| Literature DB >> 34511573 |
Naoki Miyashita1, Masahiro Onozawa1, Keito Suto1, Shinichi Fujisawa2, Nanase Okazaki3, Daisuke Hidaka1, Hiroyuki Ohigashi1, Atsushi Yasumoto1, Junichi Sugita1, Daigo Hashimoto1, Yoshihiro Matsuno3, Takanori Teshima1,2.
Abstract
Right neck swelling and pain occurred in a 49-year-old man. A Blood count showed a slight increase in platelet count without leukemoid reaction. After a biopsy of the cervical mass and bone marrow aspiration, a diagnosis of extramedullary blast crisis (EBC) of chronic myeloid leukemia (CML) was made. Fluorescence in situ hybridization (FISH) analysis showed a BCR-ABL1 fusion signal, but results of real-time polymerase chain reaction (RT-PCR) for major and minor BCR-ABL1 transcripts were negative. We identified a rare e1a3 BCR-ABL1 fusion transcript. Administration of dasatinib resulted in disappearance of the extramedullary tumor. This is the first reported case of CML-EBC with e1a3 transcript. An aleukemic extramedullary tumor can be the initial presentation of CML.Entities:
Keywords: BCR-ABL1; Philadelphia (Ph) chromosome; e1a3; extramedullary blast crisis
Mesh:
Substances:
Year: 2021 PMID: 34511573 PMCID: PMC9038454 DOI: 10.2169/internalmedicine.8319-21
Source DB: PubMed Journal: Intern Med ISSN: 0918-2918 Impact factor: 1.282
Laboratory Data at the First Consultation.
| WBC | 8,500 | /μL | PT | 11.4 | s | TP | 7.5 | g/dL | Cr | 0.64 | mg/dL | |||||||
| Blast | 0.0 | % | APTT | 28 | s | ALB | 4.3 | g/dL | Na | 140 | mEq/L | |||||||
| Neutro | 65.8 | % | Fbg | 664 | mg/dL | T-Bil | 0.7 | mg/dL | K | 4.8 | mEq/L | |||||||
| Lympho | 28.5 | % | D-dimer | 1.98 | mg/dL | D-Bil | 0.1 | mg/dL | Cl | 104 | mEq/L | |||||||
| Mono | 4.7 | % | AST | 23 | U/L | Ca | 9.4 | mg/dL | ||||||||||
| Eosino | 0.5 | % | ALT | 37 | U/L | CRP | 3.51 | mg/dL | ||||||||||
| Baso | 0.5 | % | LD | 221 | U/L | sIL-2R | 278 | U/mL | ||||||||||
| RBC | 524×104 | /μL | ALP | 419 | U/L | |||||||||||||
| Hb | 16.1 | g/dL | γ-GTP | 90 | U/L | |||||||||||||
| Plt | 35.5×104 | /μL | BUN | 15 | mg/dL |
WBC: white blood cell, Neutro: neutrophil, Lympho: lymphocyte, Mono: monocyte, Eosino: eosinophil, Baso: basophil, RBC: red blood cell, Hb: hemoglobin, Plt: platelet, PT: prothrombin time, APTT: activated partial thromboplastin time, Fbg: fibrinogen, TP: total protein, ALB: albumin, T-Bil: total bilirubin, D-Bil: direct bilirubin, AST: aspartate aminotransferase, ALT: alanine aminotransferase, LD: lactate dehydrogenase, ALP: alkaline phosphatase, γ-GTP: γ-glutamyl transpeptidase, BUN: blood urea nitrogen, Cr: creatinine, Na: sodium, K: potassium, Cl: chlorine, Ca: calcium, CRP: c-reactive protein, sIL2-R: soluble interleukin-2 receptor
Figure 1.A: A CT scan showed a supraclavicular mass with a low-density area (arrow). B: PET-CT showed FDG uptake at cervical and supraclavicular masses (arrows). C: Histopathology (Hematoxylin and Eosin staining). Left: Most of the tissue specimen was necrotic (loupe view). Right: Dense aggregates of atypical mononuclear cells were found in some areas (original magnification ×40).
Figure 2.A: Bone marrow smear obtained at presentation, compatible with CML (May-Giemsa, ×100). B: G-band of BM showed Philadelphia chromosome (the most dominant karyotype). C: FISH showed typical BCR-ABL1 fusion signal. D: RT-PCR, lane 1: GAPDH (internal control of the patient sample), lane 2: major BCR-ABL1 of the patient sample, lane 3: minor BCR-ABL1 of the patient sample, lane 4: major BCR-ABL1 (positive control), lane 5: major BCR-ABL1 (negative control), lane 6: minor BCR-ABL1 (positive control), lane 7: minor BCR-ABL1 (negative control). The minor BCR-ABL1 is detected as a 320-bp size band, but a smaller band of about 120-bp was detected in this case. E: Schema of the transcript of our case. F: Sanger sequence of the a1e3 transcript.
Primer Sequences for Nested PCR.
| Major BCR-ABL | Forward primer (5’-3’) | Reverse primer (5’-3’) | ||
| First round | GAGTCACTGCTGCTGCTTATGTC | TTTTGGTTTGGGCTTCACAC | ||
| Second round | CACGTTCCTGATCTCCTCTGAC | ACACCATTCCCCATTGTGATTAT | ||
| Minor BCR-ABL | Forward primer (5’-3’) | Reverse primer (5’-3’) | ||
| First round | CGCTCTCCCTCGCAGAACT | TTTTGGTTTGGGCTTCACAC | ||
| Second round | ACTGCCCGGTTGTCGTGTC | ACACCATTCCCCATTGTGATTAT |
Cases of e1a3 BCR-ABL1 Transcripts Reported in Literature.
| Case | Age | Sex | Diagnosis | Karyotype (the most dominant karyotype was shown) | Extramedullary lesions | Therapy | Transplant | References |
|---|---|---|---|---|---|---|---|---|
| 1 | 43 | M | ALL | 46,XY,del(9)(p22)t(9;22)(q34;q11),del(20)(q13) | NA | IMA+chemo | allogeneic | (12) |
| 2 | 65 | M | ALL | 46,XY,t(9;22)(q34;q11) | NA | IMA+chemo | - | (12) |
| 3 | 76 | M | ALL | NA | NA | Dasa | - | (13) |
| 4 | NA | M | ALL | 46,XY,t(1;21)(p36.1;q22),t(2;7)(p12;p13),t(9;22)(q34;q11.2) | NA | IMA+chemo | allogeneic | (14) |
| 5 | NA | M | ALL | 46,XY,ider(9)(q10)t(9;22)(q34;q11.2),der(22)t(9;22) | NA | IMA+chemo | - | (14) |
| 6 | 62 | F | ALL | NA | NA | IMA | NA | (15) |
| 7 | 25 | F | ALL | 46,XX,t(9;22)(q34;q11) | NA | NA | allogeneic | (16) |
| 8 | 62 | M | ALL | 46,XY,t(9;22)(q34;q11.2) | NA | chemo | autologous | (17) |
| 9 | 64 | F | ALL | 46,XX | NA | chemo | - | (17) |
| 10 | 31 | M | ALL | 44,XY,dic(3;9)(q27:p11), t(9;22)(q34:q11), -7 | NA | IMA+chemo | allogeneic | (17) |
| 11 | 61 | F | ALL | NA | NA | IMA+chemo | - | (17) |
| 12 | 48 | M | ALL | 46,XY | NA | chemo | - | (17) |
| 13 | 45 | F | ALL | NA | NA | IMA+chemo | allogeneic | (17) |
| 14 | NA | NA | ALL | NA | NA | NA | NA | (18) |
| 15 | 1 | NA | ALL | NA | NA | NA | NA | (19) |
| 16 | 39 | NA | ALL | NA | NA | NA | NA | (20) |
| 17 | NA | NA | ALL | NA | NA | NA | NA | (21) |
| 18 | 68 | M | AML | 46,XY,t(9;22)(q34;q11) | NA | Dasa→Pona | - | (22) |
| 19 | NA | NA | CML-CP | NA | NA | NA | NA | (23) |
| 20 | NA | NA | CML-CP | NA | NA | NA | NA | (24) |
| 21 | NA | NA | CML-CP | NA | NA | NA | NA | (25) |
| 22 | 41 | F | CML-CP | 46,XX,t(9;22;17)(q34;q11;q24) | NA | IFN-α→IMA | - | (26) |
| 23 | 64 | F | CML-CP | NA | NA | IMA | - | (26) |
| 24 | 75 | F | CML-CP | 46,XX,t(9;22)(q34;q11.2) | NA | - | - | (27) |
| 25 | 68 | F | CML-CP | 46,XX,t(9;22)(q34;q11) | NA | IFN-α+HU | - | (28) |
| 26 | 80 | M | CML-BC | 46,XY,t(9;22)(q34;q11.2) | NA | IMA | - | (29) |
| Our case | 49 | M | CML-BC | 46,XY,t(9;22)(q34;q11.2) | YES | Dasa |
ALL: acute lymphoblastic leukemia, CP: chronic phase, BC: blast crisis, IMA: imatinib, Dasa: dasatinib, Pona: ponatinib, IFN-α: interferon-α, HU: hydroxyurea, NA: not available