalI restriction sites of the erythromycin-resistant, temperature-sensitive plasmid pMAD to generate the pMADΩspoVS1::km plasmid. The 642-bp fragment upstream from the start codon of spoVS2 (spoVS2 fragment A) was amplified using PCR with B. thuringiensis HD73 genomic DNA as the template and spoVS2-a and spoVS2-b as primers. Primers SpoVS2-c and SpoVS2-d were used to amplify a 606-bp fragment downstream (spoVS2 fragment B), and primers Km-a and Km-b were used to amplify a 1,473-bp kanamycin resistance gene (kan) cassette directed by the PaphA3 promoter from pDG780 (40). spoVS2 fragment A, kan, and spoVS2 fragment B were ligated together using overlapping PCR with primers SpoVS2-a and SpoVS2-d. The resulting fragment (2,721 bp) was inserted into the BamHI-SalI restriction sites of the erythromycin-resistant, temperature-sensitive plasmid pMAD (41) to generate the pMADΩspoVS2::km plasmid. The pMADΩspoVS1::km plasmid and pMADΩspoVS2::km plasmid were electroporated into B. thuringiensis HD73. Transformants selected on LB agar plates containing erythromycin and kanamycin resistance were identified using PCR with pMAD-F and pMAD-R primers. Gene deletion in the HD73 cells was accomplished using homologous recombination as reported previously (42). The HD(ΔspoVS1) mutant was verified using PCR and DNA sequencing with primers HDspoVS1-F and HDspoVS1-R. The HD(ΔspoVS2) mutant was verified using PCR and DNA sequencing with primers HDspoVS2-F and HDspoVS2-R. In addition, spoVS2 fragment A and spoVS2 fragment B were ligated together using overlapping PCR with primers SpoVS2-a and SpoVS2-d. The resulting fragment (1,248 bp) was inserted into the BamHI-SalI restriction sites of the erythromycin-resistant, temperature-sensitive plasmid pMAD (41) to generate the pMADΩspoVS2 plasmid. The recombinant plasmid was electroporated into the HD(ΔspoVS1) strain. Transformants selected on LB agar plates containing erythromycin and kanamycin resistance were identified using PCR with pMAD-F and pMAD-R primers. The spoVS2 gene deletion in the HD(ΔspoVS1) strain was accomplished using homologous recombination as reported previously (42). The double mutant HD(ΔspoVS1ΔspoVS2) was verified using PCR and DNA sequencing with primers HDspoVS1-F/HDspoVS1-R and HDspoVS2-F/HDspoVS2-R. To explore the gene function relationship between spoVS1 and spoVS2, a 770-bp fragment containing the spoVS1 promoter and ORF(RS20190) was amplified using PCR with B. thuringiensis HD73 genomic DNA as the template and spoVS1-F and spoVS1-R as primers. The fragment was linked to the pHT315 shuttle vector (43) using homologous recombination. The recombinant pHTspoVS1 plasmid was then transformed into HD(ΔspoVS1) and HD(ΔspoVS2) to generate the recombinant strains HD(ΔspoVS1ΩspoVS1) and HD(ΔspoVS2ΩspoVS1). A 940-bp fragment containing the spoVS2 promoter and ORF(RS12225) was amplified using PCR with B. thuringiensis HD73 genomic DNA as the template and spoVS2-F and spoVS2-R as primers. The fragment was linked to the pHT315 shuttle vector (43) using homologous recombination. The recombinant pHTspoVS2 plasmid was then transformed into HD(ΔspoVS2) and HD(ΔspoVS1) to generate the recombinant strains HD(ΔspoVS2ΩspoVS2) and HD(ΔspoVS1ΩspoVS2). SigH protein with a His tag was purified from E. coli. The expression plasmid pETsigH was constructed with PCR amplification of the sigH gene from the B. thuringiensis HD73 genome using the primer pair sigH-F (with a BamHI restriction site) and sigH-R (with a SalI restriction site). The DNA fragment was digested with BamHI and SalI, cloned into plasmid pET21b (Novagen, Bloemfontein, South Africa), digested with the same restriction enzymes, and then transferred into E. coli BL21(DE3). To explore the activities of the spoIIE, pro-sigE, and pro-sigK promoters in the spoVS series mutants, a vector containing P-lacZ, P--lacZ, or P-lacZ (44) was transformed into the B. thuringiensis wild-type HD73, HD(ΔspoVS1), HD(ΔspoVS2), and HD(ΔspoVS1ΔspoVS2) strains.

Total RNA extraction and RT-PCR analysis.

Total RNA was extracted from B. thuringiensis HD73 cells cultured in SSM medium and harvested at T5. Reverse transcription-PCR (RT-PCR) identification was performed as described previously (21).

Determination of transcriptional start sites.

To determine the transcriptional start sites, we employed the SMARTer RACE cDNA amplification kit (Clontech, Mountain View, CA), following the manufacturer’s instructions (35). Gene-specific primers spoVS1RACE-R and spoVS2RACE-R and universal primer mix (UPM) were used to amplify the 5′ ends of spoVS1 and spoVS2 mRNAs.

β-Galactosidase assays.

B. thuringiensis strains containing lacZ transcriptional fusions were cultured in SSM medium at 30°C. As the total number of cells gradually increased during the growth of the strain, the sampling volumes were varied by time point (T0 is the end of the exponential phase, T− is n hours before the end of the exponential phase, and T is n hours after the end of the exponential phase) as follows: 8 ml during the T−2 period, 4 ml during the T−1 period, and 2 ml from the T0 to T8 period. The cells were harvested and the specific β-galactosidase activities of the samples, expressed as Miller units per milligram of protein, were measured as previously described. The results reported are the mean values from at least three independent trials (45).

Expression and purification of SigH protein.

The E. coli BL21 strain containing pETsigH was grown at 37°C in LB medium supplemented with ampicillin to an optical density at 600 nm (OD600) of 0.7. Expression of the SigH-His protein was induced by adding IPTG (isopropyl-β-d-thiogalactopyranoside) to a final concentration of 0.5 mM, and the cultures were incubated for 12 h at 18°C and 150 rpm. The cells were harvested using centrifugation at 13,500 × g for 5 min in 50-ml tubes and then resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0, 0.5 M NaCl). Bacteria were lysed on ice using sonication with an ultrasonic cell disruption system. The bacterial lysate was centrifuged at 16,000 × g for 10 min at 4°C, with the supernatant containing the solubilized SigH-His protein. The supernatant was filtered through a 0.45-μm membrane filter (Nalgene) and loaded onto a Ni-Sepharose 6 fast-flow column (4 ml) (Pharmacia) previously equilibrated with equilibrium buffer (20 mM Tris-HCl, pH 8.5, 0.5 M NaCl, 50 mM imidazole). The resin with bound protein was washed with five column volumes of equilibrium buffer, and then the target SigH-His protein was eluted with elution buffer (20 mM Tris-HCl, pH 8.5, 0.5 M NaCl, 250 mM imidazole) and collected. Purity was checked using SDS-PAGE followed by Coomassie blue staining. Fractions containing SigH-His protein were desalted using a desalination column and 20 mM Tris-HCl, pH 8.0. The method followed the instructions for the ÄKTA avant 25 protein purification system (46).

EMSAs.

Using B. thuringiensis HD73 genomic DNA as the template, the DNA fragment with the promoter sequence containing binding sites was amplified using primers marked with FAM (6-carboxyfluorescein) (Table 5). The binding of DNA fragments to protein was determined using electrophoretic mobility shift assays (EMSAs). The 20-μl reaction mixtures contained 0.02 μg or 0.015 μg FAM-labeled DNA, different concentrations of SigH-His protein, binding buffer [10 mM Tris-HCl, pH 7.5, 0.5 mM dithiothreitol (DTT), 50 mM NaCl, 500 ng poly(dI:dC), and 4% glycerol] and was reacted at 25°C for 20 min. The reaction products were detected using electrophoresis in 0.5× Tris-borate-EDTA (TBE) buffer with 5% nondenatured polyacrylamide gel and scanned with a gel imaging system (FLA Imager FLA-5100; Fujifilm).

Optical microscopy observation.

The HD73, HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS2), and HD(ΔspoVS2ΩspoVS1) strains were cultured in 100 ml SSM medium at 30°C. Samples were collected at designated time points (T24, T28, T32, T48, and T72). Cell samples were analyzed with optical microscopy (BX61; Olympus, Tokyo, Japan). Detailed methods were as previously described (44).

Confocal laser scanning microscopy.

The vital membrane dye FM 4-64 (Molecular Probes, Inc., Eugene, OR, USA) or MitoTracker green FM (ThermoFisher, USA) was dissolved in dimethyl sulfoxide (35). To assess polar septa and engulfment, 1-ml amounts of cells cultured to a designated time point in SSM medium were pelleted and resuspended in 0.02 to 0.05 ml H2O. Aliquots (2 μl) of the cell suspensions were placed on slides, stained with FM 4-64 (100 μM) and MitoTracker green FM (MTG; 100 nM) for 1 min (47), and then scanned with a confocal laser scanning microscope (Leica TCS SL; Leica Microsystems, Wetzlar, Germany) (24). Each strain was scanned independently at least three times, and each scan was then viewed in at least five fields. The rate of polar septum formation or incomplete engulfment was defined as the ratio of the number of cells with polar septa (stained with FM 4-64 in the mother cell) or incompletely engulfed cells (stained with MTG) to the total number of cells. The results given are the mean values from at least three independent replicates.

Sporulation efficiency and quantification of Cry1Ac protein production.

Cells were cultured in a conical flask containing 100 ml of SSM medium at 30°C. One-milliliter samples were taken at T24, and the total quantities of cells determined. Cell suspensions were heated to 65°C for 20 min to eliminate vegetative cells and then plated onto LB agar medium. The total cell number was defined as the number of colonies at T24. The spore number was defined as the number of colonies after heat treatment. The sporulation efficiency was defined as the ratio of spore number to total cell number (35). The HD73, HD(ΔspoVS1), HD(ΔspoVS2), HD(ΔspoVS1ΔspoVS2), HD(ΔspoVS1ΩspoVS1), HD(ΔspoVS2ΩspoVS2), HD(ΔspoVS1ΩspoVS2), and HD(ΔspoVS2ΩspoVS1) strains were grown in SSM medium at 30°C. Cell samples were harvested at T24, followed by freeze drying until the pellets became lyophilized powders. The same quantities of freeze-dried powder of different strains were dissolved in equal volumes of double-distilled water. Bacterial suspension was disrupted by using a BeadBeater (Biospec Products, Inc., Bartlesville, OK, USA) to make sure all the cells were completely lysed. Twenty-microliter amounts of cell lysates were mixed with 5 μl of 5× loading buffer and boiled for 15 min. Total protein quantitation analyses were performed as previously described (37).
  48 in total

1.  Isolation and characterization of a clone of the spoVE locus of Bacillus subtilis.

Authors:  P J Piggot; K F Chak; U D Bugaichuk
Journal:  J Gen Microbiol       Date:  1986-07

Review 2.  The Bacillus cereus Group: Bacillus Species with Pathogenic Potential.

Authors:  Monika Ehling-Schulz; Didier Lereclus; Theresa M Koehler
Journal:  Microbiol Spectr       Date:  2019-05

3.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

4.  A strong promoter of a non-cry gene directs expression of the cry1Ac gene in Bacillus thuringiensis.

Authors:  Xin Zhang; Tantan Gao; Qi Peng; Lai Song; Jie Zhang; Yunrong Chai; Dongmei Sun; Fuping Song
Journal:  Appl Microbiol Biotechnol       Date:  2018-03-08       Impact factor: 4.813

Review 5.  Bacillus thuringiensis: A story of a successful bioinsecticide.

Authors:  Alejandra Bravo; Supaporn Likitvivatanavong; Sarjeet S Gill; Mario Soberón
Journal:  Insect Biochem Mol Biol       Date:  2011-03-02       Impact factor: 4.714

6.  Characterization of a new sigma-K-dependent peptidoglycan hydrolase gene that plays a role in Bacillus subtilis mother cell lysis.

Authors:  F A Nugroho; H Yamamoto; Y Kobayashi; J Sekiguchi
Journal:  J Bacteriol       Date:  1999-10       Impact factor: 3.490

Review 7.  From soil to gut: Bacillus cereus and its food poisoning toxins.

Authors:  Lotte P Stenfors Arnesen; Annette Fagerlund; Per Einar Granum
Journal:  FEMS Microbiol Rev       Date:  2008-04-15       Impact factor: 16.408

8.  Expression in Bacillus subtilis of the Bacillus thuringiensis cryIIIA toxin gene is not dependent on a sporulation-specific sigma factor and is increased in a spo0A mutant.

Authors:  H Agaisse; D Lereclus
Journal:  J Bacteriol       Date:  1994-08       Impact factor: 3.490

9.  Transcription of the lysine-2,3-aminomutase gene in the kam locus of Bacillus thuringiensis subsp. kurstaki HD73 is controlled by both σ54 and σK factors.

Authors:  Zhe Zhang; Min Yang; Qi Peng; Guannan Wang; Qingyun Zheng; Jie Zhang; Fuping Song
Journal:  J Bacteriol       Date:  2014-06-09       Impact factor: 3.490

10.  Sequence analysis of GerM and SpoVS, uncharacterized bacterial 'sporulation' proteins with widespread phylogenetic distribution.

Authors:  Daniel J Rigden; Michael Y Galperin
Journal:  Bioinformatics       Date:  2008-06-17       Impact factor: 6.937

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.