Literature DB >> 34540167

Distribution of ciprofloxacin-resistance genes among ST131 and non-ST131 clones of Escherichia coli isolates with ESBL phenotypes isolated from women with urinary tract infection.

Masoumeh Rasoulinasab1, Fereshteh Shahcheraghi1, Mohammad Mehdi Feizabadi2,3, Bahram Nikmanesh4, Azade Hajihasani1, Mohammad Mehdi Aslani1.   

Abstract

BACKGROUND AND OBJECTIVES: Escherichia coli (E. coli) sequence type 131 (ST131) is associated with extended-spectrum beta-lactamase (ESBL) production and fluoroquinolone resistance. This study aimed to investigate the prevalence of ST131, ESBL, and plasmid-mediated quinolone resistance (PMQR) genes in the ciprofloxacin-resistant (CIPR) and ESBL producers from women with UTI.
MATERIALS AND METHODS: The CIP-resistant ESBL producing (CIPR/ESBL+) E. coli isolates were screened for ST131-by specific PCR of mdh and gyrB. The ESBL and PMQR genes were screened by single PCR. The ST131 and non-ST131 isolates were selected to determine the mutations of gyrA and parC using PCR and sequencing, and also their genetic background by the Pasteur-MLST scheme.
RESULTS: Overall, 55% (33/60) CIPR/ESBL+ isolates were identified as ST131 (94% O25b-ST131). Resistance rate to ampicillin-sulbactam (70%), aztreonam (97%) and gentamicin (61%), the prevalence of aac(6')-Ib-cr (66%), bla CTX-M-15 (82%), the profile of qnrS+aac(6')-Ib-cr (30%), and the double mutation in the parC was significantly higher in ST131 than non- ST131 isolates. The coexistence of PMQR and ESBL genes was found in more than 50% of ST131 and non-ST131 isolates. ST131 isolates differentiated into PST43 and PST506.
CONCLUSION: Management of women with UTI caused by the CIPR/ESBL+ isolates (ST131) co-harbored PMQR, ESBL, and chromosomal mutations, is important for their effective therapy.
Copyright © 2021 The Authors. Published by Tehran University of Medical Sciences.

Entities:  

Keywords:  Beta-lactamase CTX-M-15; Fluoroquinolones; Multilocus sequence typing; Urinary tract infections; Uropathogenic Escherichia coli

Year:  2021        PMID: 34540167      PMCID: PMC8416580          DOI: 10.18502/ijm.v13i3.6389

Source DB:  PubMed          Journal:  Iran J Microbiol        ISSN: 2008-3289


INTRODUCTION

Urinary tract infection (UTI) is one of the most common bacterial infections encountered in clinical practice after respiratory and gastrointestinal infections (1). Women are at increased risk for developing UTI because of their anatomy, shorter urethra and pregnancy (2). Antibiotic therapy of complicated UTI has become problematic because of the inappropriate use of antibiotics, the emergence and dissemination of antibiotic-resistant clones e.g. sequence type 131 (ST131) and subsequently reduced therapeutic choices for UTI (2, 3). Escherichia coli ST131 is one of the most important causes of community- and hospital-acquired UTI. According to the Achtman- multilocus sequence typing (MLST) system, ST131 designated as globally multidrug-resistant (MDR) clone with high virulence potential, has emerged dramatically over the past decade (4). The majority of ST131 strains belonged to phylogenetic group B2 and serotype O25b:H4. ST131 exhibits multi-resistance to different antibiotics classes such as trimethoprim/sulfamethoxazole, aminoglycosides, 3rd-generation cephalosporins and fluoroquinolones (FQs). ST131 lineage is associated with extended-spectrum beta-lactamas (ESBL) production and main cause of the spread of CTX-M-15 ESBL gene variant. Prevalence of E. coli ST131 accounted for over 50% of ESBL-producing or FQ-resistant (FQR) isolates in Asia and the US (5, 6). The FQs e. g. ciprofloxacin (CIP), a class of bactericidal/broad-spectrum antibiotics, are being used frequently as a potent and first–line drug in the treatment of UTI caused by E. coli. The major mechanism of FQ-resistance is chromosomal mutations in regions so-called quinolone resistance-determining regions (QRDR). Besides, plasmid-mediated quinolone resistance (PMQR) has been increasingly reported over the past decade worldwide. The PMQR is often mediated by quinolone resistance (Qnr) proteins and aminoglycoside acetyltransferase [FQ-modifying enzyme; aac(6′)-Ib-cr variant] (7, 8). PMQR genes often have a strong association with the ESBL genes and are typically located on the plasmids contributing to the spread of MDR isolates. Therefore, the emergence and rapid global spread of ST131, and infections caused by ST131 co-harboring ESBLs and PMQR genes that reduced therapeutic choices for UTI become a major therapeutic problem (9). The main purpose of the current study was to assess the coexistence of PMQR with ESBL genes, and chromosomal mutations in the CIPR ESBL producing ST131 (CIPR/ESBL+) isolates, and compared with non-ST131 isolates from women with UTIs. Also, the allele profiles of Pasteur-MLST (P-MLST) of selective isolates were determined to a comprehensive understanding of the population structure of CIPR/ ESBL+ isolates.

MATERIALS AND METHODS

Place and duration of the study.

The current study was carried out in the Microbiology Department at Pasteur Institute of Iran (Tehran) during 2017–2019. This study was approved by the Ethical Committee of the Pasteur Institute of Iran (Ethical code: IR.PII. REC.1396.20). Written informed consent was provided by all the patients.

E. coli isolates.

A total of 215 E. coli isolates were obtained from the urine of women with symptomatic UTIs at referral university hospitals in Tehran. The patients included in the study were in different age groups. The E. coli isolates were identified by using conventional bacteriology tests (10). All isolates was screened by ST131-specific PCR for mdh and gyrB genes (11) and an O25b-ST131-specific PCR for the pabB gene (12) using sets of specific primers (Table 1).
Table 1.

Characteristics of primers used in this study

Primer Sequence (5′– 3′) Target gene Product length (bp) Annealing temp (ºC) Reference
Mdh36F: GTTTAACGTTAACGCCGGT mdh 27065(11)
R: GGTAACACCAGAGTGACCA
GyrBF:CGCGATAAGCGCGAC gyrB 13265(11)
R: ACCGTCTTTTTCGGTGGAA
O25pabBspeF: TCCAGCAGGTGCTGGATCGT PabB 34763(12)
R: GCGAAATTTTTCGCCGTACTGT
CTX-M-15F: CACACGTGGAATTTAGGGACT bla CTX-M-15 99555(13)
R: GCCGTCTAAGGCGATAAACA
TEMF: ATGAGTATTCAACATTTCCGTG bla TEM 86156(14)
R: TTACCAATGCTTAATCAGTGAG
SHVF: TTATCTCCCTGTTAGCCACC bla SHV 79557(15)
R: GATTTGCTGATTTCGCTCGG
QnrBF: GGMATHGAAATTCGCCACTG qnrB 26457(16)
R: TTTGCYGYYCGCCAGTCGAA
QnrSF: GCAAGTTCATTGAACAGGCT qnrS 42857(16)
R: TCTAAACCGTCGAGTTCGGCG
QnrAF: AGAGGATTTCTCACGCCAGG qnrA 61957(17)
R: GCAGCACTATKACTCCCAAGG
AACF: ATGACTGAGCATGACCTTGC aac(6′)Ib-cr 51955(18)
R: TTAGGCATCACTGCGTGTTC
ParCF: TGCGTTGCCGTTTATTGG parC 47056(19)
R: GCAGGTTATGCGGTGGAAT
GyrAF: GCGATGTCGGTCATTGTT gyrA 49056(19)
R: ACTTCCGTCAGGTTGTGC

bp, base pair; F, forward; R, reverse

Characteristics of primers used in this study bp, base pair; F, forward; R, reverse

Phenotypic identification of CIP-resistant ESBL producers.

The primary ESBL screening of the E. coli isolates was accomplished by the Clinical and Laboratory Standards Institute (CLSI) guidelines (20) through the Kirby-Bauer disc diffusion method using cefotaxime and ceftazidime (30 μg each). The ESBL confirmatory test was carried out using the combination disc test (CDT) by including cefotaxime/cefotaxime+clavulanic acid (CT/CTL) and ceftazidime/ceftazidime+clavulanic acid (TZ/TZL). E. coli ATCC 25922 and K. pneumoniae ATCC 700603 were used as the ESBL- negative and -positive control strains, respectively. Also, antimicrobial susceptibility to other antimicrobial agents was tested for all the ESBL producers. The antimicrobial agents (BD BBL Sensi-Disc susceptibility discs, BD Biosciences, US) used were as follows: amoxicillin-clavulanic acid (20/10 μg), ampicillin-sulbactam (10/10 μg), piperacillin-tazobactam (100/10 μg), aztreonam (30 μg), trimethoprim-sulfamethoxazole (1.25/23.75 μg), gentamicin (10 μg), amikacin (30 μg), nitrofurantoin (300 μg), ciprofloxacin (5 μg), and nalidixic acid (30 μg), imipenem (10 μg), meropenem (10 μg), and ertapenem (10 μg). The ESBL producers associated with resistance to CIP were defined as CIPR/ESBL+ isolates. The minimum inhibitory concentration (MIC) of CIP was determined using the Epsilometer test (E-test) (20). In the end, CIPR/ESBL+ ST131 and CIPR/ESBL+ non- ST131 isolates were further investigated in molecular studies.

Molecular detection of ESBLs.

Genomic DNA of CIPR/ESBL+ E. coli isolates was extracted by the commercially available DNA extraction kit (Bioneer Company, Korea) following the manufacturer’s protocol and stored at −20°C until use. Isolates were screened for ESBL genes (bla CTX-M-15, bla TEM, and bla SHV ) by single PCR assays using primers specific as described previously (21). Data of the primers used in this study are shown in Table 1.

Detection of PMQR genes.

Detection of PMQR genes (qnrA, qnrB, qnrS, and aac(6′)-Ib-cr) was performed by single PCR using primers described previously (16–18). PCR was performed in 25 μl reaction volume containing 12.5 μl of Taq DNA polymerase 2× Master Mix RED at 1.5 mM of MgCl2 final concentration (Co. Amplicon, Denmark), 10 ng of extracted DNA, 0.6 μl of each primer (10 pmol), and distilled water to obtain a 25-μl total volume. PCR reactions were carried out at the optimized annealing temperatures for each primer pair, as shown in Table 1.

Detection of QRDR mutations in gyrA and parC genes.

Among the CIPR/ESBL+ E. coli isolates identified, 15 ST131 and 15 non-ST131 isolates were randomly selected to determine chromosomal mutations. For this purpose, the gyrA gene (encoding subunit A of DNA gyrase; primary FQ target), and the parC gene (encoding subunit A of topoisomerase; secondary FQ target) were amplified by PCR (19). Amplicons were sequenced using an ABI 3730XL DNA analyzer apparatus (Macrogen Inc., Korea). Nucleotide sequences in the gyrA and parC genes were compared with E. coli K-12 MG1655 genome sequences (reference sequences) using BLAST tools of the National Center for Biotechnology Information; (NCBI; http://www.ncbi.nlm.nih.gov/blast).

P-MLST.

Initially, 25 (12 ST131 and 13 non-ST131) CIPR/ESBL+ E. coli isolates exhibiting chromosomal mutation were selected for MLST typing to determine their Pasteur sequence type (PST). Typing was performed using eight housekeeping genes, including dinB, icdA, pabB, polB, putP, trpA, trpB, and uidA. Then their allelic profiles were characterized by comparing with the corresponding allele available in P-MLST database (https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=pubmlst_ecoli_seqdef) to recognize the PST of each isolate.

Statistics.

All data analyses were performed using SPSS software (version 19.0). The prevalence of antibiotic resistance (resistance genes) were compared between the ST131 and non-ST131 isolates by Pearson chi-square test and Fisher exact test. In all experiments, the threshold for statistical significance was p-value≤ 0.05.

RESULTS

Characteristic of patients, ESBL producers, and the prevalence of ST131 clone.

Of the 215 E. coli isolates, 94 (44%) were confirmed as ESBL producer. The confirmed ESBL+ isolates showed high rates of resistance to aztreonam (n= 78, 82.9%) and trimethoprim-sulfamethoxazole (n= 74, 78.7%), followed by amoxicillin-clavulanic acid (n= 58, 61.7%), ampicillin-sulbactam (n= 44, 46.8%), gentamicin (n= 32, 34%), piperacillin-tazobactam (n= 24, 25.5%), nitrofurantoin (n= 13, 13.8%), and amikacin (n= 11, 11.7%). All the ESBL+ isolates were susceptible to carbapenems, and resistant to both ciprofloxcacin and nalidixic acid. All CIPR/ESBL+ isolates exhibited high-level CIP resistance (MIC≥ 32 μg/mL). Among 94 ESBL+ isolates screened, 52 (55%) isolates were detected as the ST131 and the remaining 42 (45%) isolates as non-ST131. Meanwhile, 50 out of the 52 ST131 E. coli isolates were identified as the O25b-ST131 clone and two isolates as the non-O25b-ST131 clone. All patients ranged in age from 1 to 85 years (Table 2), and were allocated to group 1–15 years (n = 39), and group 16–45 years (n = 14), and group 46–85 years (n = 26). Both the ST131 and the non-ST131 isolates were mostly detected in patients under 1–15 years old (40% vs. 43%) and 46–85 years old (46% vs. 40%). Among inpatients (hospital patients), the ST131 isolates were significantly associated with the age range 46–85 years compared to the non-ST131 (79% vs. 48%; p= 0.027). No significant difference in resistance patterns was observed among different age groups between ST131 and non-ST131.
Table 2.

Characteristics of patients infected with E. coli ST131 and non-ST131 isolates

Isolates Service type Range of age groups (Years) No. of isolates (%)

1–15 16–45 46–85
ST131Inpatient, n=243 (12)2 (8)19 (79)
Outpatient, n=2818 (64)5 (18)5 (18)
Non-ST131Inpatient, n=216 (28)5 (24)10 (48)
Outpatient, n=2112 (57)2 (9)7 (33)
P-v of In/out-patient(ST131 vs. non- ST131)
Inpatient0.1790.1530.027
Outpatient0.6120.4090.213
Characteristics of patients infected with E. coli ST131 and non-ST131 isolates

Antimicrobial resistance in E. coli ST131 and non-ST131 isolates.

CIP resistance among ESBL producers was exhibited in 63.4% (n=33/52) ST131 isolates and 64.2% (n=27/42) non-ST131 isolates (CIPR/ESBL+). A significant difference was detected in the prevalence of resistance to aztreonam (p= 0.021), ampicillin-sulbactam (p= 0.048), and gentamicin (p= 0.017) in the CIPR/ESBL+ ST131 comparing the CIPR/ESBL+ non-ST131 isolates (Table 3).
Table 3.

Resistance to antimicrobial agents in the ESBL producers

Antimicrobial agents No. (%) of isolates p- value of
CIPR CIPS


ST131 (n= 33) non-ST131 (n= 27) ST131 (n= 15) non-ST131 (n= 19) CIPR (ST131 vs. non-ST131) CIPS (ST131 vs. non-ST131) AS (CIPR non-ST131 vs. CIPS non-ST131) AS (CIPR ST131 vs. CIPS ST131)
AUG24 (73)14 (52)8 (53)12 (63)0.0950.7280.4460.186
SAM23 (70)12 (44)2 (13)7 (37)0.0480.1230.606< 0.0001
PTZ11 (33)8 (29)1 (7)4 (21)0.7590.2400.5140.048
ATM32 (97)21 (77)13 (87)13 (68)0.0470.3120.4770.172
SXT26 (79)22 (81)11 (73)15 (79)0.7950.7320.8310.677
GM20 (61)8 (30)3 (20)1 (5)0.0170.1850.0400.009
AN5 (15)3 (11)1 (7)2 (10)0.6470.6940.9500.410
IN3 (9)5 (18)3 (20)2 (10)0.2650.4390.4570.289

AS, Antimicrobial susceptibility; AUG, amoxicillin-clavulanic acid; SAM, ampicillin-sulbactam; PTZ, piperacillin-tazobactam; ATM, aztreonam; SXT, trimethoprim-sulfamethoxazole; GM, gentamicin; AN, amikacin; IN, nitrofurantoin; CIPR, fluoroquinolone resistant; CIPS, fluoroquinolone sensitive. The CIPR isolates studied were defined as resistant isolates to ciprofloxacin. The ESBL positive isolates studied were confirmed by the combined disk test (CDT) as ESBL producers. All the isolates were susceptible to carbapenems and resistant to cefotaxime and nalidixic acid.

A p-value ≤ 0.05 was consideredstatistically significant.

Resistance to antimicrobial agents in the ESBL producers AS, Antimicrobial susceptibility; AUG, amoxicillin-clavulanic acid; SAM, ampicillin-sulbactam; PTZ, piperacillin-tazobactam; ATM, aztreonam; SXT, trimethoprim-sulfamethoxazole; GM, gentamicin; AN, amikacin; IN, nitrofurantoin; CIPR, fluoroquinolone resistant; CIPS, fluoroquinolone sensitive. The CIPR isolates studied were defined as resistant isolates to ciprofloxacin. The ESBL positive isolates studied were confirmed by the combined disk test (CDT) as ESBL producers. All the isolates were susceptible to carbapenems and resistant to cefotaxime and nalidixic acid. A p-value ≤ 0.05 was consideredstatistically significant. There was a significant correlation between CIPR/ ESBL+ ST131 isolates and resistance to sulbactam, piperacillin-tazobactam and gentamicin in compare with CIPS/ESBL+ isolates (Table 3). Similar finding was detected only in gentamicin resistance among CIPR/ESBL+ non-ST131 isolates.

Data analysis of the QRDR sequence in the gyrA and parC genes.

Thirty CIPR/ESBL+ isolates (15 ST131 and 15 non-ST131) were randomly analyzed by PCR and direct sequencing of QRDR of gyrA and parC. Substitutions of both serine 83 to leucine (S83L) and aspartic acid 87 to asparagine (D87N) in gyrA, as well as serine 80 to isoleucine (S80I) and glutamic acid 84 to valine (E84V) in parC were the mutations found in the isolates. The present study also detected that 23.3% (n= 7) of the isolates as carrying S83L or D87N alone and 76.7% (n= 23) of the isolates co-harboring S83L and D87N substitutions. Besides, 26.7% (n= 8) isolates carried S80I or E84V alone and 63.3% (n= 19) isolates co-harbored S80I and E84V substitutions. There was a significant difference in the double mutations (S80I+ E84V) between ST131 (80%) and non-ST131 (47%) isolates.

Characterization of ESBL and PMQR genes in the CIPR/ESBL+ producers.

Among 60 CIPR/ ESBL+ isolates, 31 (51.6%) and eight (13.4%) contained only the bla CTX-M-15 or bla TEM, respectively, and only 10 (16.6%) of isolates co-harbored the bla CTX-M-15 and bla TEM genes. The ESBL genes were detected in 93.3% (n=31/33) and 66.6% (n=18/27) of ST131 and non-ST131 isolates, respectively. The prevalence of the bla CTX-M-15 was significantly higher in ST131 isolates than non-ST131 isolates (n= 27/33; 82% vs. n= 14/27; 52%, p= 0.013). Three genes, i.e. qnrS, qnrB, and aac(6′)-Ib-cr, detected in CIPR/ESBL+ producers. The aac(6′)-Ib-cr (n=33, 55%) and qnrS (n= 32, 53.3%) were the most predominant genes in all the isolates, followed by qnrB (n= 17, 28.3%). In comparative analysis, 78.7% (26/33) ST131 and 88.8% (24/27) non-ST131 isolates possessed at least one PMQR gene (p= 0.971). The prevalence of PMQR genes in the ST131 vs. non-ST131 were as follows: qnrS (n= 16, 48.4% vs. n= 16, 59.2%; p= 0.895), qnrB (n= 7, 21.2% vs. n= 11, 40.7%; p= 0.101), and aac(6′)-Ib-cr (n= 22, 66.6% vs. n= 11, 40.7%; p= 0.045). Our results indicated a significant association of qnrS+aac(6′)-Ib-cr combination in ST131. The dominant PMQR genes in ST131 and non-ST131 isolates were aac(6′)-Ib-cr (66.6%) and qnrS (59.2%), respectively. Profiles of resistance genes are illustrated in (Table 4). The qnrA and bla SHV were not found in ST131 and non-ST131 isolates.
Table 4.

Profiles of resistance genes in the CIPR/ESBL+ isolates

Resistance genes No. (%) of CIPR/ ESBL+ isolates p-value (ST131 vs. non-ST131)

ST131 (n= 33) non- ST131 (n= 27)
ESBL genes
bla CTX-M-15 20 (61)11 (44)0.126
bla TEM 4 (11)4 (17)0.760
blaCTX-M-15 + blaTEM7 (19)3 (13)0.296
PMQR genes
qnrS 2 (6)7 (26)0.032
qnrB -2 (7)0.460
aac(6′)-Ib-cr 8 (21)4 (11)0.364
qnrS+ qnrB2 (6)3 (11)0.481
qnrS+ aac(6′)-Ib-cr9 (30)2 (7)0.048
qnrB+ aac(6′)-Ib-cr2 (3)2 (7)0.835
qnrS+qnrB+ aac(6′)-Ib-cr3 (12)4 (15)0.492
Co-existence of ESBL & PMQR genes
blaCTX-M-15 +qnrS2 (5)3 (11)0.201
blaCTX-M-15 +qnrS+qnrB-1 (5)0.270
blaCTX-M-15 +aac(6′)-Ib-cr5 (11)1 (9)0.141
blaCTX-M-15 +qnrS+aac(6′)-Ib-cr6 (24)3 (5)0.445
blaCTX-M-15 +qnrB+aac(6′)-Ib-cr1 (3)--
blaCTX-M-15 +qnrS+qnrB+aac(6′)-Ib-cr2 (3)3 (11)0.481
blaTEM +qnrS-2 (7)0.427
blaCTX-M-15 +bl aTEM +qnrS+qnrB+aac(6′)-Ib-cr2 (6)-0.193
blaTEM +qnrS+qnrB -1 (4)0.270
blaCTX-M-15+blaTEM+aac(6′)-Ib-cr3 (11)2 (9)0.257
QRDR mutations*
gyrA S83L2 (13)3 (20)0.624
D87N-2 (13)0.560
S83L+ D87N13 (87)10 (66)0.099
parC S80I1 (6.5)1 (6.5)1.000
E84V2 (13)4 (27)0.361
S80I+ E84V12 (80)7 (40)0. 058

CIPR/ESBL+, ciprofloxacinresistant/ESBL producer. The bla SHV and qnrA genes were not found in any of the isolates studied. A p-value ≤ 0.05 was considered statistically significant.

Frequency of QRDR mutations was calculated for 15 isolates in each ST131 and non-ST131.

Profiles of resistance genes in the CIPR/ESBL+ isolates CIPR/ESBL+, ciprofloxacinresistant/ESBL producer. The bla SHV and qnrA genes were not found in any of the isolates studied. A p-value ≤ 0.05 was considered statistically significant. Frequency of QRDR mutations was calculated for 15 isolates in each ST131 and non-ST131.

Coexistence of ESBL and PMQR genes among the CIPR/ESBL+ isolates.

The coexistence of ESBL and PMQR genes was detected in 37 (61.6%) out of 60 isolates. No significant difference was observed in the coexistences of ESBL and PMQR genes between ST131 and non-ST131 isolates (n= 21, 62% vs. n= 16, 48%; p= 0.729; Table 4).

PSTs among the CIPR/ESBL+ isolates.

PST of 12 CIPR/ESBL+ ST131 and 13 CIPR/ESBL+ non-ST131 isolates were obtained by the MLST technique. The O25b-ST131 and non-O25b-ST131 isolates showed PST43 (n=10) and PST506 (n=2), respectively. Thirteen non-ST131 isolates were classified into 10 different PST, that the most frequent PST was PST53 (n=4, 30.7%), followed by PST355, PST477, PST945, PST446, PST8, PST731, PST487, PST86, and PST490 (n=1, 7.6% for each).

DISCUSSION

The FQ resistance in E. coli ST131 has spread worldwide, particularly in developing countries and has become an increasing public health concern in clinical management (22). This study aimed to assess the prevalence of resistance genes in CIPR/ESBL+ E. coli isolates (ST131 and non-ST13) in women with UTIs. In this study, nearly half of the ESBL producers belonged to the ST131. The majority of these ST131 isolates belonged to the O25b-ST131, which is in agreement with other investigations (23). In current study, the ST131 were significantly detected in the hospitalized patients in the age range 46–85 years (Table 2). Elderly patients who are hospitalized are more prone to infection with ST131, because of diminished immune response, recurrent and long-duration hospitalizations, urinary catheter use, exposure to stronger drug and underlying diseases (4, 24). Therefore, screening of ST131 particularly in older hospitalized patients is essential. The CIPR ST131 isolates accounted 68.7% of ESBL producers. In a study from Canada, 44% of all CIPR E. coli isolates were ST131 (11). In the courrent study, the E. coli CIPR/ESBL+ isolates, including ST131 and non-ST131 were shown the highest sensitivity to amikacin 87% (n= 52/60). In a study in Iran, the high sensitivity rates to fosfomycin followed by amikacin and nitrofurantoin were detected in the ESBL producers (25). It is worth noting that the use of older antibiotics such as fosfomycin can be a suitable treatment option for infections caused by MDR and ESBL producers. With the analysis of PMQR genes, the most frequent genes were aac(6′)-Ib-cr and qnrS in ST131 and non-ST131 isolates, respectively. Several studies in Iran and other Asian countries showed varied frequencies for PMQR genes (26, 27). This difference could be the luck of focus on ST131 in their studies. Another explanation can be the difference in their geographical area or sample source. The relatively high prevalence of PMQR genes in our CIPR/ESBL+ isolates (with MIC≥ 32 μg/mL), especially in ST131, is alarming, as these genes may facilitate the selection of chromosomal mutations in QRDR and subsequently lead to high-level Qnr. Accordingly, the significant association of the aac(6′)-Ib-cr with the ST131 isolates in our research is likely due to the higher rate of ST131 resistance to gentamicin. The aac(6′)-Ib-cr encodes a bifunctional enzyme catalyzing the FQs and aminoglycosides (28). According to the study conducted by Nicolas-Chanoine et al. (2014), aac(6′)-Ib-cr gene is carried along with other resistance genes (bla CTX-M-15,bla OXA-1, bla TEM-1, mphA, and tetA) on the plasmids, conferring resistance to aminoglycosides, ciprofloxacin, macrolides, chloramphenicol, and tetracycline. Similarly, we found aac(6′)-Ib-cr -carrying isolates were associated with bla CTX-M-15 gene (4). The coexistence of PMQR and ESBL genes was displayed in all CIPR/ESBL+ isolate, which is in line with previous studies (4, 28, 29). The association of these genes may be potential horizontal transfer of antibiotic resistance agents among isolates (9). Therefore, a complete understanding of resistance mechanisms can be helpful for treatment and infection control. The sequence analysis of QRDR indicates that mutations occur in 2 positions at S83 in gyrA and, and E84 in parC which are consistent with other reports (30, 31). The mutations in positions S83 and E84 are likely suggestive of the higher levels of CIP-resistance. A higher rate of double mutations (S80I+E84V) was significantly observed in ST131 than non-ST131 isolates. Studies have revealed that the point mutations led to decreased susceptibility of E. coli to FQs, whereas the double mutations elevate high-level resistance to FQ (30, 32). A study in the Netherlands showed the replacement of isoleucine 529 to leucine (I529L) in parE in ST131 isolates (32). Therefore, future investigation of other chromosomal-mediated resistance agents will complete the understanding of the MDR clones, especially ST131. In the present study, PST506 was accounted for a small subset (3.8%) among CIPR/ESBL+ ST131 isolates by P-MLST analysis. PST506 belongs to the O16-ST131 clade that this clade accounts for one to five percent of E. coli isolates. According to studies, most O16-ST131 isolates are susceptible to FQs and extended-spectrum cephalosporins (33). However, our PST506-ST131 isolates (n= 2) were CIPR/ESBL+ and contained the aac(6′)-Ib-cr and bla CTX-M-15 genes but lacking bla TEM and qnr genes. Our finding revealed that PST53 was the most common PST (26.6%) in the non-ST131 isolates. In a recent study by Kim et al. (2017), PST53, PST8, PST2, PST594, PST13, PST39, PST44, PST53, PST253, PST478, and PST666 were found in community-associated bacteremia isolates (34). All PST53 isolates were associated with the variants of aac(6′)-Ib-cr and bla CTX-M-15 genes and showed at least three chromosomal mutations. Furthermore, PST53 could play an important role in the distribution of antibiotic resistance in women with UTI. Distribution of CIPR/ESBL+ isolates co-harboring various antimicrobial resistance determinants can lead to enhanced MDR bacteria and subsequently limit the choice of empirical antimicrobial therapy. Due to the fact that women are more likely to suffer from UTIs and recurrences thus epidemiological studies and molecular screening of women with UTI for the presence of ESBL-producing and MDR E. coli clones are highly recommended. It is also of paramount importance to understand the resistance gene profiles of isolates to select the appropriate treatment for reducing resistance to therapeutic agents such as CIP and spreading such clones.

CONCLUSION

This study showed that the ST131 clone were accounted for more than half of the ESBL-producing isolates. The ESBL and CIP resistance genes were significantly higher in ST131 isolates compared to non-ST131 isolates. The majority of the CIPR/ ESBL+ isolates were exhibited the coexistence of PMQR genes, ESBL genes, and multiple mutations in QRDR that is a serious public health concern in older hospitalized patients. The combination of the multiple resistance genes in the ST131 may contribute to its successful spread and rapid worldwide dissemination. Therefore, continuous monitoring and surveillance requires to prevent the dissemination of resistant clones for effective treatment options.
  32 in total

Review 1.  A systematic review of outbreak and non-outbreak studies of extraintestinal pathogenic Escherichia coli causing community-acquired infections.

Authors:  D B George; A R Manges
Journal:  Epidemiol Infect       Date:  2010-07-20       Impact factor: 2.451

2.  Rapid and specific detection, molecular epidemiology, and experimental virulence of the O16 subgroup within Escherichia coli sequence type 131.

Authors:  James R Johnson; Olivier Clermont; Brian Johnston; Connie Clabots; Veronika Tchesnokova; Evgeni Sokurenko; Adam F Junka; Beata Maczynska; Erick Denamur
Journal:  J Clin Microbiol       Date:  2014-02-05       Impact factor: 5.948

Review 3.  Plasmid-mediated quinolone resistance in Enterobacteriaceae: a systematic review with a focus on Mediterranean countries.

Authors:  B Yanat; J-M Rodríguez-Martínez; A Touati
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2016-11-26       Impact factor: 3.267

4.  Commonality among fluoroquinolone-resistant sequence type ST131 extraintestinal Escherichia coli isolates from humans and companion animals in Australia.

Authors:  Joanne L Platell; Rowland N Cobbold; James R Johnson; Anke Heisig; Peter Heisig; Connie Clabots; Michael A Kuskowski; Darren J Trott
Journal:  Antimicrob Agents Chemother       Date:  2011-06-06       Impact factor: 5.191

5.  Characterization of fluoroquinolone and cephalosporin resistance mechanisms in Enterobacteriaceae isolated in a Dutch teaching hospital reveals the presence of an Escherichia coli ST131 clone with a specific mutation in parE.

Authors:  S Paltansing; M E M Kraakman; J M C Ras; E Wessels; A T Bernards
Journal:  J Antimicrob Chemother       Date:  2012-09-18       Impact factor: 5.790

Review 6.  Mechanisms of drug resistance: quinolone resistance.

Authors:  David C Hooper; George A Jacoby
Journal:  Ann N Y Acad Sci       Date:  2015-07-17       Impact factor: 5.691

7.  Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains.

Authors:  Olivier Clermont; Hiran Dhanji; Mathew Upton; Tarek Gibreel; Andrew Fox; David Boyd; Michael R Mulvey; Patrice Nordmann; Etienne Ruppé; Jean Louis Sarthou; Thierry Frank; Sophie Vimont; Guillaume Arlet; Catherine Branger; Neil Woodford; Erick Denamur
Journal:  J Antimicrob Chemother       Date:  2009-05-27       Impact factor: 5.790

8.  Fosfomycin, interesting alternative drug for treatment of urinary tract infections created by multiple drug resistant and extended spectrum β-lactamase producing strains.

Authors:  Fatemeh Yeganeh-Sefidan; Reza Ghotaslou; Mohammad Taghi Akhi; Mohammad Reza Sadeghi; Yalda Mohammadzadeh-Asl; Hussein Bannazadeh Baghi
Journal:  Iran J Microbiol       Date:  2016-04

9.  Resistance Mutations in gyrA and parC are Common in Escherichia Communities of both Fluoroquinolone-Polluted and Uncontaminated Aquatic Environments.

Authors:  Anna Johnning; Erik Kristiansson; Jerker Fick; Birgitta Weijdegård; D G Joakim Larsson
Journal:  Front Microbiol       Date:  2015-12-09       Impact factor: 5.640

10.  Impact of co-existence of PMQR genes and QRDR mutations on fluoroquinolones resistance in Enterobacteriaceae strains isolated from community and hospital acquired UTIs.

Authors:  Dalia Nabil Kotb; Wafaa Khairy Mahdy; Mahmoud Shokry Mahmoud; Rasha M M Khairy
Journal:  BMC Infect Dis       Date:  2019-11-21       Impact factor: 3.090

View more
  1 in total

1.  Using whole-genome sequence data to examine the epidemiology of antimicrobial resistance in Escherichia coli from wild meso-mammals and environmental sources on swine farms, conservation areas, and the Grand River watershed in southern Ontario, Canada.

Authors:  Nadine A Vogt; Benjamin M Hetman; Adam A Vogt; David L Pearl; Richard J Reid-Smith; E Jane Parmley; Stefanie Kadykalo; Kim Ziebell; Amrita Bharat; Michael R Mulvey; Nicol Janecko; Nicole Ricker; Samantha E Allen; Kristin J Bondo; Claire M Jardine
Journal:  PLoS One       Date:  2022-04-08       Impact factor: 3.240

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.