| Literature DB >> 34531743 |
Jeffrey Warner1,2, Josiah Hardesty1, Ying Song1, Rui Sun3, Zhongbin Deng3,4,5, Raobo Xu5,6,7,8, Xinmin Yin5,6,7,8, Xiang Zhang5,6,7,8, Craig McClain1,2,5,6,9, Dennis Warner1, Irina Kirpich1,2,5,6.
Abstract
Alcohol-associated liver disease (ALD) is the leading cause of liver disease worldwide, and alcohol-associated hepatitis (AH), a severe form of ALD, is a major contributor to the mortality and morbidity due to ALD. Many factors modulate susceptibility to ALD development and progression, including nutritional factors such as dietary fatty acids. Recent work from our group and others showed that modulation of dietary or endogenous levels of n6-and n3-polyunsaturated fatty acids (PUFAs) can exacerbate or attenuate experimental ALD, respectively. In the current study, we interrogated the effects of endogenous n3-PUFA enrichment in a mouse model which recapitulates features of early human AH using transgenic fat-1 mice which endogenously convert n6-PUFAs to n3-PUFAs. Male wild type (WT) and fat-1 littermates were provided an ethanol (EtOH, 5% v/v)-containing liquid diet for 10 days, then administered a binge of EtOH (5 g/kg) by oral gavage on the 11th day, 9 h prior to sacrifice. In WT mice, EtOH treatment resulted in liver injury as determined by significantly elevated plasma ALT levels, whereas in fat-1 mice, EtOH caused no increase in this biomarker. Compared to their pair-fed controls, a significant EtOH-mediated increase in liver neutrophil infiltration was observed also in WT, but not fat-1 mice. The hepatic expression of several cytokines and chemokines, including Pai-1, was significantly lower in fat-1 vs WT EtOH-challenged mice. Cultured bone marrow-derived macrophages isolated from fat-1 mice expressed less Pai-1 and Cxcl2 (a canonical neutrophil chemoattractant) mRNA compared to WT when stimulated with lipopolysaccharide. Further, we observed decreased pro-inflammatory M1 liver tissue-resident macrophages (Kupffer cells, KCs), as well as increased liver T regulatory cells in fat-1 vs WT EtOH-fed mice. Taken together, our data demonstrated protective effects of endogenous n3-PUFA enrichment on liver injury caused by an acute-on-chronic EtOH exposure, a paradigm which recapitulates human AH, suggesting that n3-PUFAs may be a viable nutritional adjuvant therapy for this disease.Entities:
Keywords: NIAAA model; alcohol-associated liver disease (ALD); fat-1; n3 polyunsaturated fatty acids (n-3PUFAs); plasminogen activator inhibitor (PAI-1)
Year: 2021 PMID: 34531743 PMCID: PMC8438569 DOI: 10.3389/fphar.2021.711590
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Primer Sequences.
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
|
| CGGTTTCTGCGATGGATCCCAC | CACAGGAACCGGGCAAAGAA |
| Gdf-5 | AAGCCCTCAGTCAGTTGTGC | AAAACCATGAAAGGAGTGGG |
|
| CTCAACACGGGAAACCTCAC | CGCTCCACCAACTAAGAACG |
|
| GCGCCCAGACAGAAGTCATA | TCCAGGTCAGTTAGCCTTGC |
|
| TCAATGACTGGGTGGAAAGG | AGGCGTGTCAGCTCGTCTAC |
FIGURE 1Characterization of liver pathology in WT and fat-1 mice in an acute-on-chronic mouse model of ALD. (A) Experimental design, (B) liver n3-PUFA (EPA and DHA) and n6-PUFA (AA and LA) levels, (C) plasma ALT, (D) H&E staining, (E) quantitation of liver steatosis, (F) Oil Red O staining, (G) quantitation of Oil Red O staining, and (H) total liver triglycerides.. All images are 200X magnification. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, one-way ANOVA (comparisons not significant if unlabeled). WT PF (n = 14), fat-1 PF (n = 9), WT EtOH (n = 8), fat-1 EtOH (n = 10).
Metabolic characteristics of WT and fat-1 mice in an acute-on-chronic model of ALD.
| Characteristic | WT Pair-Fed | Fat-1 Pair-Fed | WT EtOH | Fat-1 EtOH |
|---|---|---|---|---|
| Food Consumption (g per day per mouse) | * | * | 10.18 ± 0.64 | 9.19 ± 0.49 |
| Weights | ||||
| Initial BW (g) | 27.32 ± 0.86 | 26.83 ± 0.68 | 27.75 ± 0.43 | 27.39 ± 0.61 |
| Final BW (g) | 27.80 ± 0.84 | 26.67 ± 0.63 | 26.54 ± 0.37 | 26.80 ± 0.55 |
| Body Weight Gain (%) | 1.76 ± 0.04 | −0.60 ± 0.03 | −4.63 ± 0.02 | −2.15 ± 0.03 |
| Liver/BW Ratio (%) | 3.50 ± 0.28 | 3.95 ± 0.14 | 4.00 ± 0.08 | 4.17 ± 0.11 |
| Fat/BW Ratio (%) | 0.14 ± 0.02 | 0.09 ± 0.01 | 0.12 ± 0.01 | 0.10 ± 0.01 |
| Blood alcohol concentration (mM) | 1.849 ± 0.20 | 2.001 ± 0.08 | 49.34 ± 17.45 | 40.52 ± 13.51 |
* PF mice consume the same amount of food as EtOH-fed mice, per genotype.
FIGURE 2Hepatic expression of markers of oxidative stress. (A,B) Western blot and densitometric analysis for CYP2E1 and GAPDH expression. (C) TBARS assay to determine lipid peroxidation levels. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, one-way ANOVA (comparisons not significant if unlabeled) n = 6 mice per group chosen randomly of the total 8–14.
FIGURE 3Hepatic neutrophil infiltration. (A) Immunohistochemistry staining for MPO expression. Arrows indicate MPO+ cells. Images are 200X, insets are 400X magnification. (B) Quantitation of number of MPO+ cells in representative digital microscope fields. (C) MPO levels as determined by ELISA, p < 0.05, one-way ANOVA (comparisons not significant if unlabeled). WT PF (n = 14), fat-1 PF (n = 9), WT EtOH (n = 8), fat-1 EtOH (n = 10).
FIGURE 4Hepatic Expression of Cxcl2 and Pai-1. (A) Expression of Cxcl2 mRNA and (B) CXCL2 protein in liver. (C) Expression of Pai-1 mRNA and (D) PAI-1 protein in liver. (E) Liver immunohistochemistry for PAI-1 protein, 400X magnification. Arrows indicate PAI-1+ hepatocytes. *, p < 0.05, **p < 0.01, one-way ANOVA (comparisons not significant if unlabeled). WT PF (n = 14), fat-1 PF (n = 9), WT EtOH (n = 8), fat-1 EtOH (n = 10).
FIGURE 5Expression of Cxcl2 and Pai-1 in BMDMs. (A) Expression of Cxcl2 and (B) Pai-1 in EtOH and LPS-treated BMDMs isolated from WT and fat-1 mice. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, one-way ANOVA (comparisons not significant if unlabeled). Experiment was performed twice with consistent results.
FIGURE 6Flow cytometry analysis of hepatic immune cells following EtOH feeding. Abundance of (A) M1 and M2 KCs, (B) T regulatory cells, (C) Natural killer cells, and (D) TCRβ+ killer cells. *, p < 0.05, two-tailed Student’s t test. Results are an average of n = 3–4 mice per group.
FIGURE 7Schematic representation of the beneficial effects of n3-PUFA enrichment on liver injury in acute-on-chronic EtOH-induced experimental ALD.