Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: Two new symbiont haplotypes in the Mediterranean basin.

The olive fruit fly, specialized to become monophagous during several life stages, remains the most important olive tree pest with high direct production losses, but also affecting the quality, composition, and inherent properties of the olives. Thought to have originated in Africa is nowadays present wherever olive groves are grown. The olive fruit fly evolved to harbor a vertically transmitted and obligate bacterial symbiont -Candidatus Erwinia dacicola- leading thus to a tight evolutionary history between olive tree, fruit fly and obligate, vertical transmitted symbiotic bacterium. Considering this linkage, the genetic diversity (at a 16S fragment) of this obligate symbiont was added in the understanding of the distribution pattern of the holobiont at nine locations throughout four countries in the Mediterranean Basin. This was complemented with mitochondrial (four mtDNA fragments) and nuclear (ten microsatellites) data of the host. We focused on the previously established Iberian cluster for the B. oleae structure and hypothesised that the Tunisian samples would fall into a differentiated cluster. From the host point of view, we were unable to confirm this hypothesis. Looking at the symbiont, however, two new 16S haplotypes were found exclusively in the populations from Tunisia. This finding is discussed in the frame of host-symbiont specificity and transmission mode. To understand olive fruit fly population diversity and dispersion, the dynamics of the symbiont also needs to be taken into consideration, as it enables the fly to, so efficiently and uniquely, exploit the olive fruit resource.

Introduction

The olive tree was likely the first domesticated fruit tree, and although domestication probably began in the Eastern Mediterranean, selection for cultivars took place at several different independent locations [1-3]. Given time and appropriate conditions, the olive fruit fly evolved to explore this resource. This fruit fly, Bactrocera oleae (Rossi, 1790), has specialized to become monophagous and it remains the most important olive tree pest. Production losses are estimated on an average of more than 15% yearly [4], and this fly has been responsible for losses of up to 80% of oil value and 100% of some table cultivars [5]. To cope with the olive-plant abundant secondary metabolites, particularly the defensive compound oleuropein (a bitter and otherwise toxic phenolic glycoside) [6], the olive fruit fly evolved to harbor a vertically transmitted and obligate bacterial symbiont—Candidatus Erwinia dacicola [7] leading thus to a tight evolutionary history between olive tree, fruit fly and obligate, vertical transmitted symbiotic bacterium.

The olive fruit fly is thought to have originated in Africa and then spread to the Mediterranean basin and South Central Asia [8], and it is nowadays present wherever olive groves are grown. Nardi and co-workers [9] presented the first comprehensive study on olive fly populations and found evidence of a population subdivision into three regional groups, Pakistan, Africa and Mediterranean plus America. Further, there is evidence of a separation between Iberian (Western Mediterranean) and Italic (Central Mediterranean) olive fly populations [10], with no clearly defined boundary [8]. Van Asch and co-workers [8] observed intermixing to extend at variable levels throughout their whole studied area, from Northwestern Italy to Portugal.

As an obligate symbiont, mechanisms that ensure vertical transmission have evolved and Ca. Erwinia dacicola is transmitted to the following generation at the oviposition [7,11,12] guaranteeing symbiont acquisition by the offspring but also host-symbiont specificity. When transmission is strictly vertical, host switching would not be expected, and co-evolution of host and symbiont lineages should be observed. For both symbiont and host, failure in vertical transmission has high costs, and is usually equivalent to death of the symbiont and significant reduction in host fitness or high mortality. Selection at these endosymbiotic bacteria likely results from selection imposed by the host and that from selection emerging in a symbiotic context but independent from the host [13]. Furthermore, the cyclic events of transmission -where a given number of symbionts are passed to the next generation- are likely to create strong bottlenecks affecting symbiont population dynamics. Not much is known on the diversity and structure of ca. Erwinia dacicola except that there is evidence of two lineages of this endosymbiont in Italian populations, based on 16S rRNA gene sequences [14].

Understanding how the pest population spreads is essential for its management. The close association of this monophagous fly species with its host, and its possibility of laying eggs throughout most of the year, allows for a fairly stable population and the rate of population change is mainly shaped by density-dependent population feedback [15]. Its spreading is intricately connected to the spreading of the plant host, as this relation seems the result of long-term co-evolution. In most areas where olives are grown commercially, the olive fruit fly can be found and have become a major pest. In North America was first detected in 1998 in California [16], and it has spread throughout the region, including in Central and South America. Nowadays it seems that the olive fruit fly can also be found well outside the Mediterranean basin in Central and South Africa, and not only in the Middle East but also in China and India; Australia seems to be the only area in the world, where olives are cultivated and well established for commercial purposes, which is still free of olive fruit fly [17].

Having as rationality this intricate tripartite relation between olive tree, olive fruit fly and Ca. Erwinia dacicola symbiont, this work aimed to add this obligate symbiont genetic diversity in the understanding of the distribution pattern of the holobiont at nine locations throughout four countries in the Mediterranean Basin. We focused on the Iberian cluster and on the hypothesis that the Tunisian samples would fall into a differentiated cluster due to the proximity to the Italic peninsula cluster. To date, and to the best of our knowledge, the genetic diversity present within the olive fly symbiont has only investigated for the Italian populations [14]. Therefore, the present study looked at a) haplotypes from four mitochondrial DNA fragments of the host fly, b) patterns of ten microsatellites of the host fly and c) 16S rRNA gene sequence diversity of Ca. E. dacicola. Albeit with a limited geographical and populational coverage, it was intended to look for population differentiation, gaining insights into gene flow and spreading. Overall rising temperatures, warmer winter minimum temperatures and changes in precipitation patterns that are likely linked to water shortages [18] are affecting the spreading of insects and their aggressiveness as pests in largely unknown ways [19]. These changes will lead to species specific dynamics [20-22], which likely will impact on the interaction of the olive and its obligate olive fruit fly.

Methodology

Data collection

Olive fruit flies were sampled at 9 locations (3 in Portugal, 3 in Spain, 1 in France and 2 in Tunisia; Table 1), either directly, with the permission of the owners, or made available by colleagues and/or landowners (see acknowledgements). Sampling did not involve endangered or protected species. Olives were collected and stored in plastic boxes, with emerging pupae and adults being gathered up to 12 specimens per location. Individuals were stored at -20 °C in 70% ethanol until DNA extraction. Individuals were allowed to dry on filter paper prior to DNA extraction. DNA from whole body tissue was extracted following extraction protocols [23] using CTAB extraction buffer after being ground up with a plastic pestle. Proteins were removed with 24: 1 isoamylalcohol: chloroform, and DNA precipitated with isopropanol. DNA extracts were eluted in 50 μl of sterile water. All extraction products were stored at -20 °C and later used directly in the PCRs.

Table 1

Sampling locations and collection year (see acknowledgements for collectors’ information).

Country	Location	Code	Coordinates		Year
Portugal	Guimarães	GUI	41.46N	8.31W	2016
Portugal	Valverde	VAL	38.86N	7.27W	2019
Portugal	Lagos	LAG	37.13N	8.68W	2016
Spain	LaRoda	LRD	39.09N	2.19W	2019
Spain	Seville	SEV	37.47N	5.99W	2019
Spain	Almeria	ALM	36.89N	2.44W	2016
France	Montpellier	MON	43.61N	3.87E	2017
Tunisia	Bouficha	BOU	36.30N	10.45E	2017
Tunisia	Zarzis	ZAR	33.50N	11.12E	2017

Olive fruit fly mtDNA sequences

Four highly variable sections of mtDNA were amplified and sequenced. These were amongst the five sections selected by van Asch and co-workers [10], based on the number of polymorphisms previously described in a Mediterranean region dataset [24]. These include both tRNA-Leu genes and segments of the ND2, ND4, COX1 and COX2 and genes, ca. 24% of the complete mitochondrial genome of B. oleae [10] (see S1 Table for primer information). PCR reactions were conducted using 1 μl of the extracted DNA in a standard 25 μl reaction, with 0.5 pmol/μl of each primer, 1.5 mM MgCl2, 0.5 mM dNTPs and 0.04 U/ml Taq DNA polymerase. The touch-down cycle protocol involved two-phases; 1) initial denaturation at 94 °C for 5 min, followed by 10 cycles of denaturation at 94 °C for 30 s, annealing at variable temperatures for 30 s (set at 60 °C and decreasing by 0.5 °C per cycle) and extension at 72 °C for 1 min; 2) 25 cycles of 94°C for 30 s, 50 °C for 30 s, and 72°C for 1 min, followed by a final extension of 72 °C for 7 min. The PCR products, after visualized on agarose gel, were purified using the NZYGelpure kit (from NZYTech, Lda) and sequencing was done commercially (Macrogen Inc.).

Electropherograms were inspected using Genestudio V.2.2.0.0 (www.genestudio.com) and sequences were cropped to the minimal region of overlap for all individuals using the same software. The 21 Bactrocera oleae full mitochondrial genomes made available by Nardi and co-workers [24] were aligned with our sequences and the same regions of overlap were extracted. All alignments were made using the Muscle tool implemented in MEGA X [25]. The amplified mitochondrial DNA segments and the database obtained ones were concatenated per individual. Median-joining networks [26] were calculated using the PopART [27] software.

nDNA genotyping

Ten microsatellite loci were used in the analysis (Table 2) [28]. PCR amplification was performed in a total volume of 15 μl, with.5 mM MgCl2, 0.5 mM dNTPs, 0.04 U/ml Taq DNA polymerase and 0.5 pmol/μl of each locus-specific primer with one of the primers in pair elongated for M13(-21) universal sequence (Schuelke 2000), 0.25 lM of M13(-21) universal primer labelled with dyes 6-FAM, VIC, PET or NED (Applied Biosys- tems, Foster City, CA, USA), 0.375 unit of Taq DNA polymerase (Fermentas, Vilnius, Lithuania) and 25 ng of genomic DNA. Fragment analysis by capillary electrophoresis was performed commercially at STAB VIDA Lda. Microsatellite genotypes were visualized and manually controlled with GeneMapper version 4.1 software (Applied Biosystems). GenAlEx version 6.5 [29] was used to determine the following parameters of genetic variability: number of alleles (n), number of effective alleles (ne), observed heterozygosity (Ho), expected heterozygosity (He) and Unbiased Expected heterozygosity (uHe). POPGENE version 1.31 [30] was used to calculate deviations from Hardy–Weinberg equilibrium with likelihood ratio (G2 test) and for determination of the Shannon’s Information Index (I) and fixation index (Fst) and inbreeding coefficient (Fis) and gene flow (Nm) between populations. The genetic distances were estimated on the same software using Nei’s (1978) unbiased genetic distance coefficient, and the dendrogram was constructed based on the unweighted pair-group arithmetic average (UPGMA) method and visualized in Mega X [25]. STRUCTURE 2.3.4 [31] was used to classify the individuals into a set number of clusters (K). Using the admixture ancestry model and correlated allele frequency model different values for K, from one to ten, were tested running the analysis 10 times for each cluster (each run consisted of a burn-in period of 50 000 and 100 000 Markov chain Monte Carlo (MCMC) repetitions after the initial burn-in). The most appropriate cluster number was selected using the method reported by [32].

Table 2

Microsatellite [28] loci motif, accession numbers and primer used.

Locus name	Motif	Acc. Number	Primer sequence
Boms5	(CA)10TA(CA)2 (CA)9	EU489749	F: TGTAAAACGACGGCCAGTTCTCGCCCCAATTACCACR: GAATTTTGGCAACATCCAAGC
Boms8	(CA)7CG(CA)5	EU489752	F: TGTAAAACGACGGCCAGT TGACATACATGCCTTCATTCACR: CAGAAAAGCTTAAAACTAGCGG
Boms18	(CA)13	AF467828	F: TGTAAAACGACGGCCAGTGCCATGAATGCAGACCACR: CCTATTCAAATGCACGCAAAAC
Boms21	GTGG(GT)13ATGT	AF467827	F: TGTAAAACGACGGCCAGTTCGCCTCTTACCTCACAACCR: ACCATCCTTAGTCAGCACAGTC
Boms25	(GT)12	AF467826	F: TGTAAAACGACGGCCAGT TGGAATGCGCTATTTTGTTGR: ACTCGTATATACGTACATGG
Boms30	(GT)17	AF467823	F: TGTAAAACGACGGCCAGT CTGACTTCTTGCTTTACACGR: CAGCTTATCTGCTTTAAGTGC
Boms32	(CA)14	EU489765	F: TGTAAAACGACGGCCAGTTGTATGTATTTGTGCGTCGR: GCTTAGACCATTTGCTCC
Boms34	(CA)3CTA(CA)8	EU489767	F: TGTAAAACGACGGCCAGTACGCCGCACACTTCTTAAACR: CACCCAACTTTTGTAGTTTCC
Boms58	A6CA3GCA6TA5CA5	EU489782	F: TGTAAAACGACGGCCAGTAGTTGGACGCGCACATATCR: AGCGCGTACGAGCTTTAGC
Boms59	TGTA(TG)10	DQ078250	F: TGTAAAACGACGGCCAGTAGCGCTTACATAAATATAGCTACR: TCCCCGTAAAGCCATAAAGTC

Ca. Erwinia dacicola 16S sequences

For the selective amplification of a fragment sequence of the 16S recombinant deoxyribonucleic acid (rDNA) of Ca. Erwinia dacicola, a specific primer (EdF1) was paired with 1507R for PCR as previously described [11]. PCR reactions were conducted using 1 μl of the extracted DNA in a standard 25 μl reaction, with 0.5 pmol/μl of each primer, 1.5 mM MgCl2, 0.5 mM dNTPs and 0.04 U/ml Taq DNA polymerase with the following cycle protocol: initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing for 30 s at 55 °C and extension at 72 °C for 30 s, followed by a final extension of 72 °C for 10 min. The PCR products, after visualized on agarose gel, were purified using the NZYGelpure kit (from NZYTech, Lda) and sequencing was done commercially (Macrogen Inc.). Electropherograms were inspected using Genestudio (www.genestudio.com). The evolutionary history was inferred by Maximum Likelihood and using the Hasegawa-Kishino-Yano model as selected model of evolution. Both analyses were performed in Mega X [25].

Results

From the sections of mtDNA sequenced, we retrieved a total of 3626 bp and 87 polymorphic sites (S2 Table) and Table 3 further summarizes nucleotide data at the four segments analysed, including Tajima’s Neutrality Test that suggest that the DNA sequences studied are evolving under a non-random process, with many low frequency alleles causing low average divergence—characteristic of population expansion.

Table 3

Nucleotide frequencies and polymorphisms in Bactrocera oleae (S = number of segregating sites, ps = S/m, Θ = ps/a1, π = nucleotide diversity, and D is the Tajima test statistic).

	Nucleotide Frequencies (%)					Tajima’s Neutrality Test
gene	T	C	A	G	Total(2)	S	ps	Θ	π	D
ND2	36.5	18.4	35.1	9.9	1005.9	8	0.009	0.002	0.001	-1.537
Cox	33.6	20.6	28.9	16.9	605.1	14	0.023	0.005	0.002	-1.490
CLC (1)	33.7	21.4	32.3	12.6	989.4	39	0.039	0.008	0.003	-2.018
ND4	26.9	16.7	49.1	7.3	870.7	12	0.012	0.002	0.001	-1.154
Total	32.8	19.2	36.7	11.3	3471.1	88	0.024	0.005	0.002	-1.838

(1) fragment comprising part of COX1, tRNA-Leu (UUR) and COX2;

(2) average number of total nucleotides.

The Median-joining work representing relationships among mitochondrial haplotypes of olive fly is represented in Fig 1.

Fig 1

Median-joining network representing relationships among the haplotypes (S2 Table) from the analysed segments of mitochondrial DNA of the olive fruit fly (Bactrocera oleae).

Circles represent haplotypes and the size of the circles is proportional to the frequency of the haplotype (black circles represent unobserved intermediate haplotypes and the length of the connections is proportional to the number of mutational steps that separate the haplotypes; these shared haplotypes are described on S3 Table). Colours correspond to the geographical cluster represented in the map. The grey coloured ovals correspond to maximum likelihood clades with a bootstrap value higher than 70% (in 1000 replicates; S1 Fig).

All ten microsatellite markers were polymorphic, revealing a total of 54 alleles with the parameters of genetic variability being presented on Table 4.

Table 4

Parameters of genetic variability: Number of alleles (n), number of effective alleles (ne), observed heterozygosity (Ho), expected heterozygosity (He), Unbiased Expected heterozygosity (uHe), information index (I), Hardy–Weinberg equilibrium (HWE), fixation index (Fst) and inbreeding coefficient (FIS) and gene flow (Nm) among sampling sites.

	N	ne	Ho	He	uHe	I	HWE (p)	Fst	Fis	Nm
Boms5	5	1.762	0.398	0.418	0.443	0.814	0.07	0.035	0.048	6.971
Boms8	6	1.591	0.368	0.342	0.362	0.649	0.92	0.078	-0.076	2.972
Boms18	5	3.023	0.784	0.658	0.696	1.187	0.47	0.107	-0.191	2.084
Boms21	6	2.479	0.609	0.560	0.599	1.062	0.62	0.088	-0.087	2.577
Boms25	6	2.575	0.607	0.602	0.638	1.073	0.66	0.047	-0.010	5.034
Boms30	5	2.414	0.541	0.570	0.605	0.991	0.00	0.093	0.051	2.441
Boms32	8	4.089	0.852	0.748	0.795	1.537	0.40	0.049	-0.139	4.845
Boms34	4	2.250	0.524	0.543	0.576	0.932	0.46	0.067	0.035	3.494
Boms58	4	2.589	0.609	0.592	0.627	1.071	0.59	0.069	-0.028	3.396
Boms59	5	2.039	0.379	0.487	0.514	0.874	0.01	0.071	0.222	3.266

*p value (P < 0.05).

Genetic distances among samples from all the locations were measured according to Nei’s unbiased genetic distance and the UPGMA dendrogram constructed suggests the grouping of data in two different clusters (Fig 2) albeit not related with a clear geographical pattern.

Fig 2

UPGMA dendrogram of the different sampled populations based on Nei’s unbiased genetic distance; the color codes correspond to cluster colors on Fig 1.

The associated table shows Nei’s genetic identity values (upper diagonal) and pairwise population FST values (below diagonal).

Whereas the UPGMA dendogram by definition depicts a dichotomous structure, this should be interpreted only has similarities between the haplotypes as one cluster seems the most likely number of clusters (K) according to the STRUCTURE analysis (Fig 3).

Fig 3

Plot of mean ln P(X|K) over 10 independent runs for each K (K = 1–10) suggests a higher likelihood of one cluster only.

The 16S fragment sequenced of the symbiont Ca. Erwinia dacicola specimens showed only 20 parsimonious informative sites leading to a reconstructed phylogeny (Fig 4) where the two known haplotypes -htA and htB- are in a clade (two SNPs only) and represented by 69 and 14 sequences respectively (S3 Table). Two new haplotypes, htC and htD with only 3 and 4 representatives each were found exclusively in Zarzis (htC) or Boufiche (htD) populations (note that these sequences were confirmed by two independent reactions of PCR and sanger sequencing). htC diverges from htA at 7 SNPs (and from htB at 9 SNPs), but also diverges from htD at 11 SNPs. The biggest pairwise differences are found between htD and htB (20 SNPs compared to the 18 SNPs with htA) (S1 File for sequence details).

Fig 4

Phylogenetic reconstruction of the ca. Erwinia dacicola fragment sequence (814 bp after quality trimming and alignment) of the 16S recombinant deoxyribonucleic acid (rDNA) gene.

Three other Erwinia sequences (KC139453, E. persicina; KT766070 E. aphidicola; JX867759, E. piriflorinigrans) were used to root the phylogeny (not shown). The tree with the highest log likelihood (-1304.66) is shown together with the percentage of trees in which the associated taxa clustered together (next to the branches, 1000 replicates). The selected Hasegawa-Kishino-Yano model with a discrete Gamma distribution was used to model evolutionary rate differences among sites (+G, parameter = 0.05). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

Discussion

The so far established structure of B. oleae in the Mediterranean Basin points to the existence of three clusters, with the olive fly populations in Iberia and the Levant differentiating from the ones of the Italic peninsula, albeit with intermixing [8,24]. The present work focused on the Iberian cluster and hypothesised that the Tunisian samples would fall into a differentiated cluster due to the proximity to the Italic peninsula cluster. The data obtained does not allow to confirm or dismiss the hypothesis, and a more detailed work with a higher number of samples and locations is needed. If something, the data on the fly suggests that population in this area is better seen as single cluster with no clear differentiation between populations. If for the mtDNA fragments the number of samples per population is not critical, it is well below the advisable number for microsatellite analyses (between 25 to 30 individuals seem to be needed for a reliable estimation of allele frequencies; [33]). Unfortunately, sampling relied on number of emerging adults from collected olive fruits and a high number of fruits render no insects, either by not having been infected or by death of the larvae due to storage and/or shipping conditions.

However, and when looking at the obligate symbiont Ca. Erwinia dacicola, two new 16S haplotypes were found exclusively in the populations from Tunisia. The olive fruit fly exhibits a strongest dependence of its endosymbiont Ca. E. dacicola, as it on its own does not possess the enzymatic systems required for feeding on unripped olive fruit. This actually means that the fly is a holobiont [34], better seen as a group of genetically different entities subjected to natural selection (at the level of holobiont and hologenome rather than individuals or genomes [35]). This degree of dependence associated to a vertical mode of transmission strengthens the integrity of the holobiont and stresses the importance of looking at the genetic diversity of the obligate symbiont for our understanding of the host population dynamics.

The geographical data on the Ca. E. dacicola is still scarce. The present work duplicates the known number of 16S haplotypes. These new haplotypes seem to make a sister group with the two already described 16S haplotypes [36] (Fig 4), and so far they were only found south of western Mediterranean Basin. Two hypotheses could be put forward explaining these two sister groups: 1) a single event of symbiont acquisition followed by symbiont divergence through evolution, driven by geographical or functional determinants; 2) two events of symbiont acquisition, either unrelated or due to symbiont loss and de novo acquisition through a horizontal transmission event. The limited geographical data available does not allow to disentangle between the raised hypotheses.

Following the principle that “the simplest explanation is usually the best one”, a single event of symbiont acquisition is the most likely hypothesis. In vertically transmitted symbionts there is a reduction in the purifying activity of natural selection [37,38] and the symbiont population is subjected to transmission bottlenecks, both with consequences on the symbiont genome. Theory predicts that strictly vertical transmitted symbionts are associated with high rates of amino acid substitution and the resulting reduced nucleotide base composition does not favour guanidine (G) and cytosine (C) (reviewed in [39]). Likewise, they show gene inactivation and loss, and ultimately a reduced genome ([39-41]). However, the data so far on Ca. Erwinia dacicola shows that both the genome size and GC content are similar to those of free-living bacteria than to those of other intracellular bacteria found in other insects [42,43]. These features are usually associated with facultative symbionts or with symbionts that only recently became obligate [44]. From what we know on this symbiosis, none of those special cases seem to apply. First, Ca. Erwinia dacicola seems to be an obligate symbiont, as it is believed that it allows the insect to overcome olive-plant secondary metabolites (and in particular the oleuropein) [6] and it is present in all life stages of wild olive fruit flies, being thus maintained through natural changes in diet and host metamorphosis [45]. Secondly, the olive fruit fly differentiation in the Mediterranean seems to be connected with the post-glacial recolonization of wild olives in the area [46], suggesting that symbiont acquisition is also not recent as the fly seems to be long exploiting this olive fruit resource. In such a scenario, the ‘Erwinia’ transition into an obligate symbiont probably occurred far into the evolutionary history of the olive fruit fly, before the tree domestication begun. Note needs to be taken here, as experimental data have shown that the olive fruit fly can survive and reach adulthood on ripped fruit without the obligate symbiont [6]. This raises the alternative hypothesis of a recent shift of this ‘Erwinia’ species into an obligate, vertical transmitted symbiont, probably following the domestication and human-mediated spread of this culture. On the other hand, this bacterium was found to transition between intracellular and extracellular lifestyles during specific stages of the host’s life cycle which together with the need to cope with a somewhat changing environment during the development of its polyphagous, holometabolous host, can be the reasons for the genomic similarity with free-living bacteria [11]. Also needing to be acknowledge is the possibility of DNA exchange with other transient gut bacteria (e.g., free living Enterobacter spp.) during the endosymbiont extracellular life stage, where they might coexist in the gut environment. Either way, a single transition to an obligate symbiont that became transmitted 100% vertically and uniparental (via the female) should lead to a structure genetically uniform in a clonal manner (clonality defined as in [47], the balance between vertical and horizontal gene inheritance amongst bacteria) purging genetic diversity from the population. Yet we now found a different Ca. E. dacicola 16S clade which on average diverges about 2% from the previously 16S known haplotypes. Only a study designed to disentangle the life history of these lineages will be able to distinguish between the different hypotheses, and in particularly between eventual recombination events, episodes of horizontal transmission of the symbiont or a ‘de novo’ acquisition event. An extracellular lifestyle of this symbiotic bacteria could indeed potentiate recombination events via coprophagy and/or the trophallaxis behaviour, as horizontal transfer of symbionts was observed in controlled conditions via cohabitation of symbiont-free lab populations and wild flies [48].

Nonetheless, we are dealing with a tripartite symbiosis with high specificities, and to understand olive fruit fly population diversity and dispersion there is a need to look at the olive tree population, its cultivars’ diversity and specificities, and also to the symbiont that enables the fly to so efficiently and uniquely exploit the fruit of the olive tree. All data suggest for high levels of intermixing of the fly populations, including a fast spreading of genes with fitness advantage (this ample gene flow is clear from the studies on the alleles associated with OPs resistance; [46,49,50]). The association between Bactrocera oleae and its obligate symbiont Candidatus Erwinia dacicola is key to success of the fly, enabling several generations per year as unripped fruit can be used successfully. Understanding this relation will aid in understanding pest dispersion and dynamics and in the search of alternative and sustainable pest management methods (symbiosis based; [51,52]).

Bactrocera oleae maximum likelihood reconstruction.

(DOCX)

Click here for additional data file.

Primers used to amplify Bactrocera oleae mitochondrial DNA segments analysed in this study.

(XLS)

Click here for additional data file.

Sequence variability having the Bactrocera oleae mitochondrion, complete genome AY210702 as reference.

(XLS)

Click here for additional data file.

Mitochondrial haplotypes shared by different specimens.

(XLS)

Click here for additional data file.

16S variable sites and haplotype inference.

(XLS)

Click here for additional data file.

3 Jun 2021

PONE-D-21-11736

Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: two new symbiont haplotypes in the Mediterranean basin

PLOS ONE

Dear Dr. Nobre,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Comments of both reviews should be carefully considered. Additional effort should be invested to addresses several minor editorial points in both text and the references cited that need your immediate and careful attention. I have included an annotated copy of your ms with several marks.

Please submit your revised manuscript by Jul 16 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Nikos T Papadopoulos

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

and

2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. We note that Figure 1 in your submission contains map images which may be copyrighted.

All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish this figure specifically under the CC BY 4.0 license, or (b) remove the figure from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish this figure under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The author followed a holistic approach combining data from both the host and the endosymbiont. Interestingly two new 16S haplotypes regarding the Candidatus Erwnia dacicola were detected for the Tunisian olive fly populations, which is the major finding of the manuscript, adding valuable data in the existing findings regarding the endosymbiont genetic variability.

There is also an interesting overall commentary regarding the olive fly population diversity and coevolution with the symbiont.

Generally, the manuscript is well written and structured employing a wide list of genomic tools and approaches. There is a main disadvantage regarding the microsatellites part with a restricted number of flies used for the analysis in order to have a reliable estimation. Author has explained the reason behind this and therefore assumptions based on microsatellites throughout the text are minimum.

There is a short list of minor issues that I would like to be addressed through a revised version of the manuscript:

A supplemental list with the primers/probes used would be beneficial for the reader.

Please do not use “e.g.” for citing references within the text.

Line 87-88: “These changes will lead to species specific dynamics with impact on the interaction of the olive and its obligate olive fruit fly”. This is a strong statement and it should be followed by a list of relevant references.

Line 249: “following the parsimony” please explain the meaning here and if necessary add references to support it.

Line 270: correct “this bacteria was found”

Line 287: “uniquely exploit this resource” where do you refer by “resource”?

Line 287: please correct “all data suggests” to “all data suggest”.

Reviewer #2: PONE-D-21-11736: Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: two new symbiont haplotypes in the Mediterranean basin

This paper identifies two new haplotypes of the olive fly symbiont, Ca. Erwinia dacicola, found to be uniquely associated with flies from Tunisia, and significantly different from previously described haplotypes associated with samples from Europe. These findings contrast analyses based on genomic and mitochondrial markers suggesting that the populations sampled from Africa and Europe cluster with no clear association to their geographic location. The main conclusion is that since the symbiont is vertically transmitted and essential to its host the new bacterial linages may contribute to understanding the dispersion patterns and population diversity of the fly.

The paper is well written but please note that there are many remaining typos, syntax and parsing issues which need to be attended. From the perspective of my field of expertise I have only a few comments, mostly concerning topics addressed in the results and discussion.

Please make sure that the sequencing data underlying the findings will be made publically available (I couldn’t find a note on this in the manuscript).

Introduction:

Page 4, Lines 83-84 and 222-224 (discussion): please state the hypotheses of this study in the introduction as well.

Results:

1. Figure 1 depicts the median-joining network of haplotypes derived from mitochondrial DNA analysis. In addition to the populations sampled in this study (9 locations), other flies seem to have been included in the analysis (e.g. H, GU, orange coded), which do not seem to be mentioned in the text. Please include a description of these samples. Mont = MON?

2. In Figure 2 the color codes for Montpelier and Bouficha seem to have been mixed (they do not match those in figure 1). Should there be a representation of the orange-coded cluster as well (as in figure 1)?

3. The STRUCTURE analysis and figure 3: this is a bit confusing. Should the microsatellite-based dendogram depict two clusters (as currently presented) or only one cluster? Please include a short clarification for readers which are unfamiliar with the technicalities of this specific test.

Discussion:

The discussion addresses several issues but is currently presented as one continuous mass of text. I suggest to divide the text into clear sections complying with the addressed subjects.

Lines 245 – 248: according to file S3, flies sampled from Tunisia (and other locations as well) can be associated with either one of the 4 identified symbiont haplotypes. Two points which might be considered to be included in the discussion: (1) Can the above be congruent with these two hypotheses?, and (2) can certain fly genotypes (e.g. mitochondrial haplotypes) be more prone to be associated with a certain bacterial haplotype?

Line 268: I would separate the evolution of Erwinia into an obligate symbiont from the domestication of the olive. The transition into an obligate symbiont probably occurred far into the evolutionary history of the fly, and is not associated with recent human activity.

Lines 269 – 273: another possible explanation contributing to retention of genome size of the Erwinia symbiont: it is a gut bacterium, and as such it remains exposed to transient bacteria which are ingested with the diet (probably mainly at the adult stage), and thus, to horizontal gene transfer. The composition of the gut microbiome of this fly suggest that bacteria other than the Erwinia symbiont (e.g. free living Enterobacter spp.) are intermittently associated with the fly and may contribute to DNA exchange.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-21-11736.pdf

Click here for additional data file.

9 Jun 2021

Reviewer #1: The author followed a holistic approach combining data from both the host and the endosymbiont. Interestingly two new 16S haplotypes regarding the Candidatus Erwnia dacicola were detected for the Tunisian olive fly populations, which is the major finding of the manuscript, adding valuable data in the existing findings regarding the endosymbiont genetic variability. There is also an interesting overall commentary regarding the olive fly population diversity and coevolution with the symbiont.

Generally, the manuscript is well written and structured employing a wide list of genomic tools and approaches. There is a main disadvantage regarding the microsatellites part with a restricted number of flies used for the analysis in order to have a reliable estimation. Author has explained the reason behind this and therefore assumptions based on microsatellites throughout the text are minimum.

There is a short list of minor issues that I would like to be addressed through a revised version of the manuscript:

A supplemental list with the primers/probes used would be beneficial for the reader.

This list was added as supplemental file.

Please do not use “e.g.” for citing references within the text.

Removed.

Line 87-88: “These changes will lead to species specific dynamics with impact on the interaction of the olive and its obligate olive fruit fly”. This is a strong statement and it should be followed by a list of relevant references.

Three relevant references were added to the text, that show that climate change will impact differently different insect species.

Line 249: “following the parsimony” please explain the meaning here and if necessary add references to support it.

The sentence was changed for better accuracy. What was meant as the principle of parsimony was the principle that the simplest explanation is usually the best one.

Line 270: correct “this bacteria was found”

Corrected

Line 287: “uniquely exploit this resource” where do you refer by “resource”?

By resource I meant the fruit of the olive tree. Sentence was changed accordingly

Line 287: please correct “all data suggests” to “all data suggest”.

Corrected

Reviewer #2: PONE-D-21-11736: Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: two new symbiont haplotypes in the Mediterranean basin

This paper identifies two new haplotypes of the olive fly symbiont, Ca. Erwinia dacicola, found to be uniquely associated with flies from Tunisia, and significantly different from previously described haplotypes associated with samples from Europe. These findings contrast analyses based on genomic and mitochondrial markers suggesting that the populations sampled from Africa and Europe cluster with no clear association to their geographic location. The main conclusion is that since the symbiont is vertically transmitted and essential to its host the new bacterial linages may contribute to understanding the dispersion patterns and population diversity of the fly.

The paper is well written but please note that there are many remaining typos, syntax and parsing issues which need to be attended. From the perspective of my field of expertise I have only a few comments, mostly concerning topics addressed in the results and discussion. Please make sure that the sequencing data underlying the findings will be made publically available (I couldn’t find a note on this in the manuscript).

The sequencing data on the olive fruit fly are directly available from the S1 Table as it shows all the nucleotide variability in relation to Bactrocera oleae mitochondrion, complete genome AY210702 as reference. The four Ca. Erwinia dacicola 16S haplotypes are also derived from the data made available on S3 File and were also submitted to GenBank under the codes htA: MW888710, htD: MW888711, htB: MW888712 and htC: MW888713.

Introduction:

Page 4, Lines 83-84 and 222-224 (discussion): please state the hypotheses of this study in the introduction as well.

Thank you. This was done and can now be read on Lines 79-80.

Results:

1. Figure 1 depicts the median-joining network of haplotypes derived from mitochondrial DNA analysis. In addition to the populations sampled in this study (9 locations), other flies seem to have been included in the analysis (e.g. H, GU, orange coded), which do not seem to be mentioned in the text. Please include a description of these samples. Mont = MON?

Thanks for the comment, which highlights that the information might not have been clear. The other sequences included are referred in the methodology L-119 to L-121 and these are represented by the GenBank codes and H# represents a haplotype shared by different samples. This information is indeed only presented in (S1 Table) and the haplotypes needed to be derived. Therefore, I added a S2 Table, facilitating the interpretation. A sentence is added to the legend now, for clarification. Mont = MON (now corrected).

2. In Figure 2 the color codes for Montpelier and Bouficha seem to have been mixed (they do not match those in figure 1). Should there be a representation of the orange-coded cluster as well (as in figure 1)?

You are absolutely correct as to the color codes of MON and BOU. Thank you. They are now corrected. Unfortunately, no representative of orange-coded cluster from figure 1 was available in the sampled specimens (they all corresponded to sequences coming from previous study) and therefore they could not be included in the microsatellite analyses.

3. The STRUCTURE analysis and figure 3: this is a bit confusing. Should the microsatellite-based dendogram depict two clusters (as currently presented) or only one cluster? Please include a short clarification for readers which are unfamiliar with the technicalities of this specific test.

The UPGMA dendogram by definition depicts a dichotomous structure whereas STRUCTURE infers the most likely number of clusters for a given data set using a Bayesian approach. A sentence was added to aid the reader, as suggested.

Discussion:

The discussion addresses several issues but is currently presented as one continuous mass of text. I suggest to divide the text into clear sections complying with the addressed subjects.

Thank you for the suggestion. I did struggle with finding clear sections complying with the results addressed because my original effort was exactly the opposite: I have attempted to give a more holistic perspective to the discussion by combining data from both the host and the endosymbiont. I do believe that this is one of the strong points of the manuscript, also recognized by reviewer one. Therefore, I decided to stay with my original approach.

Lines 245 – 248: according to file S3, flies sampled from Tunisia (and other locations as well) can be associated with either one of the 4 identified symbiont haplotypes. Two points which might be considered to be included in the discussion: (1) Can the above be congruent with these two hypotheses?, and (2) can certain fly genotypes (e.g. mitochondrial haplotypes) be more prone to be associated with a certain bacterial haplotype?

No doubt are the points raised interesting and relevant. Unfortunately, the scarce geographical data available does not allow to dismiss none of the two hypotheses raised in the main text. Also, the interesting possibility of high host-symbiont haplotype specificity is not possible to address with the current data. However, as soon as more data is available, I believe these suggestions can and should be discussed. A sentence was added to the discussion to allocate this comment and the data limitation.

Line 268: I would separate the evolution of Erwinia into an obligate symbiont from the domestication of the olive. The transition into an obligate symbiont probably occurred far into the evolutionary history of the fly, and is not associated with recent human activity.

This was presented in the discussion as the main hypothesis, in lines 264-267. However, it seems that it was not clear enough and therefore a sentence was added for clarification. Also further on the sentence was re-written to accommodate the comment and becoming clearer.

Lines 269 – 273: another possible explanation contributing to retention of genome size of the Erwinia symbiont: it is a gut bacterium, and as such it remains exposed to transient bacteria which are ingested with the diet (probably mainly at the adult stage), and thus, to horizontal gene transfer. The composition of the gut microbiome of this fly suggest that bacteria other than the Erwinia symbiont (e.g. free living Enterobacter spp.) are intermittently associated with the fly and may contribute to DNA exchange.

This hypothesis is now stated in a clearer way (Line 276-279).

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

4 Aug 2021

Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: two new symbiont haplotypes in the Mediterranean basin

PONE-D-21-11736R1

Dear Dr. Nobre,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Nikos T Papadopoulos

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

There is need for careful editing especially in references cited. Italics should be used for all scientific names provided

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The author addressed all my comments therefore I fully support the publication of the current manuscript.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Submitted filename: PONE-D-21-11736_R1.pdf

Click here for additional data file.

20 Aug 2021

PONE-D-21-11736R1

Olive fruit fly and its obligate symbiont Candidatus Erwinia dacicola: two new symbiont haplotypes in the Mediterranean basin

Dear Dr. Nobre:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Nikos T Papadopoulos

Academic Editor

PLOS ONE