Literature DB >> 34512169

CDC20 regulates the cell proliferation and radiosensitivity of P53 mutant HCC cells through the Bcl-2/Bax pathway.

Shuai Zhao1,2, Yichi Zhang1,2, Xiuqin Lu3, Han Ding1,2, Bing Han1,2, Xiaoling Song2, Huijie Miao2, Xuya Cui2, Shiyin Wei4, Wangrui Liu2,4, Shuxian Chen5, Jian Wang1,2.   

Abstract

Purpose: The incidence of hepatocellular carcinoma (HCC) is extremely high, and China accounts for approximately 50% of global liver cancer cases. Previous studies reported that CDC20 is involved in the occurrence and progression of a variety of malignant tumors. So, whether CDC20 will affect the development of HCC, we have conducted in-depth research on this.
Methods: We selected Hep3B and HepG2 for cell culture, and performed siRNA transfection, lentiviral infection, western blot, MTS determination, cell cycle determination, apoptosis test, immunodeficiency test, clone survival test and subcutaneous parthenogenesis in nude mice.
Results: Knockdown of CDC20 greatly enhanced the radiation efficacy on the growth retardation in HepG2, and protein level of CDC20 was decreased for the activation of P53 by radiation. Downregulation of CDC20 combined with radiation can inhibit proliferation, aggravate DNA damage, increase G2/M arrest, and promote apoptosis of HCC cells to a greater extent, and the relative survival fraction of HCC cells was gradually reduced with radiation dose increased in P53 mutated Hep3B cells. After knocking down CDC20 in HCC, Bcl-2 was down-regulated and Bax expression increased. Down-regulation of CDC20 can inhibit further invasion by promoting the radiosensitivity of HCC.
Conclusion: In this study, we found that that CDC20 was highly expressed in HCC and participated in radio resistance of HCC cells with P53 mutation Bcl-2/Bax via signaling pathway. This study is the first to present evidence that CDC20 may play a role in improving the efficacy of radiotherapy in HCC. © The author(s).

Entities:  

Keywords:  Bcl-2/Bax pathway; CDC20; P53 mutant; hepatocellular carcinoma

Mesh:

Substances:

Year:  2021        PMID: 34512169      PMCID: PMC8416732          DOI: 10.7150/ijbs.64003

Source DB:  PubMed          Journal:  Int J Biol Sci        ISSN: 1449-2288            Impact factor:   6.580


Introduction

Cancer is a serious public health issue with an enormous medical and financial burden for individuals and society. The incidence of HCC ranks among the highest in the world, with China accounting for about half of the total global cases; and HCC ranks fourth in the common cause of cancer-related deaths 1-3. There are many treatment methods for liver cancer, including surgical resection, radiotherapy, chemotherapy, gene therapy and immunotherapy, etc. Among these methods, surgical intervention is the most effective treatment; however, most HCC patients are diagnosed at middle to advanced stage and are therefore ineligible for surgery. Furthermore, HCC is highly resistant to chemotherapy and has a poor response to radiotherapy, which is partly ascribed to the high rate of genetic expression of drug resistance proteins and mutations in the p53 tumor suppressor gene 4-7. Therefore, better understanding the mechanisms of radio resistance in HCC is critical for improving the efficacy of radiotherapy and prolonging patient survival. Currently, more than half of cancer patients need radiotherapy as an essential part of their cancer treatment 8-10. Studies have found that ionizing radiation (IR) can induce DNA double-strand breaks in target cells, thereby inhibiting cell proliferation and leading to cell apoptosis. The DNA damage response (DDR) is activated in response to IR, leading to repair of DNA damage and activation of the DNA damage checkpoint. Inhibition of DDR enhances the radiosensitivity of tumor cells, and DDR-based therapies targeting DDR-related molecules are a promising therapeutic strategy 11. The radio resistance of HCC to IR suggests that HCC cells have an unusual cellular repair ability closely related to the preferential activation of the DDR. The radiation sensitivity of tumor cells is affected by many factors, including proliferation, apoptosis, cycle distribution, and DDR 12, 13. Therefore, clarifying the factors and mechanisms that play a vital role is critical for improving the efficacy of radiotherapy in HCC. Cell division cycle 20 homolog (CDC20) is a RING finger E3 ubiquitin ligase that functions as promoting complex/circular body (APC/C) activation in the later stage during the metaphase-anaphase transition and is one of the most important factors that control the spindle assembly checkpoint (SAC) 14. SAC ensures the correct separation of chromosomes during mitosis to maintain genome stability. In normally growing cells, when the SAC detects any defects in genomic stability, the cell cycle is arrested at metaphase. However, CDC20 overexpression allows cells with damaged DNA to leave mitosis and avoid apoptosis 15-17. Previous studies reported high levels of CDC20 in multiple malignancies and it participates in tumor generation and progression of tumor. Furthermore, genetic ablation of CDC20 caused elevated cellular apoptosis and blocked tumorigenesis in vivo 18-20. In this study, we found that that CDC20 was highly expressed in HCC and participated in radio resistance of HCC cells with P53 mutation Bcl-2/Bax via signaling pathway. Our study first found the present evidence that CDC20 should be a significant role in improving the efficacy of radiotherapy in HCC.

Materials and methods

Cell culture

Two human HCC cell lines (Hep3B, HepG2) were purchased from the Chinese Academy of Medical Science. Cells were cultured in DMEM containing 10% fetal bovine serum (FBS) supplemented with 100 units/mL of penicillin and 100 μg/mL of streptomycin at 37 °C in a humidified atmosphere of 5% CO2. Collectting cells for experiments for the growth rate.

siRNA transfection

CDC20 siRNA duplexes were transfected using Lipofectamine 3000 reagent (Invitrogen, USA). Cells were used for further analyses after transfection for 48 h. The sequences of the CDC20 siRNA duplexes are as follows: si1#: AACGGCAGGACUCCGGGCCGA, si2#: AAUGGCCAGUGGUGGUAAUGA.

Lentiviral infection

CDC20 short hairpin RNA (shRNA)-expressing lentivirus and vector were purchased from Genecopoeia. The short hairpin RNA (shRNA) sequences targeting CDC20 are as follows: sh1#: AACGGCAGGACUCCGGGCCGA, sh2#: AAUGGCCAGUGGUGGUAAUGA. After 24 h infection with lentivirus, the cells were passaged and selected by 10 μg/mL puromycin (Sigma-Aldrich) for 48 h to eliminate the uninfected cells before harvesting for further analyses. Knockdown efficiency was determined by western blot.

Western blot

Cells were harvested after the indicated treatments and dissolve RIPA buffer; protein concentrations quantification by bicinchoninic acid detection kit (Pierce, USA). Protein samples were Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separation under denaturing conditions and transferred to a nitrocellulose filter (NC) membrane. The membrane was then incubated with the following primary antibodies: anti-β-tubulin (CST), anti-GAPDH (CST), anti-CDC20 (Proteintech), anti-BCL-2 (CST), anti-BAX (CST), anti-p21 (Proteintech), anti-P53 (Proteintech), anti-CCNB1 (CST), anti-CCND1 (CST).

MTS assay

MTS assay (Sigma-Aldrich) was performed to measure cell proliferation. Cells in each well were incubated with 20 μl of MTS solution (5 mg/mL) for 1 h at 37 °C. The optical density (OD) at the wavelength of 490 nm was measured by a multidetection microplate reader (BMG LABTECH, Cary, NC, USA).

Cell cycle assay

The cells were washed 3 times with PBS, fixed with 70% ethanol at -20 °C for more than 12 hours, and stained with RNase (50 µg/mL) and PI for 30 minutes at room temperature. Then analyze the stained cells by flow cytometry (FC500 MPL, Beckman Coulter).

EdU assay

EdU (5-ethynyl-20-deoxyuridine, Invitrogen) was used at 1 mM for 2 h in cell culture medium as described by the manufacturer (Invitrogen). Hoechst® 33342 solution was used to stain the nuclei. Cells were mounted and imaged using fluorescence microscopy.

Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde solution for 15 minutes, permeabilized with 0.5% Triton X-100 for 15 minutes, blocked with 1% BSA for 30 minutes, and then with Anti-γ H2AX (S139) (Millipore, 1:500 diluted in 1% In BSA) for 1 hour at 37 °C. After washing 3 times with PBS, the cells were incubated with the secondary antibody for 1 hour at 37 °C and stained with DAPI to reveal the nucleus. Capture and visualize fluorescence images under a high-content imaging system (Operetta, Perkin Elmer).

Clonogenic survival assay

Cells were infected with the indicated lentivirus and screened by puromycin at 2 μg/ml at 48 h after infection for at least one week. Cells were then exposed to the indicated doses of IR, and 1000 cells from each condition were re-plated and incubated at 37 °C with 5% CO2 for 10 days. The colonies were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Colonies consisting of >50 cells were counted. The surviving fraction was defined as the plating efficiency at the experimental irradiation dose divided by that at 0 Gy. The cell survival curve was plotted by single-hit multitarget modeling and linear quadratic simulation.

Subcutaneous nude mouse model

Twelve BALB/c nude mice were randomly separated into two groups: the shNC group and the shCDC20 group (n=6/group). Hep3B cells (1 × 106 in 200 μL) infected with either shNC or shCDC20 lentivirus were subcutaneously injected into the right flank of the mice. The size and volume of tumors were measured every 3 days. When the tumors reached approximately 50 mm3, three mice in each group were exposed to 4 Gy and the other three mice were allocated to the control group (0 Gy). The tumor sizes were measured every 7 days and the tumor volumes were calculated: V (cm3) = width2 (cm2) * length (cm) / 2. Mice were euthanized on day 35.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software, CA, USA) and SPSS 20.0 (IBM Corp., NY, USA). Data are expressed as mean ± standard deviation (SD). Student's t-test was used to identify differences between pairs of group means. One-way ANOVA with Bonferroni's test was used to compare more than two group means. p < 0.05 indicated statistical significance.

Results

CDC20 is highly expressed and serves as an unfavorable prognosis marker in HCC

In order to study the role of CDC20 in HCC, we analyzed the CDC20 mRNA levels in tumor tissues and non-tumor tissues of HCC patients. CDC20 was upregulated in many types of cancers (Figure ) including HCC (Figure ) according to the GEO database through UALCAN and GEPIA. Next, we analyzed the relationship between the expression of CDC20 and the prognosis of HCC patients, and the results indicated that high CDC20 expression was correlated with poor overall survival (OS) (Figure ), disease-free survival (DFS) (Figure ), and progression-free survival (PFS) in HCC (Figure ). Collectively, these results indicated that CDC20 is highly expressed in HCC, and its high expression is associated with poor prognosis in HCC.

Bioinformatics analysis of CDC20 and its related genes in HCC

Next, we analyzed the biological functions of genes related to CDC20. After screening, we found that 4,622 genes were positively correlated with CDC20, while 57 genes were negatively correlated with CDC20. The top 25 significant genes that were positively or negatively correlated with CDC20 are shown in the Figure . GO term analysis showed that the significant genes correlated with CDC20 were involved in mitotic sister chromatid segregation, mitotic nuclear division, and sister chromatid segregation (Figure ). KEGG pathway analysis showed genes were enriched in DNA replication, DNA damage and cell cycle pathways (Figure ). Gene-gene interactions between clinical-related DEGs and related genes were analyzed, as illustrated in Figure . Approximately 84.18% of terms were in co-expression and 6.87% terms were in co-localization.

CDC20 suppression suppresses cell proliferation, upregulates apoptosis, and induces G2/M phase cell cycle arrest of HCC cells

We next used siRNA targeting CDC20 to knock down the expression of CDC20 in two HCC cell lines, HepG2 and Hep3B. The research on Hep G2 was first conducted. Western blot showed that CDC20 protein expression was markedly decreased after siRNA-CDC20 transfection, compared with the negative control group (siNC) (Figure ). We next conducted MTS assays to investigate the effect of CDC20 knockdown on HCC cell proliferation. Proliferation was significantly inhibited in both HepG2 and Hep3B siRNA-CDC20 cells compared with controls (p <0.01) (Figure ). Compared with the siNC group, both siRNA- CDC20 cell groups showed increased apoptosis and G2/M phase arrest (p <0.01), and 30% cells in the G2/M phase (Figure ). After that, we conducted research on Hep 3B. Western blot showed that CDC20 protein expression was markedly decreased after siRNA-CDC20 transfection, compared with the negative control group (siNC) (Figure ). We next conducted MTS assays to investigate the effect of CDC20 knockdown on HCC cell proliferation. Proliferation was significantly inhibited in both HepG2 and Hep3B siRNA-CDC20 cells compared with controls (p <0.01) (Figure ). We used flow cytometry to evaluate the effect of CDC20 inhibition on the apoptosis and cell cycle of HCC tumor cells. Compared with the siNC group, both siRNA- CDC20 cell groups showed increased apoptosis and G2/M phase arrest (p <0.01), and 30% cells in the G2/M phase (Figure ). The results suggested that silencing CDC20 decreases cell proliferation, increases apoptosis, and induces the G2/M phase cell cycle arrest of HCC cells. Western blot assays revealed that the levels of pro-apoptosis protein Bax and G2/M phase-related protein cyclin B1 (CCNB1) were significantly higher in the siCDC20 groups. The siCDC20 groups also showed significant reduction of anti-apoptotic Bcl-2 protein and G2/M phase-related protein cyclin D1 (CCND1) compared with the siNC group. These results suggested that the influence of CDC20 inhibition of cell proliferation, apoptosis, and G2/M phase cell cycle arrest of HCC cells may be through the cell cycle- and apoptosis-related pathway.

CDC20 suppression significantly suppressed cell proliferation of Hep3B cells but only moderately suppressed HepG2 cell proliferation when combined with x-ray irradiation

At 3 days after infection with shRNA-CDC20 or shNC lentivirus, Hep3B and HepG2 cell lines were irradiated with 6 Gy. We found that CDC20 suppression significantly suppressed cell proliferation of Hep3B cells; the cells were almost stop growing since day 3 when radiotherapy combined with CDC20 downregulation (Figure , p < 0.01). However, the same phenomenon was not exhibited in HepG2 cells. Radiotherapy combined with CDC20 downregulation resulted in only a moderate growth inhibition of HepG2 cells compared with cells receiving radiotherapy with shNC (Figure ). A previous study reported that CDC20 is negatively regulated by p53 in lung cancer cell lines 15. We found that p53 and p21 expressions were increased at 8 h after treatment with 6 Gy in the wild-type p53 HepG2 cells and CDC20 expression was gradually reduced (Figure ). These results indicated that CDC20 suppression significantly suppressed cell proliferation of p53 mutant Hep3B cells, but only moderately suppressed wild-type p53 HepG2 cell proliferation when combined with irradiation.

CDC20 suppression enhances the sensitivity of Hep3B cells to radiation

Next, we examined the impact of CDC20 suppression combined with radiation in p53 wild-type Hep3B cells. At 3 days after lentivirus infection, the cells were irradiated with 6 Gy irradiation. EdU assay showed that cells with CDC20 knockdown had a lower proliferation rate than control cells (Figure , p < 0.01). The number of γH2AX lesions in shCDC20 cells at 24 hours after IR was significantly higher than that in control cells (Figure , p < 0.01). Strikingly, the combination of IR and CDC20 suppression induced further apoptosis (Figure , p < 0.01) and G2/M phase arrest compared with G0G1 (Figure , p < 0.01). The radiosensitizing effects of CDC20 knockdown were measured in cells subjected to 0, 2, 4, 8, and 12 Gy using colony-forming assays (Figure ). The colony formation ability of cells exposed to ≥ 4 Gy was significantly different from the non-irradiated cells. The survival curve of the IR + shCDC20 group was significantly shifted downward compared with non-irradiated cells (Figure , p < 0.01).

Downregulation of CDC20 results in upregulated Bax and decreased Bcl-2 in HCC cells after radiotherapy

Western blot analysis of non-transfected Hep3B cells showed increased CDC20 expression after 4 Gy of irradiation, with slightly reduced expression of Bax and increased Bcl-2 expression. In the CDC20 knockdown group, Bax increased (p < 0.05) and Bcl-2 decreased (p < 0.05) after 4 Gy compared with the shNC group with or without IR (Figure ).

Down-regulated CDC20 represses tumorigenesis by promoting HCC radiosensitivity in vivo

To validate the in vitro results, the effect of CDC20 on radiosensitivity was investigated in a mouse model of HCC injected with Hep3B cells. The tumor growth curve is shown in Figure . The tumor growth and tumor volumes of the shNC group and the shCDC20 group were significantly suppressed after 4 Gy IR compared with mice in the respective control groups treated with 0 Gy. Furthermore, the tumor volume of the shCDC20 group was decreased compared with the shNC group (P < 0.05).

CDC20 suppresses tumor proliferation and increases radiotherapy sensitivity in the HCC xenograft mouse model

In order to further verify the role of CDC20 in the proliferation of HCC cells, we injected nude mice under the skin to construct a xenotransplanted mouse model. When tumors reached 120 mm3, mice were randomized into two groups (n = 6 each) and treated with 4 Gy radiotherapy (Figure ). Tumor size and volume were significantly inhibited in the shCDC20 group compared with the control (Figure ). Additionally, in suggested that CDC20 could significantly enhance sensitivity of HCC cells receiving radiotherapy (p<0.05). These results indicated that CDC20 suppression significantly suppressed cell proliferation of p53 mutant Hep3B cells, but only moderately suppressed proliferation of p53 wild-type HepG2 cells when combined with x-ray irradiation. This mechanism may be related to the induction of wild-type p53 and increase of p21 caused by IR, leading to suppression of CDC20 expression and apoptosis and G2/M arrest by BCL/BAX and the CCNB1/CCND1 pathway in p53 wild-type HepG2 cells. Mutation in p53 impairs its regulation of CDC20, as well as growth arrest and apoptosis. The protein level of CDC20 was increased in p53 mutant Hep3B cell lines after IR (Figure ).

Immunotherapy efficacy and TIME characterizations analysis of RBCK1

Finally, we analyzed the role of CDC20 in the immune microenvironment of HCC. We verified the Spearman correlation analysis between CDC20 and immune score. We found that in HCC, the expression of CDC20 is closely related to B cell expression, T cell CD4+ expression, T cell CD8+ expression, Neutrophil expression, Macrophage expression, Myeloid dendritic cell expression (p<0.001) (Figure ). Then, we analyzed the expression distribution of CDC20 in HCC cell lines. We found that CDC20 is highly expressed in HLF, SNU-387, SNU-423 and other cell lines (Figure ). A heatmap showed the relatively high expression of a CDC20 in different cell types across three scRNA-seq datasets (Figure ). In order to reduce the heterogeneity of tumor tissues, and to further confirm localization of CDC20 in immune cells, we included and analyzed three single-cell RNA-seq (scRNA-seq) datasets, GSE98638, GSE125449, GSE140228_10X and GSE140228. As shown in Figure , CDC20 is mainly located or bind to Tprolif.

CDC20 significantly predicts survival and aggressive clinicopathological parameters for HCC patients

Finally, we explored the relationship between the expression of CDC20 and the survival of HCC patients. HCC patients with higher CDC20 expression experienced a significantly increased risk of death, and the z-score of CDC20 expression confirmed that elevated CDC20 levels were associated with higher mortality (Figure ). The Kaplan-Meier curve also demonstrated that high CDC20 expression led to worse OS in 371 patients, with a median survival of 2.8 years in the CDC20high group and 6.3 years in the CDC20low group (Figure ). The high sensitivity and specificity of the independent diagnostic and prognostic value of CDC20 expression were shown by the ROC curve (Figure ). However, the accuracy decreased over time [1-year area under the curve (AUC)=0.733, 3-year AUC=0.683 and 5-year AUC=0.661, suggesting that CDC20 expression more accurately predicted the prognosis of early-stage HCC patients compared with those with advanced stages.

Discussion

In our research, we have found that CDC20 is closely related to the prognosis of HCC, and inhibiting CDC20 can enhance the radiosensitivity of HCC cells, and thus have new ideas in the choice of treatment of HCC patients. Biomarkers for predicting the prognosis of HCC patients open up new directions. As a regulator of the spindle checkpoint, CDC20 plays an important role in regulating the activity of the all-ubiquitin ligase of APC/C. CDC20 has been found to be a potential therapeutic target and biomarker for a variety of cancers. Studies have found that after CDC20 is inhibited, the growth of cancer cells will be inhibited, G2/M phase arrest and apoptosis 21. In our research, we also found that the high expression of CDC20 will lead to a worse prognosis of HCC patients; while inhibiting CDC20 will increase the radiosensitivity of HCC tumor cells, thus providing a new direction and idea for us to treat HCC 22, 23. Studies have shown that mutations in CDC20 can prevent cell division during mitosis, resulting in failure to start later, making chromosomes impossible to separate. Studies have found that CDC20 also plays a key role in mediating protein-protein interactions. These may be related to the influence of HCC's radiosensitivity. Interestingly, it is also suggested that Cdc20 has a function independent of APC/C. Most of the previous studies mainly focused on the analysis of the function of CDC20 and its downstream ubiquitin targets, while the analysis of upstream regulators of CDC20 and related up-regulated genes is rare. In our research, we found that CDC20, its related upstream regulators and related genes mainly play a role in mitotic sister chromatid segregation, mitotic nuclear division, sister chromatid segregation, DNA replication, DNA damage and cell cycle pathways. In addition, the research team also observed that p53 inhibits tumor cell growth by regulating Cdc20. Therefore, we further study the relationship between P53 and CDC20 in HCC. The rapid development of modern bioinformatics and phenotyping has provided great convenience to our research 24-26. Tumor formation is a complex and multistep process that involves multiple factors and gene alterations over various stages. Two important hallmarks in the development of tumor cells are abnormal cell cycle regulation and dysregulated cell proliferation 27, 28. Proper cell cycle regulation is critical for cell survival, proliferation, and growth, and cell cycle proteins are targets of anticancer therapy. Cell cycle arrest is also closely associated with the occurrence of tumor and cellular senescence 29-31. Flow cytometry revealed that CDC20 suppression increased cell cycle arrest at the G2/M phase in HCC cells, and HCC cell proliferation was significantly decreased after inhibition of CDC20 expression by siRNA-CDC20 transfection. Apoptosis or programmed cell death is an integral part of cell maintenance32 and plays an important role in tumor cell growth, immunity, metabolism and clearance. The G2/M cell cycle arrest prevents tumor cells from entering mitosis, which hinders tumor progression. After inhibition of CDC20, HCC cells showed a G2/M arrest, thus inhibiting tumor cells from entering mitosis and leading to osteosarcoma deterioration. Western blot analysis of tumor tissues showed that irradiation combined with CDC20 inhibition resulted in upregulated pro-apoptosis protein Bax and downregulated anti-apoptosis protein Bcl-2 33-35. We speculate that wild-type p53 activated by IR induces p21 and suppresses the expression of CDC20, leading to apoptosis and G2/M arrest. In contrast, mutant p53 shows impaired ability to regulate CDC20, as well as growth arrest and apoptosis. Radiation therapy is the one of the most common cancer treatments. The most important finding in this study is that the CDC20 suppression improved the radiosensitivity of HCC cells. However, our results showed that CDC20 suppression combined with x-ray irradiation significantly suppressed cell proliferation of Hep3B cells, but only moderately suppressed HepG2 cell proliferation. CDC20 expression is suppressed by genotoxic stress in p53- and p21-dependent manners. We found accumulation of p53 and p21 proteins and suppression of CDC20 in p53-wildtype HepG2 cell lines treated with IR. In contrast, the protein levels of p53 and p21 were unchanged and CDC20 expression increased in p53-mutant Hep3B cells with IR treatment. Over 50% of human malignancies contain a mutation in p53, including HCC 36. p53 is a key component in the DDR pathway, and mutation of P53 impairs its regulatory function in growth arrest, apoptosis, and senescence. The presence of p53 mutation in cancer is associated with a dismal prognosis 37, 38. We found that silencing of CDC20 enhanced the sensitivity to radiation in Hep3B cells mainly by amplify radiotherapy effect on growth retardation, DNA damage accumulation, apoptosis increase, and G2/M phase arrest. These findings demonstrate that CDC20 inhibition has a significant radiotherapy sensitization effect and that CDC20 might be a useful new potential therapeutic target and prognostic biomarker for HCC, especially in concert with p53 mutation. There are some advantages of this study. First, this research contained independent HCC cohorts. Second, we demonstrated the value of significantly elevated CDC20 expression for HCC prognosis and identified CDC20 as the most valuable gene for further analysis. Third, at both the mRNA and protein levels, we validated the association between CDC20 expression and HCC prognosis. Finally, functional enrichment analysis was performed. The role of CDC20 in the infiltration of immune cells in the tumor microenvironment was demonstrated, which may guide cancer treatment and targeted drug development. However, there are also some limitations. First, we only performed analysis without evidence from cytological tests. Hence, we could not directly investigate the effect of CDC20 on the malignant behaviors of HCC. Second, the underlying mechanism of CDC20 in HCC remains unknown. In the next experiment, we will conduct further research and excavation on the specific role of CDC20 in HCC and upstream and downstream signaling pathways, and intend to select subsequent signal pathways to verify the malignant biological significance of target genes.

Conclusion

In conclusion, we found that that CDC20 was highly expressed in HCC and participated in radio resistance of HCC cells with P53 mutation Bcl-2/Bax via signaling pathway. This study is the first to present evidence that CDC20 may play a role in improving the efficacy of radiotherapy in HCC.
  35 in total

Review 1.  Low-dose hyper-radiosensitivity: a consequence of ineffective cell cycle arrest of radiation-damaged G2-phase cells.

Authors:  B Marples; B G Wouters; S J Collis; A J Chalmers; M C Joiner
Journal:  Radiat Res       Date:  2004-03       Impact factor: 2.841

2.  Requirement for p53 and p21 to sustain G2 arrest after DNA damage.

Authors:  F Bunz; A Dutriaux; C Lengauer; T Waldman; S Zhou; J P Brown; J M Sedivy; K W Kinzler; B Vogelstein
Journal:  Science       Date:  1998-11-20       Impact factor: 47.728

Review 3.  Indoor tanning prevalence after the International Agency for Research on Cancer statement on carcinogenicity of artificial tanning devices: systematic review and meta-analysis.

Authors:  A J Rodriguez-Acevedo; A C Green; C Sinclair; E van Deventer; L G Gordon
Journal:  Br J Dermatol       Date:  2019-10-16       Impact factor: 9.302

Review 4.  Advances in targeted therapies for hepatocellular carcinoma in the genomic era.

Authors:  Josep M Llovet; Augusto Villanueva; Anja Lachenmayer; Richard S Finn
Journal:  Nat Rev Clin Oncol       Date:  2015-06-09       Impact factor: 66.675

5.  Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo.

Authors:  T Miyashita; S Krajewski; M Krajewska; H G Wang; H K Lin; D A Liebermann; B Hoffman; J C Reed
Journal:  Oncogene       Date:  1994-06       Impact factor: 9.867

6.  The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphase-promoting complex to control anaphase initiation.

Authors:  G Fang; H Yu; M W Kirschner
Journal:  Genes Dev       Date:  1998-06-15       Impact factor: 11.361

Review 7.  Hallmarks of cancer: the next generation.

Authors:  Douglas Hanahan; Robert A Weinberg
Journal:  Cell       Date:  2011-03-04       Impact factor: 41.582

8.  A Synthetic Interaction between CDC20 and RAD4 in Saccharomyces cerevisiae upon UV Irradiation.

Authors:  Bernadette Connors; Lauren Rochelle; Asela Roberts; Graham Howard
Journal:  Mol Biol Int       Date:  2014-02-23

9.  Determining consistent prognostic biomarkers of overall survival and vascular invasion in hepatocellular carcinoma.

Authors:  Otília Menyhárt; Ádám Nagy; Balázs Győrffy
Journal:  R Soc Open Sci       Date:  2018-12-05       Impact factor: 2.963

View more
  8 in total

1.  Increased DNA Polymerase Epsilon Catalytic Subunit Expression Predicts Tumor Progression and Modulates Tumor Microenvironment of Hepatocellular Carcinoma.

Authors:  Haijia Tang; Xiaoxin Hu; Fujiang Xu; Kefei Lin; Wenhao Xu; Haineng Huang; Hailiang Zhang; Yu Xiao; Dongdong Sun; Wangrui Liu; Shiyin Wei
Journal:  J Cancer       Date:  2022-06-03       Impact factor: 4.478

2.  Epigenetic and Immune-Cell Infiltration Changes in the Tumor Microenvironment in Hepatocellular Carcinoma.

Authors:  Zeng-Hong Wu; Dong-Liang Yang; Liang Wang; Jia Liu
Journal:  Front Immunol       Date:  2021-12-02       Impact factor: 7.561

3.  A Novel Gene Signature Based on CDC20 and FCN3 for Prediction of Prognosis and Immune Features in Patients with Hepatocellular Carcinoma.

Authors:  Xing Lai; Ya-Kun Wu; Guo-Qing Hong; Jun-Ke Li; Qing Luo; Jin Yuan; Guo-Hua Dai; Shuang-Quan Liu; Hua-Guo Feng
Journal:  J Immunol Res       Date:  2022-03-30       Impact factor: 4.818

Review 4.  CDC20 in and out of mitosis: a prognostic factor and therapeutic target in hematological malignancies.

Authors:  Samantha Bruno; Andrea Ghelli Luserna di Rorà; Roberta Napolitano; Simona Soverini; Giovanni Martinelli; Giorgia Simonetti
Journal:  J Exp Clin Cancer Res       Date:  2022-04-30

5.  Replication Stress: A Review of Novel Targets to Enhance Radiosensitivity-From Bench to Clinic.

Authors:  Yuewen Zhang; Lei Wu; Zhao Wang; Jinpeng Wang; Shrabasti Roychoudhury; Bartlomiej Tomasik; Gang Wu; Geng Wang; Xinrui Rao; Rui Zhou
Journal:  Front Oncol       Date:  2022-07-08       Impact factor: 5.738

6.  Identification of the Diagnostic Biomarker VIPR1 in Hepatocellular Carcinoma Based on Machine Learning Algorithm.

Authors:  Song Ge; Chen-Rui Xu; Yan-Ming Li; Yu-Lin Zhang; Na Li; Fei-Tong Wang; Liang Ding; Jian Niu
Journal:  J Oncol       Date:  2022-09-15       Impact factor: 4.501

7.  Integrating machine learning to construct aberrant alternative splicing event related classifiers to predict prognosis and immunotherapy response in patients with hepatocellular carcinoma.

Authors:  Wangrui Liu; Shuai Zhao; Wenhao Xu; Jianfeng Xiang; Chuanyu Li; Jun Li; Han Ding; Hailiang Zhang; Yichi Zhang; Haineng Huang; Jian Wang; Tao Wang; Bo Zhai; Lei Pan
Journal:  Front Pharmacol       Date:  2022-10-03       Impact factor: 5.988

8.  Risk Predictive Model Based on Three DDR-Related Genes for Predicting Prognosis, Therapeutic Sensitivity, and Tumor Microenvironment in Hepatocellular Carcinoma.

Authors:  Renzhi Hu; Xiping Liang; Qiying Li; Yao Liu
Journal:  J Oncol       Date:  2022-09-30       Impact factor: 4.501

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.