Literature DB >> 34612666

Culturable Fungi from Urban Soils in China I: Description of 10 New Taxa.

Zhi-Yuan Zhang1, Qiu-Yu Shao1, Xin Li1, Wan-Hao Chen2, Jian-Dong Liang2, Yan-Feng Han1, Jian-Zhong Huang3, Zong-Qi Liang1.   

Abstract

An investigation of members of the soil keratinophilic fungi community in China resulted in the identification of one new monotypic genus, Zongqia, and 10 new species, 2 of which are affiliated with Solomyces, 1 with the new genus Zongqia, 4 with Pseudogymnoascus, and 3 with Scedosporium. These novel taxa form an independent lineage distinct from other species, based on morphological and multilocus phylogenetic analyses. Descriptions, illustrations, and notes are provided for each taxon. These new taxa of the soil keratinophilic fungi add to the increasing number of fungi known from China, and it is now evident that numerous novel taxa are waiting to be described. IMPORTANCE Keratinophilic fungi are a group that can degrade and utilize keratin-rich material. It is also because of this ability that many taxa can cause infections in animals or humans but remain poorly studied. In this study, we reported a novel genus and 10 novel species, 7 novel species belonging to the order Thelebolales and 3 to the genus Scedosporium, based on multilocus phylogenetic analyses combined with morphological characteristics. Our study significantly updates the taxonomy of Thelebolales and Scedosporium and enhances our understanding of this group of the keratin-degrading fungal community. The findings also encourage future studies on the artificially constructed keratin-degrading microbial consortia.

Entities:  

Keywords:  Thelebolales; Zongqia; hair baiting technique; keratinophilic fungi; new taxa; soil fungi

Mesh:

Substances:

Year:  2021        PMID: 34612666      PMCID: PMC8510251          DOI: 10.1128/Spectrum.00867-21

Source DB:  PubMed          Journal:  Microbiol Spectr        ISSN: 2165-0497


INTRODUCTION

Soil microbes are the richest component of terrestrial biodiversity, and among them, soil fungi play a major role in the ecosystem processes. To date, many studies have explored fungi in ocean, caves, forests (especially pristine rainforests), extreme environments, volcanoes, mountains, deserts, freshwater aquatic systems, lakes, grasslands, indoor environments, and many other habitats (1), and they have found that fungi in different habitats have very high species diversity. At the same time, many new fungal taxa have been reported, and they have shown potential high value in the industries of agriculture and medicine. However, as global urbanization continues to expand (2, 3), urban soil fungi, which are closely related to human health, have not been systematically investigated although they are a focal area for ecological and environmental issues. China has diverse urban soil types, diverse habitats, rapid urbanization, and high population mobility. Investigating the diversity of soil fungi in different cities in China will provide scientific data for understanding their ecological functions and maintaining public health safety and will enable the isolation of many new resources with potential applications. The enrichment culture method using different substrates can often screen for the specific fungal consortium, so this method is often used for the isolation of fungal taxa with specific physiological functions. The distribution of keratinophilic fungi, as a special fungal consortium that can degrade and utilize keratin-rich materials, is greatly influenced by the activities of humans and animals, and the presence of such fungus is high in areas where humans and animals are frequently active, especially in urban parks, hospitals, and school campuses (4–7). According to the habitat, keratinophilic fungi can be broadly classified into three eco-types, anthropophilic, zoophilic, and geophilic species, and are mostly pathogenic or potentially pathogenic fungi. For human health and safety, their distribution should attract the attention of governments and scientists. Keratinophilic fungi have been reported in soils of different habitats in different geographic regions of the world, so the investigation of keratinophilic fungi has epidemiological significance (8). Since the report of the degradable keratin of Onygena equina (9), new taxa of keratinophilic fungi and their applications have been reported. Keratinophilic fungi involve a large number of taxa belonging to several orders, families, and genera, including mainly dermatophytes and some saprophytic fungi, such as some species of Arthrodermataceae and Onygenaceae in the order Onygenales (10) and some members of the genera Geomyces and Pseudogymnoascus in the order Thelebolales (11). In addition, they contain a large number of common taxa, such as some species of the genera Aspergillus, Penicillium, and Trichoderma (12, 13). In the years since we investigated the members of keratin-degrading fungal communities in Chinese soils, several new taxa have been identified and reported (14–22). Here, we introduce one new genus, Zongqia (Thelebolales genera incertae sedis, Thelebolales), and 10 new species, 2 of which are affiliated with Solomyces, 1 with the new genus Zongqia, 4 with Pseudogymnoascus, and 3 with Scedosporium.

RESULTS

In this study, the internal transcribed spacer (ITS) regions of all isolates were sequenced, and all ITS sequences obtained were BLASTn searched in NCBI and assigned to potential genera and species. Then, strains belonging to Thelebolales and Scedosporium were screened and tested for further identification through morphological characterization and phylogenetic analyses.

Molecular phylogeny.

The first concatenated alignment (including Pseudogymnoascus and its related taxa) consisted of 2,806 nucleotides, including inserted gaps (ITS: 430 bp, large subunit ribosomal DNA [LSU]: 790 bp, minichromosomal maintenance protein 7 [MCM7]: 485 bp, RNA polymerase II subunit 2 [RPB2]: 467 bp, and elongation factor 1 alpha [EF1A]: 634 bp). The second concatenated data set (mainly involving the genera of Thelebolales) included 1,208 nucleotides, including inserted gaps (ITS: 433 bp; LSU: 775 bp). The third concatenated matrix (including Scedosporium and its related taxa) contained 964 nucleotides, including inserted gaps (ITS: 544 bp; beta-tubulin [BT2]: 420 bp). The best-fit evolutionary models of ML and BI analyses of each locus are listed in Table 1. The tree topology from both maximum likelihood (ML) and Bayesian interference (BI) analyses was almost identical.
TABLE 1

The best-fit evolutionary models in our phylogenetic analyses

Data setMethodModel
ITS BT2 LSU MCM7 RPB2 EF1A
FirstMLTIM2e + I + G4GTR + F + ITVMe + I + G4K2P + I + G4SYM + R3
BISYM + I + G4TR + F + ISYM + I + G4K2P + I + G4SYM + I + G4
SecondMLSYM + R3TIM + F + I + G4
BISYM + I + G4GTR + F + I + G4
ThirdMLTIM3 + F + R3HKY + F + R2
BIHKY + F + I + G4HKY + F + G4
The best-fit evolutionary models in our phylogenetic analyses In the first phylogenetic tree (Fig. 1), the clades formed by each genus and by undetermined taxa had a high support rate: Pseudogymnoascus (1 posterior probability [PP]/100% bootstrap support [BS]), Solomyces (1 PP/100% BS), undetermined (clade O, 1 PP/100% BS), Geomyces (1 PP/100% BS), Pseudeurotium (1 PP/100% BS), and Zongqia gen. nov. (1 PP/100% BS). Our new species is divided into three genera. Eighteen of our new strains belong to three clades of genus Pseudogymnoascus, five are contained in genus Solomyces, and the remaining four are located within the new genus Zongqia.
FIG 1

Bayesian inference strict consensus tree illustrating the phylogeny of new taxa and related species in Thelebolales based on a five-loci (ITS, LSU, MCM7, RPB2, EF1A) concatenated data set. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap values of >70%. The new taxa and strains are in bold and blue. Clade names follow previous studies (21, 24).

Bayesian inference strict consensus tree illustrating the phylogeny of new taxa and related species in Thelebolales based on a five-loci (ITS, LSU, MCM7, RPB2, EF1A) concatenated data set. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap values of >70%. The new taxa and strains are in bold and blue. Clade names follow previous studies (21, 24). In the second phylogenetic tree (Fig. 2), each genus clusters into a monophyletic clade. The new genus Zongqia forms a well-supported (0.99 PP/98% BS) clade separated from other genera in Thelebolales.
FIG 2

Bayesian inference strict consensus tree illustrating the phylogeny of genera in Thelebolales based on a two-loci (ITS and LSU) concatenated data set. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap values of >70%. The new taxa and strains are in bold and blue.

Bayesian inference strict consensus tree illustrating the phylogeny of genera in Thelebolales based on a two-loci (ITS and LSU) concatenated data set. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap values of >70%. The new taxa and strains are in bold and blue. In the third phylogenetic tree (Fig. 3), the clades formed by each genus had a high support rate: Scedosporium (1 PP/95% BS), Parascedosporium (1 PP/100% BS), Lomentospora (0.99 PP/98% BS), Petriella (1 PP/100% BS), Kernia (1 PP/95% BS), and Lophotrichus (1 PP/100% BS). Our new species is nested in Scedosporium, and our strains are spread into five well-supported main clades, representing the species Scedosporium hunanense sp. nov. (0.92 PP/99% BS), Scedosporium apiospermum (1 PP/100% BS), Scedosporium hainanense sp. nov. (0.88 PP/99% BS), Scedosporium aurantiacum (1 PP/90% BS), and Scedosporium haikouense sp. nov. (1 PP/100% BS), except for CGMCC3.20466, which is associated with the species Scedosporium boydii and Scedosporium ellipsoideum.
FIG 3

Phylogeny of Scedosporium and related species generated by BI analyses based on combined two-loci (ITS and BT2) sequences. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap of >70%, respectively. New species and strains are indicated in bold and blue.

Phylogeny of Scedosporium and related species generated by BI analyses based on combined two-loci (ITS and BT2) sequences. Branches are labeled with Bayesian posterior probabilities of >0.70 and maximum likelihood bootstrap of >70%, respectively. New species and strains are indicated in bold and blue.

TAXONOMY

Pseudogymnoascus catenatus Zhang, Han, and Liang, sp. nov. (Fig. 4). MycoBank number: MB 840436. Etymology: referring to the catenation of its intercalary conidia. Diagnosis: similar to Pseudogymnoascus verrucosus but differs in obovoid conidia and intercalary conidia. Type: China, Fujian Province, Wuyishan City, Lie Ning Park, 27.758010N, 118.034403E, isolated from green belt soil, 18 August 2019, Z.Y. Zhang. (Holotype HMAS 350322, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20472 = GZUIFR 21.815, ibid., GZUIFR 21.816.) GenBank: MZ444080, MZ444081 (ITS); MZ444107, MZ444108 (LSU); MZ490762, MZ490763 (MCM7); MZ488545, MZ488546 (RPB2); MZ488522, MZ488523 (translation elongation factor [TEF]).
FIG 4

Pseudogymnoascus catenatus (from ex-holotype CGMCC 3.20472). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C, E, G, I, J) intercalary conidia; (D, H, K to N) conidiophores and conidia; (F) arthroconidia. Scale bars (C to N), 10 μm.

Pseudogymnoascus catenatus (from ex-holotype CGMCC 3.20472). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C, E, G, I, J) intercalary conidia; (D, H, K to N) conidiophores and conidia; (F) arthroconidia. Scale bars (C to N), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on peptone-dextrose agar (PDA) slowly growing, attaining 6 to 10 mm diameter after 14 days at 25°C, velvety, short and fluffy, margins irregular, light gray to white, absent pigment and exudates; reverse brown. No growth at 37°C. Hyphae hyaline, branched, septate, smooth, 1 to 3 μm wide. Racquet hyphae absent. Conidiophores abundant, frequent branches, at acute angles, often 1 to 2 verticillate with 1 to 4 branches per whorl, secondary and tertiary branches can still branch again. Conidia abundant, normally borne terminally on verticillate branches or borne laterally and solitary on short protrusions or short side branches; subhyaline to hyaline, smooth-walled or rough; obovoid, sometimes subglobose, 3.0 to 6.0 by 3.0 to 4.0 μm (n = 50). Intercalary conidia are borne on the verticillate hyphae or hyphae, solitary or 1 to 6 in chains, smooth-walled or rough, obovoid, subglobose, fusiform, drum-shaped, truncated at both ends, 3.5 to 6.5 by 3.0 to 4.5 μm (n = 50), cylindrical, barrel-shaped, truncated at both ends, 5.5 to 6.5 by 2.5 to 3.5 μm (n = 50). Arthroconidia hyaline, cylindrical, sometimes obovoid, 3.0 to 6.0 by 2.0 to 3.5 μm (n = 50). Substrate: soil. Distribution: Wuyishan City, Fujian Province; Ningbo City, Zhejiang Province, China. Material examined: China, Zhejiang Province, Ningbo City, Moon Lake, 29.870001N, 121.544021E, isolated from green belt soil, 16 August 2019, Z.Y. Zhang, GZUIFR 21.813, ibid., GZUIFR 21.814. GenBank: MZ444078, MZ444079 (ITS); MZ444105, MZ444106 (LSU); MZ490760, MZ490761 (MCM7); MZ488543, MZ488544 (RPB2); MZ488520, MZ488521 (TEF). Notes. Morphologically, Pseudogymnoascus catenatus is similar to P. verrucosus in having arthroconidia but is clearly distinguished by the obovoid conidia and intercalary conidia (23). Phylogenetically, four isolates of P. catenatus formed a single clade separate from other species in Pseudogymnoascus (Fig. 1), which indicates that they are distinct species. Pseudogymnoascus fujianensis Zhang, Han, and Liang, sp. nov. (Fig. 5). MycoBank number: MB 840437. Etymology: refers to the region from which the fungus was isolated. Diagnosis: similar to P. verrucosus, Pseudogymnoascus roseu, and Pseudogymnoascus destructans but differs in the presence of intercalary conidia and the absence of arthroconidia. Type: China, Fujian Province, Wuyishan City, Lie Ning Park, 27.758545N, 118.034134E, isolated from green belt soil, 18 August 2019, Z.Y. Zhang. (Holotype HMAS 350324, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20474 = GZUIFR 21.819, ibid., GZUIFR 21.820.) GenBank: MZ444084, MZ444085 (ITS); MZ444111, MZ444112 (LSU); MZ490766, MZ490767 (MCM7); MZ488549, MZ488550 (RPB2); MZ488526, MZ488527 (TEF).
FIG 5

Pseudogymnoascus fujianensis (from ex-holotype CGMCC 3.20474). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) conidiophores, conidia, and intercalary conidia. Scale bars (C to M), 10 μm.

Pseudogymnoascus fujianensis (from ex-holotype CGMCC 3.20474). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) conidiophores, conidia, and intercalary conidia. Scale bars (C to M), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 19 to 20 mm diameter after 14 days at 25°C, flat, flocculent, sectorization, margin identified, white to pink, absent pigment and exudates; reverse brown. No growth at 37°C. Hyphae hyaline, branched, septate, smooth-walled, 0.5 to 3.5 μm wide. Racquet hyphae absent. Conidiophores abundant, branches, at acute angles, irregular, acyclic arrangement. Conidia abundant, mostly terminal or lateral, sessile or borne on hyphae, short protrusions or side branches; solitary, fasciation, or 2 in chains; hyaline, smooth-walled; obovoid, 2.5 to 5.5 by 2.5 to 4.0 μm (n = 50). Intercalary conidia abundant, normally chained with terminal conidia; solitary, smooth-walled or rough; obovoid, sometimes drum-shaped, 2.5 to 5.0 by 2.5 to 3.5 μm (n = 50). Substrate: soil. Distribution: Wuyishan City, Fujian Province, China. Material examined: China, Fujian Province, Wuyishan City, Wuyi University, 27.728722N, 118.002862E, isolated from green belt soil, 18 August 2019, Z.Y. Zhang, GZUIFR 21.821, ibid., GZUIFR 21.822. GenBank: MZ444086, MZ444087 (ITS); MZ444113, MZ444114 (LSU); MZ490768, MZ490769 (MCM7); MZ488551, MZ488552 (RPB2); MZ488528, MZ488529 (TEF). Notes. Morphological and phylogenetic analyses (Fig. 1) support our four strains as new species of Pseudogymnoascus fujianensis. P. fujianensis is phylogenetically closely related to P. verrucosus, P. roseu, and P. destructans. However, P. fujianensis is distinguished from other species of Pseudogymnoascus by the presence of intercalary conidia and the absence of arthroconidia (23–26). Pseudogymnoascus yunnanensis Zhang, Han, and Liang, sp. nov. (Fig. 6). MycoBank number: MB 840438. Etymology: refers to the region from which the fungus was isolated. Diagnosis: similar to Pseudogymnoas lindneri, Pseudogymnoas turneri, and Pseudogymnoas guizhouensis but differs in the clavate, fusiform with basal scars terminal conidia, and reniform, fusiform, truncated at both ends of intercalary conidia. Type: China, Yunnan Province, Dali City, Dali Bai Autonomous Prefecture People’s Hospital, 25.578478N, 100.222121E, isolated from green belt soil, 3 September 2019, Z.Y. Zhang. (Holotype HMAS 350320, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20475 = GZUIFR 21.807, ibid., GZUIFR 21.808.) GenBank: MZ444072, MZ444073 (ITS); MZ444099, MZ444100 (LSU); MZ490754, MZ490755 (MCM7); MZ488537, MZ488538 (RPB2); MZ488514, MZ488515 (TEF).
FIG 6

Pseudogymnoascus yunnanensis (from ex-holotype CGMCC 3.20475). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to L) conidiophores and conidia; (M to N) conidia. Scale bars (C to N), 10 μm.

Pseudogymnoascus yunnanensis (from ex-holotype CGMCC 3.20475). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to L) conidiophores and conidia; (M to N) conidia. Scale bars (C to N), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 23 to 25 mm diameter after 14 days at 25°C, velvety, powdery, margin identified, locally indented, pink, white at the edge, absent pigment and exudates; reverse brown. No growth at 37°C. Hyphae hyaline, branched, septate, smooth-walled, 1 to 3 μm wide. Racquet hyphae absent. Conidiophores abundant, frequent branches, at acute angles, often 2 to 3 verticillate with 1 to 4 branches per whorl, secondary and tertiary branches can still branch again. Conidia abundant, normally borne terminally on verticillate branches, or borne laterally and solitary on short protrusions or short side branches; subhyaline to hyaline, smooth-walled or echinulate; obovoid, subglobose to globose, sometimes pyriform, 2.5 to 4.5 by 2.5 to 3.5 μm (n = 50); sometimes terminal conidia clavate, fusiform with basal scars, 6.5 to 9.0 by 2.5 to 4.5 μm (n = 50). Intercalary conidia are borne on the outer branches of the hyphae or verticillate hyphae, solitary or two in chains, smooth-walled or rough, reniform and fusiform truncate at both ends, 2.5 to 5.5 by 2.5 to 4.0 μm (n = 50). Substrate: soil. Distribution: Dali City, Yunnan Province, China. Material examined: China, Yunnan Province, Dali City, Dali University, 25.674141N, 100.154757E, isolated from green belt soil, 2 September 2019, Z.Y. Zhang, GZUIFR 21.809. GenBank: MZ444074 (ITS); MZ444101 (LSU); MZ490756 (MCM7); MZ488539 (RPB2); MZ488516 (TEF). Notes. Morphologically, Pseudogymnoascus yunnanensis is similar to P. lindneri, P. turneri, and P. guizhouensis in having obovoid, globose conidia (27). However, P. yunnanensis can be distinguished from P. lindneri and P. turneri by the presence of its clavate, fusiform with basal scars terminal conidia and no observed sexual morph. P. yunnanensis differs from P. guizhouensis because it is reniform, fusiform, and truncated at both ends of intercalary conidia (22). Phylogenetically, three isolates of P. yunnanensis constitute a strongly supported subclade, sister to P. guizhouensis with high support values (Fig. 1), but they can be easily distinguished. Pseudogymnoascus zhejiangensis Zhang, Han, and Liang, sp. nov. (Fig. 7). MycoBank number: MB 840439. Etymology: refers to the region from which the fungus was isolated. Diagnosis: similar to P. lindneri, P. turneri, and P. yunnanensis but differs in the obovoid, subglobose intercalary conidia. Type: China, Zhejiang Province, Ningbo City, Moon Lake, 29.871117N, 121.544218E, isolated from green belt soil, 16 August 2019, Z.Y. Zhang. (Holotype HMAS 350321, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20476 = GZUIFR 21.810, ibid., GZUIFR 21.811; ibid., GZUIFR 21.812.) GenBank: MZ444075, MZ444076, MZ444077 (ITS); MZ444102, MZ444103, MZ444104 (LSU); MZ490757, MZ490758, MZ490759 (MCM7); MZ488540, MZ488541, MZ488542 (RPB2); MZ488517, MZ488518, MZ488519 (TEF).
FIG 7

Pseudogymnoascus zhejiangensis (from ex-holotype CGMCC 3.20476). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) conidiophores, conidia, and intercalary conidia. Scale bars (C to M), 10 μm.

Pseudogymnoascus zhejiangensis (from ex-holotype CGMCC 3.20476). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) conidiophores, conidia, and intercalary conidia. Scale bars (C to M), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 20 mm diameter after 14 days at 25°C, gradually increased from the edge to the center, velvety, floccose, margin entire, white, absent pigment and exudates; reverse pink, white at the edge. No growth at 37°C. Hyphae hyaline, branched, septate, smooth, 1 to 3 μm wide. Racquet hyphae absent. Conidiophores abundant, frequent branches, at acute angles, often 1 to 4 verticillate with 1 to 4 branches per whorl, secondary and tertiary branches can still branch again. Conidia abundant, normally borne terminally on verticillate branches or borne laterally and solitary on short protrusions or short side branches; subhyaline to hyaline, smooth-walled or rough; obovoid to globose, 2.5 to 4.5 by 2.5 to 4.0 μm (n = 50); clavate, long obovoid, 5 to 9 by 2.5 to 4 μm (n = 50). Intercalary conidia are borne on the verticillate hyphae or hyphae, solitary, smooth-walled or rough, obovoid, subglobose to globose, 3.5 to 4.5 by 3.0 to 4.0 μm (n = 50). Substrate: Soil. Distribution: Ningbo City, Zhejiang Province, China. Notes. Morphologically, Pseudogymnoascus zhejiangensis resembles P. lindneri, P. turneri, and P. yunnanensis because of the obovoid, globose conidia. However, P. zhejiangensis differs from P. lindneri, P. turneri, and P. yunnanensis in that it has obovoid, subglobose intercalary conidia (the intercalary conidia of P. linderi and P. turneri are globose to truncate, and those of P. yunnanensis are reniform, fusiform, and truncated at both ends) (27). Phylogenetically, three isolates of P. zhejiangensis formed one clade and share a sister relationship to three undescribed isolates (12NJ13, 17WV06, and 22984-1-I1) with high BS (Fig. 1). However, we did not compare morphological characteristics between P. zhejiangensis and another three isolates within Pseudogymnoascus because of the lack of morphological description of these three isolates (24). Solomyces guizhouensis Zhang, Han, and Liang, sp. nov. (Fig. 8). MycoBank number: MB 840440. Etymology: refers to Guizhou, the province where the isolate was collected. Diagnosis: Solomyces guizhouensis differs from other species by the presence of 2 to 3 conidia in chains and 2 to 3 intercalary conidia in chains. Type: China, Guizhou Province, Anshun City, Anshun University, 26.244748N, 105.898997E, isolated from green belt soil, 5 September 2019, Z.Y. Zhang. (Holotype HMAS 350319, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20477 = GZUIFR 21.804.) GenBank: MZ444069 (ITS); MZ444096 (LSU); MZ490751 (MCM7); MZ488534 (RPB2); MZ488511 (TEF).
FIG 8

Solomyces guizhouensis (from ex-holotype CGMCC 3.20477). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) terminal, lateral conidia, and intercalary conidia. Scale bars (C to M), 10 μm.

Solomyces guizhouensis (from ex-holotype CGMCC 3.20477). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to M) terminal, lateral conidia, and intercalary conidia. Scale bars (C to M), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA, reaching 16 to 17 mm diameter after 14 days at 25°C, floccose, margins regular, white, absent pigment and exudates; reverse white. No growth at 37°C. Hyphae abundant, smooth and thin-walled, septate, 1.5 to 3.0 μm wide. Conidia terminal and laterally borne on hyphae, short protrusions, or side branches; solitary, sometimes 2 to 3 in chains, hyaline, smooth or rough walled, obovoid, subglobose to globose, pyriform, 4.0 to 7.0 by 4.0 to 6.0 μm (n = 50). Intercalary conidia abundant, solitary or 2 to 3 in chains, hyaline, smooth or rough walled, olivary, subglobose to globose, 4.5 to 8.5 by 3.5 to 5.0 μm (n = 50). Lateral branches may emerge from intercalary conidia. Substrate: soil. Distribution: Anshun City, Guizhou Province, China. Material examined: China, Guizhou Province, Anshun City, People’s Hospital of Anshun City Guizhou Province, 26.247091N, 105.967968E, isolated from green belt soil, 5 September 2019, Z.Y. Zhang, GZUIFR 21.805, ibid., GZUIFR 21.806. GenBank: MZ444070, MZ444071 (ITS); MZ444097, MZ444098 (LSU); MZ490752, MZ490753 (MCM7); MZ488535, MZ488536 (RPB2); MZ488512, MZ488513 (TEF). Notes. Morphologically, Solomyces guizhouensis is distinguished from other species of Solomyces by the presence of 2 to 3 conidia in chains and 2 to 3 intercalary conidia in chains. Solomyces guizhouensis is phylogenetically allied to Solomyces ramosus (Fig. 1), but they can be easily distinguished (see notes on S. ramosus [22]). Solomyces ramosus Zhang, Han, and Liang, sp. nov. (Fig. 9). MycoBank number: MB 840442. Etymology: referring to the ramose of its conidiophore. Diagnosis: Solomyces ramosus differ from other species by the presence of ramose conidiophores. Type: China, Shanghai City, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, 31.212090N, 121.467721E, isolated from green belt soil, 15 August 2019, Z.Y. Zhang. (Holotype HMAS 350323, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20478 = GZUIFR 21.817, ibid., GZUIFR 21.818.) GenBank: MZ444082, MZ444083 (ITS); MZ444109, MZ444110 (LSU); MZ490764, MZ490765 (MCM7); MZ488547, MZ488548 (RPB2); MZ488524, MZ488525 (TEF).
FIG 9

Solomyces ramosus (from ex-holotype CGMCC 3.20478). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to H) terminal, lateral conidia, and intercalary conidia; (I and J) ramose of conidiophore; (K) conidia. Scale bars (C to K), 10 μm.

Solomyces ramosus (from ex-holotype CGMCC 3.20478). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to H) terminal, lateral conidia, and intercalary conidia; (I and J) ramose of conidiophore; (K) conidia. Scale bars (C to K), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA reaching 17 mm diameter after 14 days at 25°C, slightly felty to floccose, margin identified, white; reverse white; absent pigment and exudates. No growth at 37°C. Hyphae abundant, smooth, hyaline, branched, septate, 1.0 to 3.5 μm wide. Conidiophores abundant, branches, at acute angles, 1 to 2 verticillate with 1 to 4 branches per whorl. Conidia terminal and laterally borne on hyphae, short protrusions, or side branches, solitary, hyaline, obovoid, subglobose, smooth or rough walled, 5 to 8.5 by 4.0 to 5.5 μm (n = 50). Intercalary conidia abundant, globose, olivary, subglobose to globose, 3.5 to 6.5 by 3.5 to 5.0 μm (n = 50). Substrate: soil. Distribution: Shanghai City, China. Notes. Morphologically, Solomyces ramosus is distinguished from other species of Solomyces by the presence of ramose conidiophores (22). Phylogenetically, our two new isolates of S. ramosus formed one clade and share a sister relationship to S. guizhouensis with high BS (Fig. 1), which indicates that they are distinct species. Zongqia Zhang and Han, gen. nov. MycoBank number: MB 840447. Typification: Zongqia sinensis Zhang and Han. Etymology: in honor of Zong-Qi Liang, acknowledging his contributions to our group. Diagnosis: in addition to the phylogenetic distinctions (Fig. 1 to 2), Zongqia differs from Pseudeurotium by the presence of chains of conidia, conidiophores degenerated into conidiophore cells, clavate conidiophores cells. Description. Saprobic on the soil. Sexual morph: not observed. Asexual morph: hyphae branched, septate, smooth. Conidiophores not observed and were degenerated into conidiophore cells. Conidiophores cells hyaline, cylindrical, clavate, occurring directly from the hyphae, smooth-walled, solitary. Conidia aseptate, smooth-walled, one-celled, solitary or chains, obovate, subglobose, fusiform, cylindrical, clavate. Chlamydospores not observed. Notes. The new genus Zongqia is introduced here based on phylogeny and morphological evidence. Until now, the Thelebolales consisted of 23 genera (22, 28). In five-loci (ITS, LSU, MCM7, RPB2, and EF1A; Fig. 1) and two-loci (ITS and LSU; Fig. 2) phylogenetic analyses, Zongqia was related to Pseudeurotium with high support values (1 PP/100% BS). However, because no ITS, LSU, MCM7, RPB2, and EF1A sequence data were reported for Ascophanus, Ascozonus, Caccobius, Coprobolus, Leptokalpion, Neelakesa, and Pseudascozonus (22), we could not compare the phylogenetic relationships between these genera and Zongqia. Morphologically, because there is no record of the asexual stage of Ascophanus, Ascozonus, Caccobius, Coprobolus, Leptokalpion, Neelakesa, and Pseudascozonus in the literature (29), we could not compare the morphology between these genera and Zongqia. Of the remaining genera, Zongqia is similar to Pseudeurotium, but there are still noteworthy differences between them. Zongqia is distinguished from Pseudeurotium by the presence of chains of conidia, conidiophores degenerated into conidiophore cells, clavate conidiophores cells, and no observed sexual morph. Zongqia sinensis Zhang and Han, sp. nov. (Fig. 10). MycoBank number: MB 840448. Etymology: named after China where the species is distributed. Diagnosis: the main diagnostic criteria of the species Zongqia sinensis are presence of chains of conidia, conidiophores degenerated into conidiophore cells, clavate conidiophores cells. Type: China, Guizhou Province, Guiyang, The Affiliated Hospital of Guizhou Medical University, 26.594218N, 106.713166E, isolated from green belt soil, 13 September 2019, Z.Y. Zhang. (Holotype HMAS 350325, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20471 = GZUIFR 21.823, ibid., GZUIFR 21.824.) GenBank: MZ444088, MZ444089 (ITS); MZ444115, MZ444116 (LSU); MZ490770, MZ490771 (MCM7); MZ488553, MZ488554 (RPB2).
FIG 10

Zongqia sinensis (from ex-holotype CGMCC 3.20471). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to E, H, I, L, M) conidia chains; (F) conidia borne on hyphae; (G) differentiation of conidiophore cells; (J) two conidia on the apex of conidiophore cells; (K) degenerated conidiophores; (N to P) solitary conidia. Scale bars (C to P), 10 μm.

Zongqia sinensis (from ex-holotype CGMCC 3.20471). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to E, H, I, L, M) conidia chains; (F) conidia borne on hyphae; (G) differentiation of conidiophore cells; (J) two conidia on the apex of conidiophore cells; (K) degenerated conidiophores; (N to P) solitary conidia. Scale bars (C to P), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies grow slowly on PDA, reaching 11 to 13 mm diameter after 14 days at 25°C, suborbicular, white, floccose, margins regular; reverse white, no growth at 37°C. Hyphae hyaline, branched, septate, smooth, 1.5 to 3.5 μm wide. Conidiophores not observed but degenerated into conidiophore cells. Conidiophore cells hyaline, cylindrical, clavate, arising directly from the aerial hyphae, smooth-walled, solitary. Conidia aseptate, smooth-walled, one-celled, solitary, obovate to subobovoid, 5 to 9 by 3 to 5 μm (n = 50); or 2 to 20 in chains, obovate, subglobose, fusiform and obtuse at apex and base, sometimes cylindrical, clavate, 3.5 to 8.5 (to 12) by 2.5 to 4.5 μm (n = 50). Chlamydospores not observed. Substrate: soil. Distribution: Guiyang City, Guizhou Province, China. Material examined: China, Guizhou Province, Guiyang, Guizhou University, 26.444504N, 106.669296E, isolated from green belt soil, 13 September 2019, Z.Y. Zhang, GZUIFR 21.825. GenBank: MZ444090 (ITS); MZ444117 (LSU); MZ490772 (MCM7); MZ488555 (RPB2). Guizhou Province, Guiyang, Qianlingshan Park, 26.592019N, 106.695434E, isolated from green belt soil, 13 September 2019, Z.Y. Zhang, GZUIFR 21.826. GenBank: MZ444091 (ITS); MZ444118 (LSU); MZ490773 (MCM7); MZ488556 (RPB2). Notes. Based on multilocus phylogenetic analyses (Fig. 1 and 2) and similar morphological characteristics, the four strains are regarded as the same species, which cluster together very well and form a single clade separated from other species of Thelebolales. Morphologically, Zongqia sinensis is the only species that produces the conidia chains in this order. Therefore, based on both morphological and phylogenetic evidence, Z. sinensis is proposed as a novel species as a type of Zongqia. Scedosporium haikouense Zhang, Han, and Liang, sp. nov. (Fig. 11). MycoBank number: MB 840443. Etymology: refers to Haikou, the city where the isolate was collected. Diagnosis: the main diagnostic criteria of the species Scedosporium haikouense are abundant ovoid, ellipsoidal, subcylindrical conidia, conidiogenous cells solitary or 2 to 3 fascicled conidia, and absent pigment and exudates and lack of synnemata. Type: China, Hainan Province, Haikou City, Hainan university Haidian Campus, 20.059602N, 110.330436E, isolated from green belt soil, 28 August 2019, Z.Y. Zhang. (Holotype HMAS 350313, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20468 = GZUIFR 21.833, ibid., GZUIFR 21.834.) GenBank: MZ469289, MZ469290 (ITS); MZ488563, MZ488564 (BT2).
FIG 11

Scedosporium haikouense (from ex-holotype CGMCC 3.20468). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to J) conidiogenous cells and conidia. Scale bars (C to J), 10 μm.

Scedosporium haikouense (from ex-holotype CGMCC 3.20468). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to J) conidiogenous cells and conidia. Scale bars (C to J), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 54 to 56 mm diameter after 5 days at 25°C, fluffy, flavescens to white, gray at margins, annular at the center, margin slightly undulate; reverse cream-yellow to black; absent pigment and exudates. Colonies on PDA attaining 68 to 70 mm diameter after 5 days at 37°C. Hyphae hyaline, branched, septate, smooth-walled, 0.5 to 5.5 μm wide. Conidiophores solitary, usually reduced to conidiogenous cells, arising terminally or laterally from hypha, hyaline, smooth-walled, cylindrical, 1.5 to 26.0 by 1.0 to 2.0 μm (n = 50). Conidia are borne on hyphae, short protrusions, or side branches, one-celled, solitary, or 2 to 3 fascicled, pale brown to brown, ovoid, ellipsoidal, subcylindrical and bilaterally compressed, rounded at the ends, 5.0 to 9.0 by 3.0 to 4.5 μm (n = 50). Synnemata not observed. Substrate: soil. Distribution: Haikou City, Hainan Province, China. Notes. Phylogenetically, Scedosporium haikouense is closely related to Scedosporium rarisporum, Scedosporium cereisporum, and S. aurantiacum. However, S. haikouense can be distinguished from S. rarisporum by the presence of abundant ovoid, ellipsoidal, subcylindrical conidia (30), from S. cereisporum by the solitary conidiogenous cells, solitary or 2 to 3 fascicled conidia (31), and from S. aurantiacum by the absent pigment and exudates and lack of synnemata (32). Scedosporium hainanense Zhang, Han, and Liang, sp. nov. (Fig. 12). MycoBank number: MB 840445. Etymology: refers to Hainan, the province where the isolate was collected. Diagnosis: similar to S. apiospermum but differs in the ellipsoidal conidia. Type: China, Hainan Province, Sanya City, Hainan Tropical Ocean University, 18.311670N, 109.534152E, isolated from green belt soil, 26 August 2019, Z.Y. Zhang. (Holotype HMAS 350311, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20469 = GZUIFR 21.829.) GenBank: MZ469285 (ITS); MZ488559 (BT2).
FIG 12

Scedosporium hainanense (from ex-holotype CGMCC 3.20469). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to I) conidiogenous cells and conidia; (J and K) synnematous conidiomata. Scale bars (C to J), 10 μm.

Scedosporium hainanense (from ex-holotype CGMCC 3.20469). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to I) conidiogenous cells and conidia; (J and K) synnematous conidiomata. Scale bars (C to J), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 38 to 43 mm diameter after 5 days at 25°C, cottony, floccose, light gray, margins irregular; reverse peltricolor, white to margins; absent pigment and exudates. Colonies on PDA attaining 64 to 66 mm diameter after 5 days at 37°C. Hyphae hyaline, branched, septate, smooth-walled, 0.5 to 4.5 μm wide. Conidiophores solitary, often consisting of a single conidiogenous cell, or arranged in whorls of 2 to 3 conidiogenous cells, arising terminally or laterally from hypha, undifferentiated hypha, short-stalked, or inside branches. Conidiogenous cells annellidic, hyaline, thin- and smooth-walled, lateral or terminal, cylindrical or slightly broad at the base, sometimes with several annellations at the top with the age, 2.5 to 33.0 by 1.0 to 2.5 μm (n = 50). Conidia are borne on hyphae, short protrusions, or side branches, one-celled, solitary, hyaline, ovoid, 5.0 to 8.0 by 2.5 to 6.0 μm (n = 50), ellipsoidal, 5.5 to 7.0 by 5.0 to 5.5 μm (n = 50). Conidiomata synnematous, erect, consisting of a cylindrical stipe, hyaline, smooth-walled; conidia cylindrical or claviform with a truncated base, 4.5 to 8.5 by 2.5 to 3.5 μm (n = 50). Substrate: soil. Distribution: Sanya and Danzhou City, Hainan Province, China. Material examined: China, Hainan Province, Sanya City, Seaside parks, 18.272349N, 109.479274E, isolated from green belt soil, 26 August 2019, Z.Y. Zhang, GZUIFR 21.828. GenBank: MZ469284 (ITS); MZ488558 (BT2). Hainan Province, Danzhou City, Hainan University Danzhou Campus, 19.508080N, 109.494579E, isolated from green belt soil, 27 August 2019, Z.Y. Zhang, GZUIFR 21.827. GenBank: MZ469283 (ITS); MZ488557 (BT2). Notes. Morphological and phylogenetic data (Fig. 3) support our strains as new species of Scedosporium hainanense. Scedosporium hainanense is phylogenetically closely related to S. apiospermum complex that comprises Scedosporium angustum, S. apiospermum, S. boydii, S. ellipsoideum, and Scedosporium fusarium. However, S. hainanense can be distinguished from S. apiospermum by the ellipsoidal conidia. We did not compare morphological characteristics between S. hainanense and the S. apiospermum complex (S. angustum, S. apiospermum, S. boydii, S. ellipsoideum, and Scedosporium fusarium) because of the lack of asexual morph descriptions of these species (33). Scedosporium multisporum Zhang, Han, and Liang, sp. nov. (Fig. 13). MycoBank number: MB 840446. Etymology: referring to the 2 to 3 fascicled conidia. Diagnosis: similar to S. apiospermum complex but differs in the presence of 2 to 3 fascicled conidia, conidiomata synnematous. Type: China, Hunan Province, Huaihua City, Huaihua University, 27.572703N, 110.023832E, isolated from green belt soil, 12 August 2019, Z.Y. Zhang. (Holotype HMAS 350312, stored in a metabolically inactive state; ex-holotype culture CGMCC 3.20470 = GZUIFR 21.830, ibid., GZUIFR 21.831; ibid., GZUIFR 21.832.) GenBank: MZ469286, MZ469287, MZ469288 (ITS); MZ488560, MZ488561, MZ488562 (BT2).
FIG 13

Scedosporium multisporum (from ex-holotype CGMCC 3.20470). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to G) conidiogenous cells and conidia; (H and I) synnematous conidiomata. Scale bars (C to I), 10 μm.

Scedosporium multisporum (from ex-holotype CGMCC 3.20470). (A, B) Upper and reverse views of culture on PDA 14 days after inoculation; (C to G) conidiogenous cells and conidia; (H and I) synnematous conidiomata. Scale bars (C to I), 10 μm. Description. Sexual morph: not observed. Asexual morph: colonies on PDA attaining 45 to 50 mm diameter after 5 days at 25°C, cottony, powdery at the center; reverse white, light yellow at the center; absent pigment and exudates. Colonies on PDA attaining 70 to 73 mm diameter after 5 days at 37°C. Hyphae hyaline, branched, septate, smooth-walled, 1.0 to 4.0 μm wide. Conidiophores solitary, often consisting of a single conidiogenous cell, or arranged in whorls of 2 to 3 conidiogenous cells, arising terminally or laterally from hypha, undifferentiated hypha, short-stalked, or inside branches. Conidiogenous cells annellidic, hyaline, thin- and smooth-walled, lateral or terminal, cylindrical or slightly broad at the base, sometimes with several annellations at the top with the age, 0.5 to 16.0 by 1.0 to 3.5 μm (n = 50). Conidia are borne on hyphae, short protrusions, or side branches, one-celled, solitary, or 2 to 3 fascicled, hyaline, ovoid to subglobose, 3.0 to 7.5 by 3.0 to 5.0 μm (n = 50). Conidiomata synnematous, erect, consisting of a cylindrical stipe, hyaline, smooth-walled; conidia cylindrical, ovoid, long ovoid with a truncated base, 5.0 to 10.0 by 2.0 to 4.0 μm (n = 50). Substrate: soil. Distribution: Huaihua City, Hunan Province, China. Notes. Scedosporium multisporum is phylogenetically closely related to the S. apiospermum complex that comprises S. angustum, S. apiospermum, S. boydii, S. ellipsoideum, and S. fusarium. However, S. multisporum is distinguished from other species of Scedosporium by the presence of 2 to 3 fascicled conidia, conidiomata synnematous (33). Parascedosporium sanyaense (Han, Zheng, Luo, Wang, and Liang 2017) Zhang, Han, and Liang 2021, comb. nov. MycoBank: MB 818105. Basionym: Scedosporium sanyaense (see reference 30). Description: Y.F. Han, Huan Zheng, Y. Luo, Y.R. Wang, and Z.Q. Liang 2017. Notes. In 2017, Han et al. introduced S. sanyaense to the genus Scedosporium, based on morphological and internal transcribed spacers (ITS) phylogenetic analysis (30). However, in our phylogenetic study, S. sanyaense is placed in the genus Parascedosporium. Therefore, we propose a new combination for that species.

DISCUSSION

The hair baiting technique was first used to isolate keratinophilic fungi from the soil by Vanbreuseghem (34) and has become applied widely. So far, the investigation of such resources is still dominated by traditional isolated cultures and baiting with materials of human or animal origin, such as feathers (35), horsehair (4), wool (36), human hair (37), and human nails (38). Only a small number of studies have used next-generation sequencing technologies (39). Taxonomy and phylogenetic identification of fungi remain significant challenges (40). One of the main fundamental needs in fungal ecology is a strong taxonomic basis, which is dependent on advances in nucleic acid sequence technology. However, some researchers have relied too much on these techniques to the complete exclusion of fungal isolation and characterization using classical methods. While bacterial microbiome studies have relatively reliable taxonomic identification using 16S ribosomal DNA (rDNA) and even metagenome sequencing, mycobiome studies are still few and far between, with limited taxonomic interpretation capabilities. Indeed, phenotypic and culture-based studies remain an invaluable tool for fungal biology and ecology (41). The advantage of placing these organisms in pure culture is, of course, that almost all aspects of their biology can be studied, which may help to understand how they function in their natural ecological context. Thus, many challenges remain in studying the hundreds of niches on Earth that may be inhabited by fungi, not only to demonstrate their presence in these niches but also to culture them in pure form and store them properly for further study (42). The ability of microorganisms to degrade recalcitrant materials has been widely explored for environmental remediation and industrial production. Significant success has been achieved with single strains, but the focus is now on the use of microbial consortia because of their functional stability and efficiency (43). The keratin degradation process requires the synergistic action of different enzymes, such as endoproteases, exoproteases, oligopeptidases, and disulfide reductases (44); thus, this process involves the synergistic cooperation of multiple species. We did not isolate purified fungal strains directly from feathers after enrichment using hair bating but did isolate members of the fungal community from the soil. Therefore, we could not determine whether the obtained strains are keratinophilic fungi and whether they are able to degrade and utilize keratin. However, numerous studies have shown that many members of Thelebolales and Scedosporium are indeed keratinophilic fungi (45–48). Hence, we think that our obtained strains are the keratinophilic fungi and should at least be constituent members of the keratin-degrading fungal consortia, although it is not clear what role they play in this consortium. In this study, 10 new species were identified and introduced, not only contributing to the further understanding of the keratin-degrading fungal community but also accumulating strains for future artificially constructed keratin-degrading microbial consortia.

MATERIALS AND METHODS

Sampling, fungal isolation, and morphology.

Soil samples were collected from Guizhou, Hunan, Zhejiang, Yunnan, Fujian, Hainan, Jiangxi, Guangdong, and Zhejiang provinces in southern China and transported to the laboratory in Ziploc plastic bags. The soil samples were processed using the method we described previously (22). Briefly, clean and sterile chicken feathers were placed in a sterile petri dish after the soil sample was added, wetted with distilled water, and incubated at room temperature for 1 month. Fungi were isolated using a conventional dilution technique based on Sabouraud’s dextrose agar (SDA; 10 g of peptone, 40 g of dextrose, 20 g of agar, 1 liter of ddH2O) supplemented with chloramphenicol and cycloheximide, and the purification of the strains was performed using potato dextrose agar (PDA; Shanghai Bio-way Technology Co., Ltd., China) (20, 22). Colonies on PDA were incubated after 14 days at 25°C, and the cultures were placed to slowly dry at 50°C to produce the holotype. Holotypes were deposited in the Mycological Herbarium of the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS). All strains were deposited in the Institute of Fungus Resources, Guizhou University (GZUIFR, the Herbarium of Guizhou Agricultural College, code GZAC), and the ex-type strains were also deposited in the China General Microbiological Culture Collection Center (CGMCC). The living cultures were stored in a metabolically inactive state, i.e., kept in sterile 30% glycerol in a −80°C freezer. Macroscopic and morphological characterization of the colonies was performed on PDA incubated for 14 days in the dark at 25°C. The characterization and measurement of fungal microscopic characteristics were performed in 25% lactic acid. Images were obtained using an optical microscope (OM; DM4 B, Leica, Germany) with differential interference contrast (DIC). Taxonomic descriptions and nomenclature were deposited at MycoBank (https://www.mycobank.org/).

DNA extraction, PCR amplification, and sequencing.

Total genomic DNA was extracted from fungal mycelia using the BioTeke fungus genomic DNA extraction kit (DP2032, BioTeke, Beijing, China) following the manufacturer’s instructions. Multiple loci were amplified and sequenced for each new isolate, and the primer sets are listed in Table 2. Amplification conditions were carried out as in the original literature where the primers were reported. The PCR thermal cycle programs for each locus amplification were performed as in the original literature where the primers were reported. The PCR products were sequenced with the amplified primers at a commercial sequencing service provider (Shanghai Sangon Biological Engineering Technology & Services Co., Shanghai, China) in an ABI 3730xl DNA analyzer using the Sanger method. The consensus sequences were obtained using the SeqMan software v. 7 (DNASTAR Lasergene, Madison, WI, USA).
TABLE 2

Primers used in this study

LocusPrimerPrimer sequence 5′ to 3′OrientationReference
ITSITS1 TCCGTAGGTGAACCTGCGG Forward 56
ITS4 TCCTCCGCTTATTGATATGC Reverse 56
Beta-tubulin (BT2)Bt2a GGTAACCAAATCGGTGCTGCTTTC Forward 57
Bt2b ACCCTCAGTGTAGTGACCCTTGGC Reverse 57
Large subunit ribosomal DNA (LSU)LROR ACCCGCTGAACTTAAGC Forward 58
LR7 TACTACCACCAAGATCT Reverse 59
Translation elongation factor 1-alpha (TEF1-α)983F GCYCCYGGHCAYCGTGAYTTYAT Forward 60
EF1-2218R ATGACACCRACRGCRACRGTYTG Reverse 60
RNA polymerase II subunit 2 (RPB2)fRPB2-7cF ATGGG[T/C]AA[A/G]CAAGC[T/C]ATGGG Forward 61
RPB2-3053bR TGRATYTTRTCRTCSACCAT Reverse 62
Minichromosomal maintenance protein 7 (MCM7)MCM7-709 ACIMGIGTITCVGAYGTHAARCC Forward 63
MCM7-1348 GAYTTDGCIACICCIGGRTCWCCCAT Reverse 63
Primers used in this study

Phylogenetic analysis.

The data sets were assembled based on the closest matches from the BLASTn search results and recently published data. Sequences generated from each locus were analyzed along with other sequences retrieved from GenBank. The individual loci matrix was aligned with MAFFT v7.037b (49) and was further edited manually, where necessary, using BioEdit v.7.0.9.0 (50). The best-fit model of maximum likelihood (ML) and Bayesian analyses of each locus were estimated using IQ-TREE’s ModelFinder function (51) using the Akaike Information Criterion (AIC). Phylogenetic analyses of the combined aligned data were performed under ML and Bayesian inference (BI). ML analyses were performed with IQ-TREE v. 1.6.11 (52). Bootstrap analyses were performed using the ultrafast bootstrap approximation (53) with 10,000 replicates, and bootstrap support (BS) greater than 70% was considered significantly supported. The BI was conducted with MrBayes v. 3.2.6 (54). Four Markov chains were run for two runs from random starting trees for 5 million generations, and trees were sampled every 1,000 generations. The first 25% of the sampled trees were discarded as burn-in, and the remaining ones were used to reconstruct a majority rule consensus tree and calculate Bayesian posterior probabilities (BPP) of the clades. The above analyses were carried out in PhyloSuite v1.16 (55).

Data availability.

The sequences generated in this study can be found in GenBank. The accession numbers of the sequences deposited in GenBank are listed in Table 3.
TABLE 3

List of GenBank accession numbers of sequences used in this study

SpeciesStrainGenBank accession no.
ITSLSU MCM7 RPB2 TEF1 BT2
Thelebolales
Alatospora acuminata CBS 104.88 MH862121 MH873811
Alatospora constricta CCM F-11302 KC834040 KC834017
Alatospora pulchella CCM F-502 KC834039 KC834019
Antarctomyces pellizaniae UFMGCB 12416 KX576510
Antarctomyces psychrotrophicus CBS 100573 MH874317
Cleistothelebolus nipigonensis CBS 778.70 MH859938 MH871738
Crinula caliciiformis AFTOL-ID 272 KT225524 AY544680
Epiglia gloeocapsae CBS 126301 MH863968 MH875423
CBS 126302 MH863969 MH875424
Geomyces auratus CBS 108.14 KF039895 KF017864 KF017690 KF017746 KF017805
Geomyces obovatus CGMCC 3.18491 MT509362 MT509376 MT534202 MT534216 MT534227
CGMCC 3.18492 MT509363 MT509377 MT534203 MT534217 MT534228
Gorgomyces honrubiae CCM F-12003 KC834057 KC834028
CCM F-12696 KC834058
Gymnostellatospora alpina CBS 620.81 MH861383 MH873132
Gymnostellatospora bhattii CBS 760.71 MH860337 MH872092
CBS 761.71 MH860338 MH872093
CBS 762.71 MH860339 MH872094
Holwaya mucida NBRC 112552 LC425042 LC429385
TU 112863 MH752062 KX090844
Leuconeurospora pulcherrima CBS 343.76 KF049206 FJ176884 FJ238367 FJ238409
 Leuconeurospora sp.02NH04 JX270349 KF017817 KF017648 KF017702 KF017757
15PA04 JX270479 KF017841 KF017669 KF017725 KF017781
Miniancora allisoniens CCM F-30487 KC834064
Patinella hyalophaea H.B.9739 KT876978 KT876978
Pseudeurotium bakeri CBS 128111 MH864831 MH876274
CBS 128112 MH864832 MH876275
CBS 128113 MH864833 MH876276
CBS 878.71 MH860393 MH872136
Pseudeurotium hygrophilum CBS 102670 AY129291 MH874401
CBS 102671 AY129292
S661 KP644137 KP644138
Pseudeurotium ovale CBS 389.54 MH857368 MH868913
CBS 454.62 MH858209 MH869809
CBS 531.71 MH860256 MH872019
Pseudeurotium ovale var. ovaleUAMH 5825 KJ755521
Pseudeurotium zonatum CBS 126947 MH864346 MH875790
CBS 130172 MH865520 MH876956
CBS 329.36 AY129286 DQ470988 DQ470940 DQ471112
CBS 391.61 MH858096 MH869666
Pseudogymnoascus appendiculatus 02NH11 JX270356 KF017819 KF017650 KF017704 KF017759
07MA02 JX270402 KF017827 KF017658 KF017712 KF017767
Pseudogymnoascus catenatus GZUIFR 21.813a MZ444078 MZ444105 MZ490760 MZ488543 MZ488520
GZUIFR 21.814a MZ444079 MZ444106 MZ490761 MZ488544 MZ488521
GZUIFR 21.815a MZ444080 MZ444107 MZ490762 MZ488545 MZ488522
GZUIFR 21.816a MZ444081 MZ444108 MZ490763 MZ488546 MZ488523
Pseudogymnoascus destructans 20631.21 EU884921 KF017865 KF017691 KF017747 KF017806
Pseudogymnoascus fujianensis GZUIFR 21.819a MZ444084 MZ444111 MZ490766 MZ488549 MZ488526
GZUIFR 21.820a MZ444085 MZ444112 MZ490767 MZ488550 MZ488527
GZUIFR 21.821a MZ444086 MZ444113 MZ490768 MZ488551 MZ488528
GZUIFR 21.822a MZ444087 MZ444114 MZ490769 MZ488552 MZ488529
Pseudogymnoascus guizhouensis GZUIFR 376.1 MT509369 MT509383 MT534209 MT534223 MT534234
GZUIFR 376.2 MT509370 MT509384 MT534210 MT534224 MT534235
GZUIFR 376.3 MT509371 MT509385 MT534211 MT534225 MT534236
Pseudogymnoascus lindneri 02NH05 JX270350 KF017818 KF017649 KF017703 KF017758
LHU.158 MN542212 MN541384 MN541383
Pseudogymnoascus roseus 05NY06 JX270385 KF017824 KF017655 KF017709 KF017764
05NY08 JX270387 KF017825 KF017656 KF017710 KF017765
05NY09 JX270388 KF017826 KF017657 KF017711 KF017766
Pseudogymnoascus shaanxiensis GZUIFR 21.800a MZ444065 MZ444092 MZ490747 MZ488530 MZ488507
GZUIFR 21.801a MZ444066 MZ444093 MZ490748 MZ488531 MZ488508
Pseudogymnoascus shaanxiensis GZUIFR CY1.8 MT509367 MT509381 MT534207 MT534221 MT534232
GZUIFR HZ5.7 MT509366 MT509380 MT534206 MT534220 MT534231
Pseudogymnoascus sinensis CGMCC 3.18493 MT509364 MT509378 MT534204 MT534218 MT534229
CGMCC 3.18494 MT509365 MT509379 MT534205 MT534219 MT534230
 Pseudogymnoascus sp.04NY11 JX270375 KF017821 KF017652 KF017706 KF017761
04NY17A JX270378 KF017823 KF017654 KF017708 KF017763
10NY08 JX270432 KF017829 KF017659 KF017714 KF017769
10NY09 JX270433 KF017830 KF017660 KF017715 KF017770
10NY10 JX270434 KF017831 KF017716 KF017771
11MA03 JX270438 KF017832 KF017661 KF017717 KF017772
11MA05 JX270440 KF017833 KF017662 KF017718 KF017773
11MA07 JX270442 KF017834 KF017663 KF017719 KF017774
11MA08 JX270443 KF017835 KF017664 KF017720 KF017775
12NJ13 JX270459 KF017838 KF017667 KF017722 KF017778
15PA10B KF039894 KF017842 KF017670 KF017726 KF017782
15PA11 JX270486 KF017843 KF017671 KF017727 KF017783
17WV03 JX270510 KF017844 KF017672 KF017728 KF017784
17WV06 JX270513 KF017673 KF017729 KF017785
18VA07 JX270527 KF017847 KF017675 KF017788
18VA08 JX270528 KF017848 KF017676 KF017731 KF017789
18VA12 JX270532 KF017849 KF017732 KF017790
18VA13 JX270533 KF017850 KF017733 KF017791
20KY08 JX270562 KF017851 KF017677 KF017734 KF017792
20KY10 JX270563 KF017852 KF017678 KF017735 KF017793
20KY12 JX270565 KF017853 KF017679 KF017736 KF017794
21IN01 JX270568 KF017854 KF017680 KF017737 KF017795
21IN05 JX270572 KF017855 KF017681 KF017738 KF017796
21IN10 JX270577 KF017856 KF017682 KF017739 KF017797
22984-1-I1 JX415262 KF017866 KF017692 KF017807
23014-1-I6 JX512256 KF017867 KF017693 KF017748 KF017808
24MN04 JX270612 KF017859 KF017685 KF017741 KF017800
24MN06 JX270614 KF017860 KF017686 KF017742 KF017801
24MN14 JX270622 KF017862 KF017688 KF017744 KF017803
24MN18 JX270626 KF017863 KF017689 KF017745 KF017804
A07MA10 KF039893 KF017828 KF017713 KF017768
MN-Mycosel-7 KF039899 KF017872 KF017698 KF017753 KF017813
RMF 7792 KF039898 KF017871 KF017697 KF017752 KF017812
Pseudogymnoascus turneri LHU 121 MN542213 MN541380 MN541379
Ps5 MN542214 MN541382 MN541381
Pseudogymnoascus verrucosus 01NH08 JX270343 KF017816 KF017647 KF017701 KF017756
04NY16 JX270377 KF017822 KF017653 KF017707 KF017762
24MN13 JX270621 KF017861 KF017687 KF017743 KF017802
GZUIFR 21.802a MZ444067 MZ444094 MZ490749 MZ488532 MZ488509
GZUIFR 21.803a MZ444068 MZ444095 MZ490750 MZ488533 MZ488510
Pseudogymnoascus yunnanensis GZUIFR 21.807a MZ444072 MZ444099 MZ490754 MZ488537 MZ488514
GZUIFR 21.808a MZ444073 MZ444100 MZ490755 MZ488538 MZ488515
GZUIFR 21.809a MZ444074 MZ444101 MZ490756 MZ488539 MZ488516
Pseudogymnoascus zhejiangensis GZUIFR 21.810a MZ444075 MZ444102 MZ490757 MZ488540 MZ488517
GZUIFR 21.811a MZ444076 MZ444103 MZ490758 MZ488541 MZ488518
GZUIFR 21.812a MZ444077 MZ444104 MZ490759 MZ488542 MZ488519
Ramgea ozimecii CNF 2/9997 KY368752 KY368753
Solomyces guizhouensis GZUIFR 21.804 MZ444069 MZ444096 MZ490751 MZ488534 MZ488511
GZUIFR 21.805 MZ444070 MZ444097 MZ490752 MZ488535 MZ488512
GZUIFR 21.806 MZ444071 MZ444098 MZ490753 MZ488536 MZ488513
Solomyces ramosus GZUIFR 21.817 MZ444082 MZ444109 MZ490764 MZ488547 MZ488524
GZUIFR 21.818 MZ444083 MZ444110 MZ490765 MZ488548 MZ488525
Solomyces sinensis CGMCC 3.18498 MT509373 MT509387 MT534213 MT534238
CGMCC 3.18499 MT509374 MT509388 MT534214 MT534239
CGMCC 3.18500 MT509375 MT509389 MT534215 MT534240
 Solomyces sp.15PA02 JX270477 KF017840 KF017724 KF017780
17WV02 JX270509 KF017845 KF017730 KF017786
Thelebolus balaustiformis MUT 2357 NR_159056 NG_067559
Thelebolus globosus CBS 113940 MH862951 NG_067263
Thelebolus spongiae MUT 2359 MG813185 MG816493
 Undetermined12NJ08 JX270454 KF017836 KF017665 KF017776
12NJ10 JX270456 KF017837 KF017666 KF017721 KF017777
17WV09 JX270515 KF017846 KF017674 KF017787
23WI08 JX270598 KF017858 KF017799
23WI14 JX270604 KF017684
Zongqia sinensis GZUIFR 21.823a MZ444088 MZ444115 MZ490770 MZ488553
GZUIFR 21.824a MZ444089 MZ444116 MZ490771 MZ488554
GZUIFR 21.825a MZ444090 MZ444117 MZ490772 MZ488555
GZUIFR 21.826a MZ444091 MZ444118 MZ490773 MZ488556
Scedosporium and related taxa
Kernia columnaris CBS 159.66 MN991957 MN982416
Kernia geniculotricha CBS 599.68 MN991956 MN982414
Kernia nitida CBS 282.52 MN991955 MN982415
Kernia pachypleura CBS 776.70 MN991958 MN982417
Lomentospora prolificans CBS 114.90 MH862198
DTO 402-E9 MT316371 MT433464
Lophotrichus fimeti CBS 129.78 MH861119
Lophotrichus macrosporus CBS 379.78 MH861152
Microascus longirostris CBS 196.61 LM652421 LM652634
Parascedosporium putredinis CBS 108.10 MH854594
CBS 133438 MH866067
Parascedosporium tectonae CBS 118694 AM749735
Petriella guttulata CBS 362.61 MH858084
Petriella setifera CBS 385.87 AY882345 EU977491
Petriella sordida CBS 144612 MK442608 MK442740
Petriellopsis africana CBS 311.72 AJ888425 AJ889603
Scedosporium americanum CBS 218.35 AM712309 MT813192
DMic 165285 MT803031 MT813191
Scedosporium angusta CBS 116914 KT008539 KT008468
CBS 254.72 AY228114 KT008467
Scedosporium apiospermum CBS 101719 KT008504 KT008486
CBS 117399 KT008503 KT008485
CBS 117405 KT008514 KT008483
CBS 117411 KT008513 KT008484
GZUIFR 21.835a MZ469291 MZ488565
GZUIFR 21.836a MZ469292 MZ488566
Scedosporium aurantiacum CBS 103.44 KT008559 KT008437
CBS 117414 KT008558 KT008436
CBS 117426 KT008560 KT008435
GZUIFR 21.838a MZ469294 MZ488568
GZUIFR 21.839a MZ469295 MZ488569
Scedosporium boydii CBS 116898 KT008520 KT008458
CBS 117390 KT008528 KT008465
CBS 117392 KT008530 KT008466
CBS 117417 KT008526 KT008464
CBS 117432 KT008516 KT008456
Scedosporium cereisporum FMR 12996 KJ599660 KJ599659
Scedosporium dehoogii CBS 117387 KT008552 KT008494
CBS 117393 KT008553 KT008495
CBS 117406 KT163400 KT163401
GZUIFR 21.837a MZ469293 MZ488567
Scedosporium desertorum CBS 489.72 MH860541 KT008438
Scedosporium ellipsoideum CBS 418.73 AJ888426 AJ889595
Scedosporium fusoideum CBS 106.53 AJ888428 AJ889601
Scedosporium haikouense GZUIFR 21.833a MZ469289 MZ488563
GZUIFR 21.834a MZ469290 MZ488564
Scedosporium hainanense GZUIFR 21.827a MZ469283 MZ488557
GZUIFR 21.828a MZ469284 MZ488558
GZUIFR 21.829a MZ469285 MZ488559
Scedosporium hunanense GZUIFR 21.830a MZ469286 MZ488560
GZUIFR 21.831a MZ469287 MZ488561
GZUIFR 21.832a MZ469288 MZ488562
Scedosporium minutisporum CBS 100396 KT008555 KT008440
CBS 116595 KT008557 KT008439
CBS 116911 KT008556 KT008441
FMR 4072 AJ888384 AJ889592
Scedosporium rarisporum G79 KX790702
Scedosporium sanyaense EM 65901 KJ001005
EM 65901.2 KX790701
 Scedosporium sp.GZUIFR 21.840a MZ469296 MN541380
Scopulariopsis brevicaulis MUCL 40726 LM652465 LM652672
Wardomyces anomalus CBS 299.61 LN850992 LN851149
Wardomyces giganteus CBS 746.69 LM652411 LN851150
Wardomyces humicola CBS 369.62 LN850993 LN851151
Wardomyces inflatus CBS 216.61 LM652496 LN851152

Accession numbers for these strains generated from this study.

List of GenBank accession numbers of sequences used in this study Accession numbers for these strains generated from this study.
  38 in total

1.  Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit.

Authors:  Y J Liu; S Whelen; B D Hall
Journal:  Mol Biol Evol       Date:  1999-12       Impact factor: 16.240

2.  Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory.

Authors:  Valérie Reeb; François Lutzoni; Claude Roux
Journal:  Mol Phylogenet Evol       Date:  2004-09       Impact factor: 4.286

3.  Keratinophilic fungi isolated from hospital dust and soils of public places at Gulbarga, India.

Authors:  G M Vidyasagar; Narayan Hosmani; D Shivkumar
Journal:  Mycopathologia       Date:  2005-01       Impact factor: 2.574

4.  Diversity of Onygenalean Fungi in Keratin-Rich Habitats of Maharashtra (India) and Description of Three Novel Taxa.

Authors:  Rahul Sharma; Yogesh S Shouche
Journal:  Mycopathologia       Date:  2019-06-11       Impact factor: 2.574

5.  Two new species of Pseudogymnoascus with Geomyces anamorphs and their phylogenetic relationship with Gymnostellatospora.

Authors:  Adrianne V Rice; Randolph S Currah
Journal:  Mycologia       Date:  2006 Mar-Apr       Impact factor: 2.696

6.  A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs.

Authors:  Stephen A Rehner; Ellen Buckley
Journal:  Mycologia       Date:  2005 Jan-Feb       Impact factor: 2.696

7.  New primers for promising single-copy genes in fungal phylogenetics and systematics.

Authors:  I Schmitt; A Crespo; P K Divakar; J D Fankhauser; E Herman-Sackett; K Kalb; M P Nelsen; N A Nelson; E Rivas-Plata; A D Shimp; T Widhelm; H T Lumbsch
Journal:  Persoonia       Date:  2009-08-04       Impact factor: 11.051

Review 8.  Microbial decomposition of keratin in nature-a new hypothesis of industrial relevance.

Authors:  Lene Lange; Yuhong Huang; Peter Kamp Busk
Journal:  Appl Microbiol Biotechnol       Date:  2016-01-12       Impact factor: 4.813

9.  Construction of Simplified Microbial Consortia to Degrade Recalcitrant Materials Based on Enrichment and Dilution-to-Extinction Cultures.

Authors:  Dingrong Kang; Samuel Jacquiod; Jakob Herschend; Shaodong Wei; Joseph Nesme; Søren J Sørensen
Journal:  Front Microbiol       Date:  2020-01-10       Impact factor: 5.640

10.  The Enigmatic Thelebolaceae (Thelebolales, Leotiomycetes): One New Genus Solomyces and Five New Species.

Authors:  Zhiyuan Zhang; Chunbo Dong; Wanhao Chen; Quanrong Mou; Xiaoxiao Lu; Yanfeng Han; Jianzhong Huang; Zongqi Liang
Journal:  Front Microbiol       Date:  2020-10-29       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.