Literature DB >> 34610317

Attenuation of apoptotic cell detection triggers thymic regeneration after damage.

Sinéad Kinsella1, Cindy A Evandy2, Kirsten Cooper2, Lorenzo Iovino2, Paul C deRoos2, Kayla S Hopwo2, David W Granadier2, Colton W Smith2, Shahin Rafii3, Jarrod A Dudakov4.   

Abstract

The thymus, which is the primary site of T cell development, is particularly sensitive to insult but also has a remarkable capacity for repair. However, the mechanisms orchestrating regeneration are poorly understood, and delayed repair is common after cytoreductive therapies. Here, we demonstrate a trigger of thymic regeneration, centered on detecting the loss of dying thymocytes that are abundant during steady-state T cell development. Specifically, apoptotic thymocytes suppressed production of the regenerative factors IL-23 and BMP4 via TAM receptor signaling and activation of the Rho-GTPase Rac1, the intracellular pattern recognition receptor NOD2, and micro-RNA-29c. However, after damage, when profound thymocyte depletion occurs, this TAM-Rac1-NOD2-miR29c pathway is attenuated, increasing production of IL-23 and BMP4. Notably, pharmacological inhibition of Rac1-GTPase enhanced thymic function after acute damage. These findings identify a complex trigger of tissue regeneration and offer a regenerative strategy for restoring immune competence in patients whose thymic function has been compromised.
Copyright © 2021 The Author(s). Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  NOD2; Rac1 GTPase; T cell development; TAM receptors; apoptotic cell death; lymphopenia; thymus; tissue regeneration

Mesh:

Substances:

Year:  2021        PMID: 34610317      PMCID: PMC8627669          DOI: 10.1016/j.celrep.2021.109789

Source DB:  PubMed          Journal:  Cell Rep            Impact factor:   9.423


INTRODUCTION

Efficient functioning of the thymus is critical for establishing and maintaining effective adaptive immunity (Miller, 2020). T cell development is a highly complex process involving cross-talk between developing thymocytes and the non-hematopoietic supporting stromal microenvironment, primarily highly specialized thymic epithelial cells (TECs), but also endothelial cells (ECs), fibroblasts, and dendritic cells (DCs) (Abramson and Anderson, 2017). The thymus is exceptionally sensitive to negative stimuli that, together with its well-characterized capacity for repair, leads to continual cycles of involution and regeneration in response to acute injury (Gruver and Sempowski, 2008; Kinsella and Dudakov, 2020; van den Broek et al., 2016). However, this endogenous regenerative aptitude declines with age as a function of thymic involution leading to a reduced ability to respond to new pathogens, as well as poor response to vaccines and immunotherapy (Granadier et al., 2021; Velardi et al., 2020). Therefore, there is a pressing clinical need for the development of therapeutic strategies that can enhance T cell reconstitution. One approach is to exploit key pathways that promote endogenous thymic regeneration into pharmacologic strategies; however, the molecular mechanisms governing endogenous thymic regeneration are not fully understood. Recent studies have revealed that endogenous thymic repair is dependent on the production of two distinct regeneration factors, interleukin-23 (IL-23) and BMP4, by DCs and ECs, respectively (Dudakov et al., 2012, 2017; Wertheimer et al., 2018). Both IL-23 and BMP4 target TECs to facilitate regeneration, the former through the downstream production of IL-22 by innate lymphoid cells (ILCs) (Buonocore et al., 2010; Cella et al., 2009; Dudakov et al., 2012, 2017; Wertheimer et al., 2018; Zheng et al., 2007). These regeneration-associated factors have profound reparative effects in the thymus after acute injury and can be utilized individually as therapeutic strategies of immune regeneration (Kinsella and Dudakov, 2020). Although BMP4 and the IL-23-IL-22 axis represent two regenerative pathways that facilitate TEC repair, both the damage-sensing mechanisms that trigger the production of these factors and the molecular pathways that intrinsically regulate Bmp4 and Il23 expression after damage are unknown. Here, we identify an innate trigger of the reparative response in the thymus, centered on the attenuation of signaling directly downstream of apoptotic cell detection as thymocytes are depleted after acute damage. We found that the intracellular pattern recognition receptor NOD2, via induction of microRNA-29c, suppressed levels of the regenerative factors IL-23 and BMP4, in DCs and ECs, respectively. During steady-state T cell development, a high proportion of thymocytes undergo apoptosis due to selection events during T cell development (Hernandez et al., 2010; Jameson et al., 1995). We demonstrate that this provides a signal for a suppressive pathway that is constitutively activated by the detection of exposed phosphatidylserine on apoptotic cells by cell-surface TAM receptors (Rothlin et al., 2015) on DCs and ECs, with downstream intracellular activation of the Rho GTPase Rac1. However, after damage, when profound cell depletion occurs across the thymus, the TAM-Rac1-NOD2-miR29c pathway is abrogated in the absence of apoptotic thymocytes, therefore allowing for the increased production of IL-23 and BMP4. Importantly, this pathway could be modulated pharmacologically by inhibiting Rac1 GTPase activation in vivo, which resulted in increased thymic function and T cell recovery after acute damage. In conclusion, this work not only represents an innovative regenerative strategy for restoring immune competence in patients whose thymic function has been compromised due to cytoreductive conditioning, infection, or age but also identifies a mechanism by which tissue regenerative responses are triggered.

RESULTS

NOD2 negatively regulates thymus regeneration by suppressing the production of BMP4 and IL-23

To identify potential mechanisms by which thymic regeneration networks are governed, we first performed transcriptome analysis on purified ECs (the primary source of BMP4 after damage [Wertheimer et al., 2018]) isolated from the mouse thymus at days 0 and 4 after a sublethal dose of total body irradiation (SL-TBI, 550 cGy), time points that capture baseline expression levels and expression at the initiation of the regenerative response (day 4) (Dudakov et al., 2012; Wertheimer et al., 2018). Analysis through the DAVID bioinformatics tool revealed a surprising number of pathways associated with immune function, which included most of the pathways with a false discovery rate [FDR] of <0.05 (Figures 1A and S1A). Further analysis identified that, within these pathways, several genes shared a high frequency across all gene ontology (GO) pathways (Figure 1A). In particular, nucleotide-binding oligomerization domain-containing protein 2 (NOD2) stood out not only as it is centrally involved in innate immunity via its role in detection of danger signals, such as bacterial peptidoglycan (Caruso et al., 2014; Chen et al., 2009) but also because NOD2 is one of the only molecular pathways previously reported to suppress the production of IL-23 by DCs (Brain et al., 2013). Notably, GSEA analysis supported the role of NOD2 in the damage response, with a significant enrichment in the signature of downstream NOD2 gene targets (Billmann-Born et al., 2011) at day 4 after damage (Figure S1B). Importantly, transcriptome analysis in highly purified DCs after damage revealed highly similar inflammatory gene signatures and enrichment for NOD2 expression (Figures 1B and S1C). Although the expression of Nod2 in thymic tissue has been known for some time (Iwanaga et al., 2003), the only functional role for NOD2 that has been described in the thymus has been in thymocyte selection (Martinic et al., 2017). Therefore, we hypothesized that NOD2 activation was central to the inhibition of IL-23 and BMP4, and after damage this activation is abrogated upstream by the depletion of thymocytes. To explore the effects of NOD2 deficiency on thymic regeneration following insult, wild-type (WT) or Nod2−/− animals were exposed to SL-TBI, and levels of thymic IL-23 and BMP4 were measured by ELISA. Nod2−/− thymi had increased absolute intracellular levels of BMP4 and IL-23 compared to WT controls after damage (Figure 1C). Downstream of IL-23, we also found a significant increased production of IL-22 in Nod2-deficient thymi (Figure S2A). Consistent with this, there was a commensurate increase in thymic cellularity, from as early as 7 days after SL-TBI (Figure 1D), suggesting that these increased levels of regenerative factors are supporting superior thymic regeneration. Although there was no global change in thymocyte proportions (Figure 1E), the enhanced total cellularity was reflected by increases in all subsets of thymocytes (Figure 1F). Remarkably, given their role in the production of the regenerative factors, there was no change in the number of ECs in the Nod2-deficient thymus; however, we observed increased regeneration of CD103+ DCs in Nod2−/− thymi, compared with WT (Figure 1G), which mediate IL-23 levels (Dudakov et al., 2012; Kinnebrew et al., 2012). Importantly, given the increased levels of BMP4 and IL-23, which can directly or indirectly induce TEC proliferation and function (Dudakov et al., 2012; Wertheimer et al., 2018), there was significantly augmented regeneration of both cortical TECs (cTECs) and medullary TECs (mTECs) (Figure 1H), both of which have distinct crucial roles in T cell development (Abramson and Anderson, 2017). Elevated thymic function persisted in mice deficient for NOD2 compared to age-matched WT controls even 150 days after TBI (Figure 1I); although perhaps prolonged effects are not surprising given that Nod2-deficient mice exhibited increased levels of IL-23 and BMP4 even at baseline (Figure S2B), which was also reflected by enhanced baseline cellularity and individual thymocyte subsets (Figures S2C–S2E).
Figure 1.

NOD2 limits thymus regeneration by inhibiting the production of regenerative factors

(A and B) Thymuses were pooled from 6-week-old C57BL/6 mice, and transcriptome analysis was performed on fluorescence-activated cell sorting (FACS)-purified ECs (A) or DCs (B) isolated from either untreated mice (d0) or 4 days after TBI (550 cGy, d0, n = 3; d4, n = 2; each n pooled from 5 mice). (A) Gene ontology (GO) pathway analysis was performed on upregulated genes in ECs at day 4 after SL-TBI using DAVID, and the top-ten pathways by FDR are displayed. Red bars represent pathways involved with immune function; dashed line at p = 0.05. Top-ten genes in ECs are shown by frequency of representation among all GO pathways with an FDR <0.05. (B) Gene ontology (GO) pathway analysis was performed on upregulated genes in DCs at day 4 after SL-TBI using DAVID, and the top-ten pathways by FDR are displayed. Red bars represent pathways involved with immune function; dashed line at p = 0.05. Top-ten genes in DCs are shown by frequency of representation among all GO pathways with an FDR <0.05.

(C–I) 6- to 8-week C57BL/6 WT or Nod2−/− mice were given a sublethal dose of TBI (550 cGy), and the thymus was harvested and analyzed at the indicated time points. (C) Total thymic amounts of BMP4, IL-23, and IL-22 were assessed by ELISA at day 7 after SL-TBI (n = 4/group from a representative experiment of at least two independent experiments). (D) Total thymic cellularity at days 7 and 14 after SL-TBI (d7, n = 11–15; d14, n = 6–10; combined from two independent experiments). (E) Concatenated flow plots showing CD4 and CD8 expression at days 7 and 14 after SL-TBI. (F) Total number of CD4+CD8+ DP, CD4+CD3+ SP4, or CD3+CD8+ SP8 thymocytes (d7, n = 11–15; d14, n = 6–10; combined from two independent experiments). (G) Number of CD45+MHCII+CD11c+CD103+ cDC1 and CD45−EpCAM−CD31+PDGFRa− ECs at day 7 after SL-TBI (n = 11–15/group across two independent experiments). (H) Number of CD45–EpCAM+MHCII+UEA1loLy51hi cTECs and CD45−EpCAM+MH-CII+UEA1hiLy51lo mTECs at day 7 after SL-TBI (n = 11–15/group across two independent experiments). (I) Total thymic cellularity and absolute number of thymocyte subsets at day 150 after SL-TBI (n = 3–5). Graphs represent mean ± SEM; each dot represents a biologically independent observation. See also Figures S1 and S2.

miR29c mediates the suppressive function of NOD2

NOD2 has been previously shown to induce expression of the microRNA miR29, which downregulates IL-23 by directly regulating transcription of Il12p40 and indirectly regulating Il23p19 (Brain et al., 2013). MicroRNAs are small non-coding RNAs that critically govern protein expression by binding to and degrading target RNA (Bartel, 2004; Krol et al., 2010; Makeyev and Maniatis, 2008). There are three members of the miR29 family, each with some overlapping physiological functions, including a TEC-intrinsic role of miR29a in regulating the response to interferon signaling and Aire-dependent gene expression (Papadopoulou et al., 2011; Ucar et al., 2013). Furthermore, the expression of all three miR29 family members are increased in the aged thymus, suggesting a potential role in involution (Ye et al., 2014). To understand whether miR29 was involved in the regenerative response in the thymus, we first assessed the expression levels of mature 3p and 5p arms of miR29a, miR29b, and miR29c in the thymus from WT or Nod2−/− mice 3 days after TBI and found lower expression of miR29c-5p in Nod2-deficient mice (Figure 2A). To elucidate whether there was a cell-specific function of miR29 in the thymus, we assessed miR29 expression in purified populations of ECs, DCs, and DP thymocytes and did not find a significant change in the expression of either miR29a-5p or miR29b-5p after damage (Figure S3A). However, we observed decreased expression of miR29c-5p in ECs and DCs after damage, with this damage-induced reduction lacking in DP thymocytes (Figure 2B), suggesting an endogenous regulation in miR29c-5p after damage in the regeneration-initiating DCs and ECs, both of which have higher miR29c-5p expression at baseline compared to DP thymocytes (Figure S3B).
Figure 2.

miR29c mediates the effects of NOD2 in limiting production of regenerative factors in ECs and DCs

(A) Thymuses were isolated from 6- to 8-week C57BL/6 WT or Nod2−/− mice at day 3 following SL-TBI, and the expression of 3p and 5p arms of miR29a, miR29b, or miR29c was analyzed by qPCR (3p, n = 4/group; 5p, n = 7/group across two independent experiments).

(B) DPs, ECs, and DCs were FACS purified from WT thymuses at day 0 or 3 after SL-TBI and expression of miR29c-5p was analyzed by qPCR (DCs, n = 4; ECs/DPs, n = 6–7/population/time point across two independent experiments).

(C) Thymic exECs were generated as previously described (Seandel et al., 2008; Wertheimer et al., 2018) and transfected with a miR29c mimic. 20 h after transfection, the expression of Bmp4 was analyzed by qPCR (n = 7 independent experiments).

(D) exECs were transfected with a miR29c inhibitor, and the expression of Bmp4 was analyzed by qPCR 20 h after transfection (n = 4 independent experiments).

(E) CD11c+ DCs were isolated from untreated C57BL/6 thymuses and transfected with a miR29c mimic. 20 h after transfection, Il23p19 was analyzed by qPCR (n = 5 across three independent experiments).

(F) HEK293 cells were co-transfected with either Bmp4-3′ UTR, Il12p40-5′ UTR, or Il23p19-3′ UTR luciferase constructs and a miR29c-5p mimic. Binding activity was quantified by measuring luciferase activity after 20 h (n = 5–7 independent experiments). Graphs represent mean ± SEM; each dot represents a biologically independent observation. See also Figure S3.

To functionally assess the relationship between miR29c-5p and the production of regenerative factors, we used a technique to constitutively activate the Akt pathway in freshly isolated thymic ECs using the pro-survival adenoviral gene E4ORF1, which allows for their ex vivo propagation and expansion while maintaining endothelial phenotype, adaptability, as well as vascular tube formation capacity (Seandel et al., 2008; Wertheimer et al., 2018), allowing for functional manipulation of the cells for in vitro modeling of regenerative pathways. Consistent with the decrease of miR29c-5p in regeneration-initiating cells after damage, and the previously identified role of miR29 in the attenuation of Il23p19 (Brain et al., 2013), we hypothesized that miR29c-5p regulates the expression of Bmp4 in ECs. Overexpression of miR29c-5p in thymic exECs resulted in a significant reduction in the expression of Bmp4 (Figure 2C). Conversely, Bmp4 expression was increased upon inhibition of miR29c-5p (Figure 2D). Importantly, freshly isolated DCs transfected with a miR29c-5p mimic demonstrated a similar reduction in expression of the Il23p19 subunit (Figure 2E), suggesting that miR29c-5p negatively regulates these regenerative factors in both ECs and DCs. miRNAs regulate gene expression in several ways, either by binding to the 3′ UTR of their target transcript and inducing post-transcriptional modifications and translational repression, ultimately resulting in transcript degradation, or by binding to the 5′ UTR sequence of their target transcript and exerting silencing effects on gene expression (Huntzinger and Izaurralde, 2011). To understand whether miR29c-5p regulation of Bmp4 and Il23p19 was due to direct binding, and to determine where this binding occurred, we carried out a luciferase assay using 3′UTR and 5′ UTR Bmp4-luciferase constructs that were co-transfected with a miR29c-5p mimic. We observed a degradation of the 3′ UTR of Bmp4 in the presence of the miR29c-5p mimic, identifying a direct and specific regulation of miR29c-5p on Bmp4 expression (Figure 2F), with a suggested indirect effect of miR29c-5p on Il23p19 stability, consistent with previous reports (Papadopoulou et al., 2011).

Detection of apoptotic thymocytes by TAM receptors suppresses the production of regenerative factors

Although we have demonstrated that attenuation of NOD2-dependent miR29c-5p expression is involved in regulating levels of critical regenerative factors, the upstream initiator of this cascade is not defined. In our previous studies, we found a link between the loss of thymic cellularity and the initiation of the IL-22 and BMP4 pathways (Dudakov et al., 2012, 2017; Wertheimer et al., 2018). In the case of IL-22/IL-23, this could be directly correlated with the depletion in the number of CD4+CD8+ double-positive (DP) thymocytes, as mice with a genetic block before the DP stage (Rag1−/−, Il7ra−/−, Il7−/−, and Tcrb−/−) (Mak et al., 2001) or mice treated with dexamethasone, which causes a targeted reduction in DP thymocytes (Purton et al., 2004), expressed profoundly more IL-22 and IL-23 than WT controls or mutant mice with blocks further downstream in T cell development (Tcra−/− and Ccr7−/−) (Dudakov et al., 2012). In the case of the mutant mouse strains, this occurred even without acute thymic damage, suggesting that merely the absence of DP thymocytes is enough to trigger these reparative pathways. Although 80%–90% of the thymus comprises DP thymocytes, approximately 99% of these cells undergo apoptosis under homeostatic conditions due to selection events (Hernandez et al., 2010; Jameson et al., 1995). Taken together with reports that apoptotic cells can regulate the production of cytokines, including reducing the production of IL-23 by DCs (Municio et al., 2011), we hypothesized that the presence of homeostatic apoptotic thymocytes can limit the production of the regenerative factors IL-23 and BMP4. To test this, we performed co-culture experiments of thymocytes with thymic ECs or DCs, where the thymocytes had been further induced to undergo apoptosis with dexamethasone (Cifone et al., 1999) (referred to as apoptotic cells, ACs), or where apoptosis was inhibited with the pan-caspase inhibitor z-VAD-FMK, which considerably reduced thymocyte apoptosis as measured by Annexin V binding (Figure S4A). Consistent with the hypothesis that ACs suppress the production of regenerative factors, inhibiting apoptosis in thymocytes significantly enhanced the production of Bmp4 in ECs and IL-23 in DCs (Figures 3A and 3B). Annexin V is a surrogate marker of apoptotic cells and binds to exposed phosphatidylserine (PtdSer), inversion of which from the inner cell membrane is a key identifying feature of apoptotic cells (Mower et al., 1994; Schlegel et al., 1993). Even though on a per-cell basis there is an increase in Annexin V binding on DP thymocytes after damage (Figure 3C), given the severe depletion in DP thymocytes after damage (Figures 3D and 3E) there was a profound decrease in total exposed PtdSer (Figures 3F, S4B, and S4C), resulting in a robust correlation between exposed PtdSer and DP cellularity (Figure 3G). Apoptotic cell clearance can be facilitated by the detection of exposed PtdSer by the TAM receptors, Tyro, Axl, and Mer, on nearby cells. TAM receptors are a family of transmembrane tyrosine kinase receptors that recognize their extracellular ligands Gas6 or ProS 1 in the presence of PtdSer and have a critical role in the maintenance of immune homeostasis, including regulation of thymic negative selection (Lemke and Rothlin, 2008; Rothlin et al., 2015; Wallet et al., 2009). Both thymic ECs and DCs express Axl, Mer, and Tyro3 (Figure 3H), as has been extensively reported previously in other tissues (Rothlin et al., 2015). Consistent with the inhibition of apoptosis, abrogation of TAM receptor signaling with the pan-inhibitor RXDX-106 (Yokoyama et al., 2019) increased expression of Bmp4 in ECs and IL-23 in DCs (Figures 3I and 3J).
Figure 3.

TAM receptor detection of phosphatidylserine mediates thymocyte suppression of regenerative factors

(A and B) Thymocytes were isolated from untreated C57BL/6 mice and incubated for 4 h with Dexamethasone (100 nM) or zVAD-FMK (20 μM). After 4 h, apoptotic thymocytes (ACs) were washed and co-cultured with exECs (A) or freshly isolated CD11c+ DCs (B) for 24 h after which Bmp4 expression was analyzed by qPCR (n = 7 across 5 independent experiments) or IL-23 was analyzed by intracellular cytokine staining (n = 5 across two independent experiments).

(C–G) 6- to 8-week-old C57BL/6 mice were given sublethal TBI (550 cGy), and the thymus was harvested at days 0, 1, 2, 3, and 7. (C) Annexin V staining on DP thymocytes (displayed are concatenated plots from 3 individual mice, representative of three independent experiments). (D) Staining for CD4 and CD8 on thymus cells (displayed are concatenated plots from 3 individual mice, representative of three independent experiments). (E) Total number of DP thymocytes (solid line; left axis) compared with proportion of Annexin V+ DP thymocytes (red broken line; right axis) (n = 8 across 3 independent experiments). (F) Absolute binding of Annexin V in the thymus (n = 8 across 3 independent experiments). (G) Correlation of absolute thymic binding of Annexin V with total number of cells in the thymus (n = 3/time point comprising one of three independent experiments).

(H) DP thymocytes, DCs, or ECs were FACS purified from untreated C57BL/6 mice, and expression of Axl, Mer, and Tyro3 was analyzed by qPCR (DP, n = 7; DC, n = 5; EC, n = 7 across two independent experiments).

(I and J) Thymocytes were isolated from untreated C57BL/6 mice and incubated for 4 h with dexamethasone (100 nM). After 4 h, apoptotic thymocytes (ACs) were washed and co-cultured with exECs (I) or freshly isolated CD11c+ DCs. (J) in the presence or absence of the TAM receptor inhibitor RXDX-106 (25 μM) for 20 h after which Bmp4 expression was analyzed by qPCR (n = 6/treatment across 2 independent experiments) or IL-23 was analyzed by intracellular cytokine staining (n = 4). Graphs represent mean ± SEM; each dot represents a biologically independent observation. See also Figure S4.

TAM receptor signaling promotes Rac1 GTPase activation and limits Bmp4 and Il23

PtdSer guides and strengthens ligand binding to TAM receptors and is critical for TAM receptor activation and downstream signaling (Rothlin et al., 2015). One of the common downstream targets of TAM receptors are Rho GTPases, which is notable given recent reports that, in addition to its capacity to sense bacterial-derived peptidoglycans, NOD2 can also act as a cytosolic sensor of activated Rho GTPases (Keestra et al., 2013; Keestra-Gounder and Tsolis, 2017). Rho GTPases have multiple cellular roles centered on modulation of the cellular cytoskeletal architecture and regulate processes such as cell adhesion, migration, polarization, and trafficking (Hervé and Bourmeyster, 2015). To investigate the role of Rho GTPases in the regulation of regenerative factors, we first performed a functional screen of inhibitors of Rho, Rac, and Cdc42 subclasses of Rho GTPases (Hervé and Bourmeyster, 2015; Hodge and Ridley, 2016; Lin and Zheng, 2015) in exECs or freshly isolated thymic DCs and assessed the expression of regenerative factors. Using this approach, we identified that, while inhibition of Cdc42 did not mediate considerable effects on the production of Bmp4 by ECs or Il12p40 in DCs, inhibition of Rac1 led to significantly increased expression in these regenerative factors (Figures 4A and 4B). Interestingly, inhibition of ROCK1, a downstream mediator of RhoA, induced Bmp4 but not Il12p40, although RhoA itself only trended toward an increase in Bmp4 production. Given the common profound effect of Rac1 inhibition across ECs and DCs in these in vitro assays, we next sought to determine whether detection of apoptotic thymocytes could indeed lead to Rac1 GTPase activation. Consistent with our proposed framework, we demonstrated that inhibiting either the induction of apoptosis or the detection of apoptotic thymocytes reduced activation of Rac1 in thymic ECs (Figures 4C and 4D). Notably, we found significantly increased thymic recovery following acute injury caused by SL-TBI in Rac1 was deleted in mice specifically from DCs (Figure 4E).
Figure 4.

Rac1-GTPase is activated by apoptotic thymocytes and suppresses production of IL-23 and BMP4

(A and B) exECs (A) or freshly isolated CD11c+ DCs (B) were incubated for 20 h in the presence of inhibitors (all at 50 μM) for RhoA (Rhosin), ROCK (TC-S 7001), Rac1 (EHT-1864), or Cdc42 (ZCL272) after which Bmp4 (ECs) or Il12p40 was analyzed by qPCR (exECs, n = 5 independent experiments; DCs, n = 6 across two independent experiments).

(C) Thymocytes were isolated from untreated C57BL/6 mice and incubated for4 h with Dexamethasone (100 nM) or zVAD-FMK (20 μM). After 4 h, apoptotic thymocytes (ACs) were washed and co-cultured with exECs for 24 h after which Rac1-GTPase activation was measured using a GTPase ELISA specific for Rac1 (n = 5 across two independent experiments).

(D) Thymocytes were isolated from untreated C57BL/6 mice and incubated for 4 h with dexamethasone (100 nM). After 4 h, apoptotic thymocytes (ACs) were washed and co-cultured with exECs in the presence or absence of the TAM receptor inhibitor RXDX-106 (25 μM) for 20 h after which Rac1-GTPase activation was measured using a GTPase ELISA specific for Rac1 (n = 5 across two independent experiments).

(E) Mice deficient for Rac1 specifically in DCs were generated by crossing Rac1fl/fl mice with CD11c-Cre. WT or Rac1ΔDC mice were given SL-TBI and thymus cellularity was assessed at day 7 (n = 5–7/group combined from two independent experiments). Graphs represent mean ± SEM; each dot represents a biologically independent observation.

Rac1 GTPase inhibition enhances thymus regeneration and thymic output in vivo

Several strategies targeting Rho GTPases have been examined pre-clinically for multiple cancers. These include small molecules targeting the spatial regulation of GTPase activators (Mazieres et al., 2004), and Rho-GEF interactions, such as Rhosin (Shang et al., 2012), and our therapeutic candidate Rac1 GTPase inhibitor EHT1864 (Shutes et al., 2007), with the greatest clinical trial success thus far in targeting the downstream kinase of RhoA, ROCK (Dong et al., 2010; Sadok et al., 2015). To determine whether this pathway could be manipulated for therapeutic efficacy in thymic regeneration, we treated mice with the Rac1 GTPase inhibitor EHT1864 following SL-TBI and identified a robust regeneration of thymic cellularity (Figure 5A). EHT1864 had no effect on thymus cellularity in Nod2−/− mice (Figure 5A), supporting our hypothesis of a Rac1-NOD2 regeneration axis. Although thymocyte proportions were unaffected by treatment with EHT1864 (Figure 5B), we found a similar increase in almost all thymocyte subsets (Figure 5C), which was not observed in EHT1864-treated Nod2-deficient mice (Figure S5). Consistent with our proposed mechanism, we found a significant decrease in miR29c-5p expression in the thymus after Rac1 inhibition (Figure 5D), with a corresponding increase in the levels of BMP4 and IL-23 (Figure 5E). This was also then accompanied by enhanced TEC regeneration after EHT1864 treatment (Figure 5F). In the periphery, while there was no change in the total number of CD4+ or CD8+ thymocytes or their relative proportions (Figures 5G and 5H), there was an increase in the output of naive T cells in mice treated with EHT1864, reflected by their proportion and the ratio of naive:memory cells (Figures 5I and 5J).
Figure 5.

Rac1 inhibition enhances thymus regeneration and peripheral CD4+ naive T cell recovery after acute damage

6- to 8-week C57BL/6 WT or Nod2−/− mice were treated with the Rac1 inhibitor EHT1864 (40 mg/kg i.p. injection) at days 3, 5, and 7 following a sublethal dose of TBI (550 cGy), and the thymus was analyzed on day 14.

(A) Total thymic cellularity at day 14 after SL-TBI (WT, n = 20/treatment across 4 independent experiments; KO, n = 9–12 across three independent experiments).

(B) Flow plots showing CD4 and CD8 expression at day 14 after SL-TBI (gated on CD45+ cells; plots were concatenated of all samples in each treatment group from one experiment).

(C) Total number of DP, SP4, or SP8 thymocytes (n = 20/treatment across 4 independent experiments).

(D) Expression of miR29c analyzed by qPCR on whole thymic tissue (n = 5/group).

(E) Total thymic amounts of BMP4 and IL-23 assessed by ELISA at day 7 (n = 4–5/group, representative of two independent experiments).

(F) Total number of cTECs and mTECs (n = 15/group across three independent experiments).

(G) Flow plots showing CD4 and CD8 expression in the spleen at day 56 after SL-TBI (gated on CD45+CD3+ cells).

(H) Total number of CD4+ and CD8+ T cells in the spleen at d56 (n = 5/group).

(I) Plots of CD62L and CD44 on CD4+ and CD8+ T cells (gated on either CD45+CD3+CD4+CD8− or CD45+CD3+CD4−CD8+) cells; plots concatenated of all samples in a given experiment).

(J) Ratio of number of naive (CD62Lhi CD44lo) CD4+ or CD8+ to CD4+ or CD8+ EM (CD62Lhi CD44hi) T cells (n = 5/group).

Experiments in (C)–(J) were performed only in WT mice. Graphs represent mean ± SEM; each dot represents a biologically independent observation. See also Figure S5.

DISCUSSION

Despite its importance for generating a competent repertoire of T cells, the thymus is exquisitely sensitive to acute injury such as that caused by infection, shock, or common cancer therapies such as cytoreductive chemo- or radiation therapy; however, it also has a remarkable capacity for repair (Dudakov et al., 2012; Gruver and Sempowski, 2008). Even in the clinical setting where children who have had large parts of their thymus removed exhibit significant thymic repair (van den Broek et al., 2016). Of note, the general phenomena of endogenous thymic regeneration has been known for longer even than its immunological function (Jaffe, 1924; Miller, 1961); however, the underlying mechanisms controlling this process are poorly understood (Chidgey et al., 2007; Dudakov et al., 2010). Thus, endogenous thymic regeneration is a critical process to restore immune competence following thymic injury, although acute and profound thymic damage such as that caused by common cancer cytoreductive therapies, conditioning regimes as part of hematopoietic cell transplantation (HCT), or age-related thymic involution lead to prolonged T cell deficiency, precipitating high morbidity and mortality from opportunistic infections and may even facilitate cancer relapse (Bosch et al., 2012; Clave et al., 2013; Dudakov et al., 2016; Komanduri et al., 2007; Legrand et al., 2007; Mackall, 2000; Mackall et al., 1995; Parkman and Weinberg, 1997; Pizzo et al., 1991; van den Brink et al., 2018; Weinberg et al., 1995; Williams et al., 2007). Recent studies have shown that thymic ILCs and ECs have profound reparative effects in the thymus after acute injury through their production of the regeneration-associated factors IL-22 and BMP4, respectively, both of which act by stimulating TECs (Dudakov et al., 2012, 2017; Wertheimer et al., 2018). Although activation of these reparative programs was linked with the depletion of thymocytes, hinting at an innate trigger of regeneration, the mechanisms that controlled this response were unclear. In this study, we reveal that apoptotic thymocytes, which are abundant as a result of selection events during tolerance induction (Hernandez et al., 2010; Jameson et al., 1995), signaling through TAM receptors and the downstream activation of Rac1 GTPase, NOD2, and miR29c, actively suppresses the steady-state production BMP4 and IL-23, the upstream regulator of IL-22 production. One of the ways that apoptotic cells are detected is via the receptor tyrosine kinases Tyro3, Axl, and Mertk (TAM). TAM receptors are pivotal mediators of innate immunity, detecting exposed PtdSer on apoptotic cells via the intermediaries Gas6 or Pros1 (Lemke and Rothlin, 2008; Rothlin et al., 2015). In addition to being crucial for promoting phagocytosis of apoptotic cells, TAM receptor signaling has been also shown to limit the innate immune response, particularly in the suppression of cytokine production (Chan et al., 2016; Rothlin et al., 2007). However, TAM receptors can also act as a rheostat for controlling the activity of pleiotropic cytokines such as IL-4 and IL-13 (Bosurgi et al., 2017). This framework for TAM receptor regulation of immune responses is consistent with our findings that PtdSer detection by TAM receptors on thymic ECs and DCs inhibits their expression of BMP4 and IL-23, respectively. However, after damage, the loss of thymocytes (and their exposed PtdSer) attenuates this tonic signaling, inducing the production of regenerative factors. Moreover, given the passive activation of this pathway, this acts as a “dead-man’s switch” that ensures faithful regulation and activation of the regeneration program in settings of damage. Notably, while expression of Nod2 in the thymus has been known for some time (Iwanaga et al., 2003), it has thus far only been functionally linked to positive selection and maturation of CD8+ T cells by facilitating TCR-ERK signaling (Martinic et al., 2017). Reports suggest that NOD2 can control the production of IL-23 by DCs via miR29, which directly regulated the transcription of Il12p40 and indirectly through Il23p19 (Brain et al., 2013). The three members of the miR29 family have overlapping physiological roles, and a role for TEC-intrinsic miR29a/b has been described in tuning the epithelial response to injury by controlling IFN receptor expression (Papadopoulou et al., 2011). However, here, we revealed that EC and DC-intrinsic miR29c facilitates NOD2-mediated suppression of thymic regeneration directly by suppressing Bmp4 expression, and indirectly regulating both p19 and p40 subunits of IL-23. Although we can detect all three miR29 family members in DP thymocytes, ECs, and DCs, expression of miR29c-5p was significantly higher in ECs and DCs, and there was a targeted decrease in expression within ECs and DCs after TBI but not DPs thymocytes. The canonical ligands for NOD2 are peptidoglycans found in the cell wall of bacteria (Caruso et al., 2014); however, these are unlikely to serve as a NOD2 activator in the thymus since it is typically thought of as a sterile organ (Nunes-Alves et al., 2013). One recently described alternate function of NOD2 is as a cytosolic sensor of activated Rho GTPases (Keestra et al., 2013; Keestra-Gounder and Tsolis, 2017; Legrand-Poels et al., 2007). This is especially notable given the role that Rho-GTPase activation plays in TAM receptor signaling (Mao and Finnemann, 2015; Todt et al., 2004; Wu et al., 2005). The Rho GTPase family is responsible for a wide range of physiological processes (Hodge and Ridley, 2016; Van Aelst and D’Souza-Schorey, 1997; Wennerberg and Der, 2004), including the intrathymic regulation by Rac1, RhoA, and Cdc42 of β-selection and positive selection (Gomez et al., 2001; Gomez et al., 2000). Rho GTPases including RhoA, Rac1, and Cdc42 can be activated by caspase-3 during apoptosis (Coleman and Olson, 2002; Krieser and Eastman, 1999; Na et al., 1996) and themselves further promote apoptosis (Koyanagi et al., 2008; Lacal, 1997; Sanno et al., 2010), including in thymocytes that do not successfully express a pre-TCR (Dumont et al., 2009). Notably, both NOD2-miR29 and apoptotic cells have been identified to negatively regulate the production of IL-23 by DCs (Brain et al., 2013; Municio et al., 2011). Prolonged thymic repair following everyday insults represents an important clinical problem in older patients. Several strategies targeting Rho GTPases have been examined pre-clinically for multiple cancers. These include small molecules targeting the spatial regulation of GTPase activators (Mazieres et al., 2004), and Rho-GEF interactions, such as Rhosin (Shang et al., 2012) and EHT1864 (Shutes et al., 2007). Furthermore, there is considerable interest in the effect of ROCK inhibition on T cell function, particularly during graft versus host disease and autoimmunity (Flynn et al., 2016; Jagasia et al., 2021; Ricker et al., 2016; Zanin-Zhorov et al., 2014). We have found that these Rho-GTPase pathways can be effectively targeted therapeutically to boost thymic function and peripheral T cell reconstitution. Several Rho GTPases, including Rac1, RhoA, and Cdc42, play a role in T cell development (Gomez et al., 2001; Gomez et al., 2000), notably during stages of selection when there are high levels of apoptosis (Hernandez et al., 2010), implying a potential down-side to Rho GTPase inhibition. However, given the proposed therapeutic window coincides with when thymocytes are largely absent, together with the redundancy of Rac1 and Rac2 in T cell development (Guo et al., 2008), Rac1 inhibition represents a promising therapeutic strategy for boosting immune function. Interestingly, although deletion of Rac1 in TECs promotes thymic atrophy (Hunziker et al., 2011), given that Rac1 deletion also enhances myc expression that has been shown to expand TEC numbers (Cowan et al., 2019), the functional consequences of Rac1 inhibition in TECs will need to be carefully evaluated. In summary, these findings not only uncover mechanisms governing endogenous thymic repair; considering the previously highlighted roles of BMP signaling as well as the IL-23/IL-22 axis in the repair of several tissues, such as intestine, liver, bone, muscle, and skin (Dudakov et al., 2015; Parikh et al., 2011; Schmidt-Bleek et al., 2016), these findings outline a potentially globally applicable pathway triggering tissue regeneration. Furthermore, by targeting this pathway pharmacologically, we propose a therapeutic intervention that could be used to boost immune function in patients whose thymus has been damaged due to age, cytoreductive therapies, infection, or other causes.

STAR★METHODS

Detailed methods are provided in the online version of this paper and include the following:

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be filled by the Lead Contact, Jarrod Dudakov (jdudakov@fredhutch.org).

Materials availability

This study did not generate new unique reagents.

Data and code availability

The microarray and RNA sequencing datasets described in this manuscript have been deposited in GEO and are available as of the date of publication at GEO: GSE106982, GSE160989, and GSE183056. This manuscript does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice

Inbred male and female C57BL/6J mice were obtained from the Jackson Laboratories (Bar Harbor, USA). Nod2−/− (B6.129S1-Nod2/J) mice were obtained from Jackson Laboratories and bred in house. Rac1 flox mice (Rac1tm1Djk/J) and CD11c-Cre-GFP line (C57BL/6J-Tg(Itgax-cre,-EGFP)4097Ach/J) were obtained from Jackson Laboratories and crossed in house to generate Rac1fl/fl*CD11c-Cre. All experimental mice were between 6–8 weeks old. To induce thymic damage, mice were given sub-lethal total body irradiation (SL-TBI) at a dose of 550 cGy from a cesium source mouse irradiator (Mark I series 30JL Shepherd irradiator) with no hematopoietic rescue. For in vivo studies of EHT-1864 administration, mice were given SL-TBI (550cGy) and subsequently received i.p. injections of 40 mg/kg EHT1864 (3872, Tocris, UK), or 1 × PBS as control, on days 3, 5 and 7 following TBI. Mice were maintained at the Fred Hutchinson Cancer Research Center (Seattle, WA), and acclimatized for at least 2 days before experimentation, which was performed per Institutional Animal Care and Use Committee guidelines.

Cell isolation

Single cell suspensions of freshly dissected thymuses were obtained and either mechanically suspended or enzymatically digested using 0.15% Collagenase D (Sigma, 11088882001) and 0.1% DNase 1 (Sigma, 10104159001) in DMEM, as previously described (Dudakov et al., 2012; Velardi et al., 2014), and counted using the Z2 Coulter Particle and Size Analyzer (Beckman Coulter, USA). For studies sorting rare populations of cells in the thymus, multiple identically-treated thymuses were pooled so that sufficient number of cells could be isolated; however, in this instance separate pools of cells were established to maintain individual samples as biological replicates.

Generation of exECs

exECs were generated as previously described (Seandel et al., 2008). Briefly, CD45−CD31+ cells were FACS purified and incubated with lentivirus containing either the E4ORF1 or myrAkt construct for 48 hours. Cell culture medium containing 20% FBS (SH30066.03, HyClone, GE Life Sciences), 10 mM HEPES (15630–080, Invitrogen), 1% Glutamax (35050061, Life Technologies), 1% Non-Essential Amino Acids (11140050, Life Technologies), 1% PenStrep (15240–062, Invitrogen), 50 ug/ml Heparin (H3149, Sigma), 50 ug/ml Endothelial Cell Supplement (02–102, Millipore-Sigma), 5 μM SB431542 (1614/10, R&D Systems), 20 ng/ml FGF (100–18B, Peprotech) and 10 ng/ml VEGF (450–32, Peprotech) at 37°C, 5% O2, 5% CO2 in a HERAcell 150i incubator (Thermo Fisher, USA).

METHOD DETAILS

Reagents

Cells were stained with the following antibodies for analysis CD3-FITC (35–0031, Tonbo Bioscience), CD8-BV711 (100748, BioLegend), CD4-BV650 (100546, BioLegend), CD45-BUV395 (565967, BD Biosciences), CD90-BV785 (105331, BioLegend), CD11c-APC (20–0114, Tonbo Biosciences), MHC-II-Pac Blue (107620, BioLegend), CD103-PercPCy5.5 (121416, BioLegend), CD11b-A700 (557960, BD PharMingen), EpCAM-PercPe710 (46–5791-82, eBioscience), Ly51-PE (12–5891-83, eBioscience), CD31-PECy7 (25–0311-82, eBioscience), CD140a-APC (135907, BioLegend), UEA1-FITC (FL-1061, Vector Laboratories), TCRbeta-PECy7 (109222, BioLegend), CD62L-APC-Cy7 (104427, BioLegend), CD44-Alexa Fluor RTM700 (56–0441-82, BioLegend), CD25-PercP-Cy5.5 (102030, BioLegend). Annexin V staining (640906, BioLegend) was performed in Annexin V binding buffer (422201, BioLegend). Flow cytometric analysis was performed on an LSRFortessa X50 (BD Biosciences) and cells were sorted on an Aria II (BD Biosciences) using FACSDiva (BD Biosciences) or FlowJo (Treestar Software).

In vitro cell culture

Co-culture experiments were carried out using exECs or DCs and thymocytes harvested from mechanically dissociated thymus from untreated mice, or in the case of DC analysis whole thymus cultures were used. Harvested thymocytes were incubated with either 100 nM dexamethasone (D2915, Sigma Aldrich, Germany), or 20 μM z-VAD-FMK (2163, Tocris, UK) for 4 hours at 37°C prior to co-culture, washed twice with PBS, and resuspended in exEC media for co-culture (1 × 106 cells / well). Cells were harvested 20 hours post co-culture and prepared for either qPCR analysis or flow cytometry analysis. Thymic DCs were isolated from untreated mice using CD11c UltraPure microbeads (130–108-338, Miltenyi Biotech, USA), on enzymatically digested thymuses. DCs were cultured in DMEM (11965, GIBCO), 10% FBS (SH30066.03, HyClone, GE Life Sciences), and 1% PenStrep (15240–062, Invitrogen). For TAM receptor inhibitor studies, exECs were treated with 25 μM RXDX-106 (CEP-40783, s8570, Selleck Chemicals) 30 minutes prior to incubation with dexamethasone treated or z-VAD-FMK treated thymocytes, and Bmp4 expression was determined by qPCR analysis 20 h post co-culture. HEK293 cells (ATCC, Manassas, VA) were cultured in DMEM (11965, GIBCO), 10% FBS (SH30066.03, HyClone, GE Life Sciences), 1% Glutamax (35050061, Life Technologies), and 1% PenStrep (15240–062, Invitrogen).

ELISA

Thymuses were homogenized in RIPA buffer (25 mM Tris pH 7.6, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.05% sodium deoxycholate, 0.5 mM EDTA) with protease inhibitors (Thermo, A32955), using a Homogenizer 150 (Fisher Scientific) at a concentration of 10 mg/ml, where protein concentration was further normalized using BCA assay. BMP4 (DY485–05, R&D Systems) and IL-23 (433704, BioLegend) levels were assessed by ELISA, and absorbance was measured on the Tecan Spark 10M (Tecan, Switzerland).

Transcriptome analysis

Microarray analysis was performed on an Affymetrix MOE 430 A 2.0 platform in triplicate for untreated as well as day 4 ECs after TBI. RNaseq was performed on freshly isolated and FACS purified DCs. To obtain sufficient RNA for every time point, thymi of several mice were pooled. All samples underwent a quality control on a bioanalyzer to exclude degradation of RNA. GSEA analysis was performed using the GSEA tool v4.1 of the Broad Institute (https://www.gsea-msigdb.org/gsea). Comparisons were made to known signaling pathways from the Gene Expression Omnibus (GEO) database (GSE226611). Pathway analysis was performed by submitting genes changed > 1.5 (p < 0.05) to DAVID Bioinformatics Resource v6.8(Huang da et al., 2009a, b). Transcriptome data generated from ECs and DCs at day 4 after TBI will be deposited in the GEO. EC data was generated concurrently to untreated day 0 EC data, which has already been deposited to the GEO under number GSE106982 (Wertheimer et al., 2018). The full EC dataset is available under accession numbers GSE106982 and GSE160989, while the DC sequencing data is available under accession number GSE183056.

qPCR

RNA was extracted from exECs or DCs using a RNeasy Mini kit (74104, QIAGEN), and from sorted cells using a RNeasy Plus Micro kit (74034, QIAGEN). cDNA was synthesized using the iScript gDNA Clear cDNA Synthesis kit (1725035, Bio-Rad, USA) and a Bio-Rad C1000 Touch ThermoCycler (Bio-Rad). RNA expression was assessed in the Bio-Rad CFX96 Real Time System (Bio-Rad), using iTaq Universal SYBR Green Supermix (1725122, Bio-Rad), and the following primers: B-Actin (F 5′-CACTGTCGAGTCGCGTCC-3′; R 5′-TCATCCATGGCGAACTGGTG-3′); Il12p40 (F 5′-AAGGAACAGTGGGTGTCCAG-3′, R 5′-CATCTTCTTCAGGCGTGTCA-3′); Il23p19 (F 5′-GACTCAGCCAACTCCTCCAG-3′; R 5′-GGCACTAAGGGCTCAGTCAG-3′); Bmp4 (qMmuCED0046239, Bio-Rad). miRNA was extracted from cells using an miRNeasy Mini kit (217004, QIAGEN) or miRNeasy Micro kit (1071023, QIAGEN), and cDNA was synthesized using a Taqman Advanced miRNA cDNA Synthesis kit (A28007, Thermo Fisher). miRNA expression was measured on a Bio-Rad CFX96 Real Time System (Bio-Rad), using Taqman Advanced Master Mix (4444557, Thermo Fisher) and the following primers (Thermo Fisher): miR29a-3p (mmu478587_mir); miR29b-3p (mmu481300_mir); miR29c-3p (mmu479229_mir), miR29a-5p (mmu481032_mir), miR29b-5p (mmu481675_mir), miR29c-5p (mmu481034_mir).

miRNA mimic and inhibition

miRNA overexpression or inhibition was carried out by transfection of 50 μM miRVANA miRNA mimic (4464066, Thermo Fisher) or 100 μM miRCURY LNA-inhibitor (YI04105459, Exiqon) for miR29c-5p or miR29c-3p. Transfections were carried out using Lipofectamine 2000 (11668030, Thermo Fisher) in Opti-MEM™ reduced serum media (31985070, GIBCO) for DCs, and using Nucleofector electroporation kit (VPI-1001, Lonza) for exECs (Program M-003, Nucleofector 2b, Lonza).

Luciferase assays

HEK293 cells (ATCC, Manassas, VA) were co-transfected with 100 mM miR29c-5p miRVANA miRNA mimic (4464066, ThermoFisher) using Lipofectamine and one of the following Luciferase vectors, using RNAifectin (G073, Abm); Blank-Luc [pLenti-Ubc-UTR-Dual-Luc-Blank vector (C047, Abm)]; BMP4–3′UTR [pLenti-Ubc-3′UTR-Dual-Luciferase (MT-m02780-Custom)]; IL12B-5′UTR [pLenti-Ubc-IL12B-5′UTR-Dual-luciferase]; IL23A-3′UTR [pLenti-Ubc-Dual-Luciferase (MT-M10060-Custom)]. Luciferase activity was measured after 24 hours using the Dual-Glo® Luciferase Assay System (E2920, Promega) on a Veritas microplate Luminometer (Turner BioSystems, USA).

Rho GTPase activation assays

Activated Rac1 was measured using the absorbance-based G-LISA Rac1 Activation Assay Biochem Kit (BK128, Cytoskeleton, USA). Briefly, exECs were co-cultured with thymocytes harvested from untreated mice, as described above. 24 hours after co-culture the exECs were harvested rapidly on ice, aliquoted and snap frozen using liquid nitrogen. Lysate volumes were subsequently adjusted for equal protein levels following BCA assay (23227, Pierce BCA protein assay kit, Thermo Fisher, USA), and GTP-bound Rac1 levels were assessed according to the manufacturers protocol. Plates were read at 490 nm on a Spark 10M plate reader (Tecan, Switzerland).

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis between two groups was performed with unpaired two-tailed t test. Statistical comparison between 3 or more groups in Figures 3F, 3H, 3K, and 4A was performed using a one-way ANOVA with Dunnett’s or Tukey’s multiple comparison test. Studies described in Figures 2C–2F, 3A, 3B, 3I, 3J, and 3L used paired analyses. All statistics were calculated using Graphpad Prism and display graphs were generated in Graphpad Prism or R. Information on replicates, error bars and statistical significance can be found in the figures and their corresponding legends.
KEY RESOURCES TABLE
Reagent or resourceSourceIdentifier

Antibodies

CD3-FITCTonbo Biosciences35-0031; RRID:AB_2621659
CD8-BV711BioLegend100748; RRID:AB_2562100
CD4-BV650BioLegend100546; RRID:AB_2562098
CD45-BUV395BD Biosciences565967; RRID:AB_2739420
CD90-BV785BioLegend105331; RRID:AB_2562900
CD11c-APCTonbo Biosciences20-0114; RRID:AB_2621557
MHC-II-Pac BlueBioLegend107620; RRID:AB_493527
CD103-PercPCy5.5BioLegend121416; RRID:AB_2128621
CD11b-A700BD PharMingen557960; RRID:AB_396960
EpCAM-PercPe710eBioscience46-5791-82; RRID:AB_10598205
Ly51-PEeBioscience12-5891-83; RRID:AB_466016
CD31-PECy7eBioscience25-0311-82; RRID:AB_2716949
CD140a-APCBioLegend135907; RRID:AB_2043969
UEA1-FITCVector LaboratoriesFL-1061; RRID:AB_2336767
TCRbetaPECy7BioLegend109222; RRID:AB_893625
CD62L-APC-Cy7BioLegend104427; RRID:AB_830798
CD44-Alexa Fluor RTM700eBioscience56-0441-82; RRID:AB_494011
CD25-PercP-Cy5.5BioLegend102030; RRID:AB_893288
Annexin VBioLegend640906

Bacterial and virus strains

DH5alpha competent cellsSigma18265017

Biological samples

Mouse: thymus & spleen harvested from C57BL/6J & B6.129S1-Nod2tm1Flv/J miceThis paperN/A

Chemicals, peptides, and recombinant proteins

EHT1864Tocris, UK3872
RXDX-106 (CEP-40783)Selleck Chemicalss8570
z-VAD-FMKTocris, UK2163
DexamethasoneSigma Aldrich, GermanyD2915
Lipofectamine 2000Thermo fisher11668019
RNAifectinAbm, Btitish Columbia, CanadaG073
OptiMEM reduced serum mediaGIBCO31985070

Critical commercial assays

BMP4 ELISAR&D systemsDY485-05
IL-23 ELISABioLegend433704
G-LISA Rac1 Activation Assay Biochem KitCytoskeleton, USABK128
Pierce BCA protein assay kitThermo Fisher23227
RNeasy Mini kitQIAGEN74104
Rneasy Plus Micro KitQIAGEN74034
miRNeasy Mini kitQIAGEN217004
miRNeasy Micro kitQIAGEN1071023
iScript gDNA Clear cDNA synthesis kitBio-Rad1725035
Dual-Glo® Luciferase Assay SystemPromegaE2920
iTaq Universal SYBR Green SupermixBio-Rad1725122
Taqman Advanced miRNA cDNA Synthesis kitThermo FisherA28007
Nucleofector endothelial electroporation kitLonzaVPI-1001

Deposited data

EC microarray data (Day 0) Wertheimer et al. (2018) GEO: GSE106982
EC microarray data (Day 4)This paperGEO: GSE160989
DC RNA sequencingThis paperGEO: GSE183056

Experimental models: Cell lines

exEC: purified thymic endothelial cells transduced with pCCL-PGK-myrAkt vectorBrandon Hadland, Fred Hutchinson Cancer Research CenterN/A
exEC: purified thymic endothelial cells transduced with E4orf1 viral geneShahin Rafii, Weill Cornell Medical CollegeN/A
HEK293ATCCCRL-1573

Experimental models: Organisms/strains

Mouse: C57BL/6JJackson Laboratories0006644
Mouse: Nod2−/− (B6.129S1-Nod2tm1Flv/J)Jackson Laboratories005763
Mouse: Rac1fl/fl*CD11c CreJackson LaboratoriesRac1fl/fl, 005550; CD11c-cre, 007567

Oligonucleotides

B-Actin – F (CACTGTCGAGTCGCGTCC)IDTN/A
B-Actin – R (TCATCCATGGCGAACTGGTG)IDTN/A
Il12p40 – F (AAGGAACAGTGGGTGTCCAG)IDTN/A
Il12p40 – R (CATCTTCTTCAGGCGTGTCA)IDTN/A
Il23p19 – F (GACTCAGCCAACTCCTCCAG)IDTN/A
Il23p19 – R (GGCACTAAGGGCTCAGTCAG)IDTN/A
Bmp4Bio-RadqMmuCED0046239
miR29a-3pThermo Fishermmu478587_mir
miR29b-3pThermo Fishermmu481300_mir
miR29c-3pThermo Fishermmu479229_mir
miR29a-5pThermo Fishermmu481032_mir
miR29b-5pThermo Fishermmu481675_mir
miR29c-5pThermo Fishermmu481034_mir

Recombinant DNA

pLenti-Ubc-UTR-Dual-Luc-BlankAbm custom vectorN/A
pLenti-Ubc-3′UTR-Dual-Luciferase (GAATTCACTAGTACCGGTAGGCCTGTCGACGATATCGGGCCCGCGGCCGCTGGATCCTCTAGACTCGAG)Abm custom vectorN/A
pLenti-Ubc-IL12B-5′UTR-Dual-luciferase (GGCGCGCCACTAGTACCGGTAGGCCTGTCGACGATATCGGGCCCGCGGCCGCTGGATCC)Abm custom vectorN/A
pLenti-Ubc-IL23A-3′UTR-Dual-Luciferase (GGATTCACTAGTACCGGTAGGCCTGTCGACGATATCGGGCCCGCGGCCGCTGGATCCTCTAGACTCGAG)Abm custom vectorN/A
pCCL-PGK-myrAkt vectorBrandon Hadland, Fred Hutchinson Cancer Research CenterN/A

Software and algorithms

GSEA tool v4.1Broad Institute https://www.gsea-msigdb.org/gsea
Prism v8.0GraphPad Software https://www.graphpad.com
FlowJo v9BD https://www.flowjo.com/
BioRenderBioRender https://app.biorender.com

Other

TECAN Spark 10MTecan, SwitzerlandSpark 10M
Z2 Coulter Particle and Size AnalyzerBeckman Coulter, USAN/A
Bio-Rad CFX96 Real Time SystemBio-RadN/A
LuminometerTurner Biosystems, USAVeritas microplate Luminometer
Amaxa Nucleofector (Program M-003)LonzaNucleofecotr 2b
IrradiatorFred Hutchinson Cancer Research CenterMark I series 30JL Shepherd irradiator
  95 in total

1.  The GTPase Rac-1 controls cell fate in the thymus by diverting thymocytes from positive to negative selection.

Authors:  M Gomez; D Kioussis; D A Cantrell
Journal:  Immunity       Date:  2001-11       Impact factor: 31.745

Review 2.  The child with cancer and infection. II. Nonbacterial infections.

Authors:  P A Pizzo; M Rubin; A Freifeld; T J Walsh
Journal:  J Pediatr       Date:  1991-12       Impact factor: 4.406

3.  Modulation of Nod2-dependent NF-kappaB signaling by the actin cytoskeleton.

Authors:  Sylvie Legrand-Poels; Gaelle Kustermans; Françoise Bex; Elisabeth Kremmer; Thomas A Kufer; Jacques Piette
Journal:  J Cell Sci       Date:  2007-03-13       Impact factor: 5.285

Review 4.  Rho GTPases and signaling networks.

Authors:  L Van Aelst; C D'Souza-Schorey
Journal:  Genes Dev       Date:  1997-09-15       Impact factor: 11.361

Review 5.  The function of the thymus and its impact on modern medicine.

Authors:  Jacques F A P Miller
Journal:  Science       Date:  2020-07-31       Impact factor: 47.728

6.  The effect of thymic function on immunocompetence following bone marrow transplantation.

Authors:  K Weinberg; G Annett; A Kashyap; C Lenarsky; S J Forman; R Parkman
Journal:  Biol Blood Marrow Transplant       Date:  1995-11       Impact factor: 5.742

7.  The Bacterial Peptidoglycan-Sensing Molecules NOD1 and NOD2 Promote CD8+ Thymocyte Selection.

Authors:  Marianne M Martinic; Irina Caminschi; Meredith O'Keeffe; Therese C Thinnes; Raelene Grumont; Steve Gerondakis; Dianne B McKay; David Nemazee; Amanda L Gavin
Journal:  J Immunol       Date:  2017-02-15       Impact factor: 5.422

8.  MerTK regulates thymic selection of autoreactive T cells.

Authors:  Mark A Wallet; Rafael R Flores; Yaming Wang; Zuoan Yi; Charles J Kroger; Clayton E Mathews; H Shelton Earp; Glenn Matsushima; Bo Wang; Roland Tisch
Journal:  Proc Natl Acad Sci U S A       Date:  2009-02-27       Impact factor: 11.205

9.  ROCK2 Inhibition With Belumosudil (KD025) for the Treatment of Chronic Graft-Versus-Host Disease.

Authors:  Madan Jagasia; Aleksandr Lazaryan; Carlos R Bachier; Amandeep Salhotra; Daniel J Weisdorf; Behyar Zoghi; James Essell; Laurie Green; Olivier Schueller; Jeegar Patel; Alexandra Zanin-Zhorov; Jonathan M Weiss; Zhongming Yang; David Eiznhamer; Sanjay K Aggarwal; Bruce R Blazar; Stephanie J Lee
Journal:  J Clin Oncol       Date:  2021-04-20       Impact factor: 50.717

10.  Manipulation of small Rho GTPases is a pathogen-induced process detected by NOD1.

Authors:  A Marijke Keestra; Maria G Winter; Josef J Auburger; Simon P Frässle; Mariana N Xavier; Sebastian E Winter; Anita Kim; Victor Poon; Mariëtta M Ravesloot; Julian F T Waldenmaier; Renée M Tsolis; Richard A Eigenheer; Andreas J Bäumler
Journal:  Nature       Date:  2013-03-31       Impact factor: 49.962

View more
  2 in total

1.  Eosinophils are an essential element of a type 2 immune axis that controls thymus regeneration.

Authors:  Emilie J Cosway; Andrea J White; Sonia M Parnell; Edina Schweighoffer; Helen E Jolin; Andrea Bacon; Hans-Reimer Rodewald; Victor Tybulewicz; Andrew N J McKenzie; William E Jenkinson; Graham Anderson
Journal:  Sci Immunol       Date:  2022-03-11

2.  Activation of the zinc-sensing receptor GPR39 promotes T-cell reconstitution after hematopoietic cell transplant in mice.

Authors:  Lorenzo Iovino; Kirsten Cooper; Paul deRoos; Sinéad Kinsella; Cindy Evandy; Tamas Ugrai; Francesco Mazziotta; Kathleen S Ensbey; David Granadier; Kayla Hopwo; Colton Smith; Alex Gagnon; Sara Galimberti; Mario Petrini; Geoffrey R Hill; Jarrod A Dudakov
Journal:  Blood       Date:  2022-06-23       Impact factor: 25.476

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.