Literature DB >> 34484560

Dietary Valine Ameliorated Gut Health and Accelerated the Development of Nonalcoholic Fatty Liver Disease of Laying Hens.

Huafeng Jian1,2,3,4,5, Sasa Miao1,2,3,4,5, Yating Liu1,2,3,4,5, Xiaoming Wang1,2,3,4,5, Qianqian Xu1,2,3,4,5, Wenting Zhou1,2,3,4,5, Huaiyu Li1,2,3,4,5, Xinyang Dong1,2,3,4,5, Xiaoting Zou1,2,3,4,5.   

Abstract

Valine is an important essential amino acid of laying hens. Dietary supplemented with BCAAs ameliorated gut microbiota, whereas elevated blood levels of BCAAs are positively associated with obesity, insulin resistance, and diabetes in both humans and rodents. General controlled nonrepressed (GCN2) kinase plays a crucial role in regulating intestinal inflammation and hepatic fatty acid homeostasis during amino acids deficiency, while GCN2 deficient results in enhanced intestinal inflammation and developed hepatic steatosis. However, how long-term dietary valine impacts gut health and the development of nonalcoholic fatty liver disease (NAFLD) remains unknown. Hence, in the present study, we elucidated the effects of dietary valine on intestinal barrier function, microbial homeostasis, and the development of NAFLD. A total of 960 healthy 33-weeks-old laying hens were randomly divided into five experimental groups and fed with valine at the following different levels in a feeding trial that lasted 8 weeks: 0.59, 0.64, 0.69, 0.74, and 0.79%, respectively. After 8 weeks of treatment, related tissues and cecal contents were obtained for further analysis. The results showed that diet supplemented with valine ameliorated gut health by improving intestinal villus morphology, enhancing intestinal barrier, decreasing cecum pathogenic bacteria abundances such as Fusobacteriota and Deferribacterota, and inhibiting inflammatory response mediated by GCN2. However, long-term intake of high levels of dietary valine (0.74 and 0.79%) accelerated the development of NAFLD of laying hens by promoting lipogenesis and inhibiting fatty acid oxidation mediated by GCN2-eIF2α-ATF4. Furthermore, NAFLD induced by high levels of dietary valine (0.74 and 0.79%) resulted in strengthening oxidative stress, ER stress, and inflammatory response. Our results revealed that high levels of valine are a key regulator of gut health and the adverse metabolic response to NAFLD and suggested reducing dietary valine as a new approach to preventing NAFLD of laying hens.
Copyright © 2021 Huafeng Jian et al.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34484560      PMCID: PMC8410442          DOI: 10.1155/2021/4704771

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Branched-chain amino acids (BCAAs), including leucine, isoleucine, and valine, are important essential amino acids for the growth and development of animals, which participate in the synthesis of proteins and precursor of other amino acids [1]. Valine deficiency results in the reduction of feed intake and growth, and a high level of leucine (Leu) further aggravates the consequences of valine deficiency [2]. As the 5th limiting amino acid of corn and soybean meal-basal diet in laying hens, valine is necessary for protein synthesis during egg formation [3, 4]. Laying hens absorbs lots of nutrients to form eggs during the peak laying period, which commonly results in intestinal villus damage and intestinal mucosa shedding. Gut microbiota plays vital roles in maintaining host health and the metabolism of nutrients and intestinal barrier function [5, 6]. In poultry, ceca has a rather slow passage rate than the small intestine and neutral to mildly acidic pH, being ideal habitats for diverse microbes, and has been indeed the most studied intestinal microbiome of poultry [6]. The middle-aged mice fed with a branch-chain amino acid-enriched mixture (BCAAem) slowed the change speed of gut microbiota and increased the abundances of the Akkermansia and Bifidobacterium while decreased the ratio of Enterobacteriaceae [7]. Laying hens is susceptible to infection by various pathogens and nonpathogens in the environment during the peak laying period, which stimulates the immune system to secrete excess inflammatory cytokines, e.g., interleukin-6 (IL-6), IL-12, interferon (IFN-γ), tumor necrosis factor-a (TNF-α), IL-1β, and inhibits anti-inflammation cytokines such as IL-10 production [6]. As an amino acid sensor, general controlled nonrepressed (GCN2) kinase deletion of intestinal antigen-presenting cells (APCs) and epithelial cells resulted in enhanced intestinal inflammation and T helper 17 cells (TH17) response, owing to enhanced inflammasome activation and IL-1β production [8]. The intestinal epithelial barrier is the most vital line of defense against microbial pathogens that enter the host through the intestinal tract [9]. The intestinal barrier integrity decrease allows the luminal antigens (microbes, toxins) through the intestinal mucosa access to the circulation and subsequently destroys the gut mucosal homeostasis, resulting in chronic inflammation and malabsorption [10]. However, recent reports indicated that elevated BCAAs circulating levels were positively associated with obesity, insulin resistance, and metabolic dysfunction in rodents and with obesity, insulin resistance, and type 2 diabetes in humans [11]. Long-term intake of higher BCAAs diet led to hyperphagia, obesity, and reduced lifespan, which also promoted hepatic steatosis and de novo lipogenesis [12]. Nonalcoholic fatty liver disease (NAFLD) is characterized by hepatic lipid deposition, steatosis, oxidative stress, and chronic inflammation, eventually resulting in a fatty liver hemorrhagic syndrome (FLHS) that has been reported as a significant cause of death in commercial layers [13]. FLHS is characterized by increased hepatic triglyceride content accompanied by liver haemorrhage and large amounts of lipid accumulation in the abdominal cavity, which usually causes considerable mortality of laying hens during the peak laying period owing to liver rupture resulting in internal bleeding [14, 15]. Hens FLHS commonly selected as a study model of NAFLD owning to the pathogenesis of FLHS was similar to NAFLD in humans, such as excessive triglyceride accumulation, severe hepatic steatosis, insulin resistance, oxidation stress, inflammatory reaction, and autophagy [16]. It has been demonstrated that GCN2 was a key regulator of liver fatty acid metabolism and the development of NAFLD [17, 18]. In addition, isobutyric and isovaleric acids, generated by fermentation of BCAAs, have been confirmed that could inhibit both cAMP-mediated lipolysis and insulin-stimulated de novo lipogenesis in primary rats and human adipocytes [19]. Our recent research found that diet supplemented with valine promoted amino acid nutrient uptake and utilization by upregulating mRNA expression levels of amino acid transporters in the jejunum and corresponding serum free amino acids concentrations, ultimately improving the production performance of laying hens [20]. Nevertheless, the effects of dietary valine supplementation on the gut microbiota, intestinal barrier function, and lipid metabolism in the liver of laying hens during the peak laying period have not been fully understood. Therefore, we hypothesized that dietary valine supplementation could ameliorate intestinal health but may produce adverse metabolic effects on the development of NAFLD of laying hens. To test this hypothesis, we used adult laying hens as a model fed with different levels of valine for 8 weeks and examined whether the effects of dietary valine supplementation on intestinal health and the development of NAFLD in laying hens were mediated by GCN2.

2. Materials and Methods

2.1. Diets, Birds, and Management

Corn and soybean meals were selected as major ingredients to make up a corn-soybean-type basal diet and prepared according to NRC (1994) [21] and China's “Chicken Feeding Standard (NY/T33-2004)” [22]. Synthetic L-Val (98% purity, Specom Biochemical Co. Ltd, Zhangjiagang, China) was supplemented to the basal diet in 0, 0.0508, 0.1016, 0.1523, and 0.2031% increments, resulting in experimental diets containing 0.59, 0.64, 0.69, 0.74, and 0.79% valine, respectively (Table 1). In addition, the ratio of other amino acids of the diet was corrected to be consistent with each group by dietary protein.
Table 1

Composition and nutrient levels of the basal diet (air-dry basis).

IngredientsDietary valine levels (%)a
0.590.640.690.740.79
Corn66.666.666.666.666.6
Soybean meal10.510.6511.211.5511.8
Wheat bran2.92.92.912.922.92
Peanut meal8.78.57.97.57.2
Limestone9.39.39.39.39.3
Soybean oil0.30.30.30.30.3
DL-methionine (98%)0.160.160.150.150.15
Lysine (78%)0.110.110.110.10.1
Valine (98%)00.05080.10160.15230.2031
CaHPO40.60.60.60.60.6
Salt0.360.360.360.360.36
Choline chloride, 60%0.20.20.20.20.2
Mineral and vitamin premixb0.270.270.270.270.27
Calculated nutritional level (%)
Crude protein (CP)14.714.714.714.714.7
ME (MJ/kg)2.682.682.682.682.68
Analyzed nutritional level (%)
Crude protein (CP)14.6514.7214.7514.7414.78
Calcium (calculated)3.583.583.593.593.59
Total phosphorus0.460.460.460.460.46
Methionine0.360.360.360.370.37
Lysine0.660.660.660.670.67
Threonine0.480.480.480.490.49
Tryptophan0.140.140.140.140.14
Arginine1.051.041.031.031.02
Leucine0.820.820.820.820.82
Isoleucine0.650.650.650.650.65
Valine0.590.640.690.740.79

aAnalyzed value of pooled experimental diets 0.59, 0.64, 0.69, 0.74, and 0.79% valine. bThe premix provided following per kilogram of diet: vitamin A, 7500 IU; vitamin D3, 2500 IU; vitamin E, 49.5 mg; vitamin K3, 2.5 mg; vitamin B1, 1.5 mg; vitamin B2, 4 mg; vitamin B6, 2 mg; vitamin B12, 0.02 mg; niacin, 30 mg; folic acid, 1.1 mg; pantothenic acid, 10 mg; biotin, 0.16 mg; chloride choline, 400 mg; sodium chloride, 2500 mg; Fe, 80 mg; Cu, 20 mg; Mn, 60 mg; Zn, 80 mg; I, 0.8 mg.

A total of 960 healthy 33-weeks-old Fengda No. 1 laying hens with similar BW and laying rate were randomly allocated into 5 experimental groups, and each group included 6 replicates of 32 laying hens (8 birds/cage). This study lasted 9 weeks, including a one-week acclimation period and 8-week experimental period. All hens were housed in an environmentally controlled room where the temperature was maintained at approximately 23°C. The hens were exposed to a 16 h photoperiod throughout the experiment by the use of artificial lighting. Hens were supplied with water and fed a complete feeding mixture twice daily. All animal works in this experiment were conducted by following the Chinese Guidelines for Animal Welfare and approved by the Zhejiang University Institutional Animal Care and Use Committee (No. ZJU2013105002) (Hangzhou, China).

2.2. Sample Collection and Processing

At the end of the 8-week experiment, 2 hens were randomly selected from each replication (12 hens in each group; a total of 60 hens) and fasted for 12 h. A blood sample (5 mL bird−1) was collected from the vein under the wing. After centrifugation at 3000 × g for 10 min, serum was separated. After blood sampling, hens were euthanized with pentobarbital sodium and sacrificed. The duodenum, jejunum, ileum, and liver were collected and fixed in 4% paraformaldehyde. The jejunum and liver were collected for the determination of antioxidant enzymes, liver function parameters, and mRNA expression. The cecum content was collected in sterile containers and then frozen in liquid nitrogen for microbiota and SCFAs analysis.

2.3. Hematoxylin and Eosin and Oil Red O

Formalin-fixed, paraffin-embedded sections (5 μm) of liver and small intestine segments were stained with hematoxylin and eosin (H&E) for histology. Frozen sections of the liver (5 μm) were stained with oil red O (OA). Villus height and crypt depth of 8 villi per intestinal sample were calculated by optical microscopy (Nikon Eclipse 80i, Nikon, Tokyo, Japan). The data included villus height (V) and crypt depth (C); the villus height to crypt depth ratio (V/C) was then calculated.

2.4. DNA Extraction, 16S rRNA Gene Sequencing, and Data Analysis

Microbial DNA was extracted from cecum contents using the QIAamp DNA Stool Mini Kit (QIAGEN, CA, Hamburg, Germany) according to the manufacturer's instructions. The purity and concentration of the extracted DNA were detected using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). V3–V4 hypervariable region of the 16S rRNA genes was magnified by barcoded primers (341F: 5′-CCTAYGGGRBGCASCAG-3′, 806R: 5′-GGACTACNNGGGTATCTAAT-3′). The clean sequences were assigned to the same operational taxonomic units (OTUs) with ≥97% similarity. The data was analyzed on the free online platform of Majorbio Cloud Platform (https://cloud.majorbio.com/). Alpha diversity, including Shannon, Simpson, Sobs, Ace, Chao1, and Coverage, was calculated to reflect the bacterial diversity and richness. Beta diversity on unweighted UniFrac was calculated based on OTU level. UniFrac-based principal component analysis (PCA) and principal coordinate analysis (PCoA) were performed to get principal coordinates and visualized from complex data. Dissimilarity in community structure between samples was calculated by nonmetric dimensional scaling (NMDS). The relative abundance of microbiota was examined at different taxonomic levels. The relative abundance of significant differences in phylum, class, order, and OTU levels was calculated by the Student's t-test with Welch's correction.

2.5. Serum and Liver Parameter Measurements

One gram liver was homogenized in 9 mL of 0.9% (w/v) sterile normal saline on ice and centrifuged at 3,500 × g and 4°C for 15 min. Total protein in the tissue supernatant was measured with a BCA protein assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's protocol and stored at -80°C. The concentrations of triglyceride (TG), total cholesterol (T-CHO), reduced glutathione (GSH), oxidized glutathione (GSSG) in the serum and liver, and liver malondialdehyde (MDA) were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively. The activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total antioxidative capacity (T-AOC), total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) in the liver were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively. The concentrations of IL-1β, IL-6, IL-10, IL-12, IL-17, TNF-α, and IFN-γ in the serum and liver were determined using chicken-specific ELISA quantitation kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively. All assays were performed according to the manufacturer's instructions.

2.6. Gas Chromatography for Short-Chain Fatty Acid (SCFA) Measurement

Quantification of acetate, propionate, butyrate, isobutyric acid, valeric acid, and isovaleric acid in the cecum contents was performed using the following procedures. Briefly, cecum content was blended with ethanol (1 : 5, w/v) and shaken vigorously, then placed on ice for 1 h. Samples were centrifuged at 10000 g for 15 min, and the supernatant was collected. Twenty microliters of orthophosphoric acid were added into 1 mL of supernatant and centrifuged for 15 min at 12000 g. A total of 2 μL supernatant was injected into a gas chromatograph (Agilent 7890A, California, USA) to determine the contents of acetate, propionate, butyrate, isobutyric, valerate, and isovaleric.

2.7. Total RNA Isolation and Relative Quantitative RT-PCR

The jejunum and liver mRNA expression levels were determined using real-time PCR. Total RNA was extracted using TRIzol reagent (Takara code: 9109, Shiga, Japan). RNA quality and quantity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). cDNA was synthesized with a HiScriptIIqRT SuperMix Reverse Transcriptase (Vazyme Biotechnology, Nanjing, Jiangsu, China). Real-time PCR was conducted with SYBR Premix PCR kit (Vazyme Biotechnology, Nanjing, Jiangsu, China) via CFX96TM Real-Time System (Bio-Rad, Hercules, CA, USA). Table 2 shows gene-specific primers for q-PCR. The reference gene β-actin was used as an internal control. Each sample was run in triplicate, and the 2- method was employed for evaluating relative mRNA expression of the target gene.
Table 2

Primers used for quantitative real-time PCR.

GenePrimerPrimer sequence (5′-3′)GenBank number
β-ActinForwardTCCCTGGAGAAGAGCTATGAANM_205518.1
ReverseCAGGACTCCATACCCAAGAAAG
GCN2ForwardGTGCCCGCATACTTACCXM_004941720.3
ReverseGCCCTACGCAGTTCCT
Caspase1ForwardTTCCTTCAACACCATCTACGXM_025142104.1
ReverseGGTGAGCTTCTCTGGTTTTA
Atg5ForwardGATGAAATAACTGAAAGGGAAGCNM_001006409.1
ReverseTGAAGATCAAAGAGCAAACCAA
Atg7ForwardTCAGATTCAAGCACTTCAGANM_001030592.1
ReverseGAGGAGATACAACCACAGAG
eIF2αForwardCAGGGGCACCCAACCTACAANM_001031323.2
ReverseCGGGCACAAA TACTTTCA TCA TCT
ATF4ForwardGAA TCGGCTAACACCAGAGGANM_204880.2
ReverseCGCA TAGCTCTCCAGCTCA TT
ReverseTGCAACGTTGACAACTAACGACA
Cyt CForwardGGAGATATTGAGAAGGGCAAGAAXM_015281453.2
ReverseATCATCTTTGTTCCTGGGATGT
ChopForwardACCCAGACAGCACGGCGAGCACXM_015273173.2
ReverseCTAAGCACGGCAGAGGCTGAGGAC
Grp78ForwardGTTACTGTGCCAGCCTACTTNM_205491.1
ReverseCCGCTTCGCTTTCTCTACTT
Caspase 3ForwardTCCCTGGTTCCAAAGGAATGXM_015276122.2
ReverseAGTAGCCTGGAGCAGTAGAA
Caspase 7ForwardTGCAAAGCCAGACAGAAGTAGXM_025151846.1
ReverseGGTCCATCGGTGCCATAAAT
Caspase 9ForwardGACCTGCTAACCATGCTACTTXM_424580.6
ReverseTTCCACTGAATCCTCCAATCC
ACOX1ForwardACTGAGCTGTGTCTCTTGTATGXM_015295164.2
ReverseGCTTCAGGTGTTTGTGGAAAG
CPT1ForwardGAGAAGAGTGCAGTGAGAAGAGXM_015286798.2
ReverseCCAGCCACAGAAGTAGAGTAAG
FASNForwardCCTGGAGATGTGGAGTATGTTGNM_205155.3
ReverseTCAAGGAGCCATCGTGTAAAG
PPARαForwardGATGCTGCGTGAAGTGAAATGXM_025150258.1
ReverseCTGGTGAAAGGGTGTCTGTTAT
PPARγForwardGTGCAATCAAAATGGAGCCNM_001001460.1
ReverseCTTACAACCTTCACATGCAT
SREBP-1cForwardGCCATCGAGTACATCCGCTTNM 204126.2
ReverseGGTCCTTGAGGGACTTGCTC
ZO-1ForwardTGTAGCCACAGCAAGAGGTGXM_015278975
ReverseCTGGAATGGCTCCTTGTGGT
OccludinForwardTCATCGCCTCCATCGTCTACNM_205128
ReverseTCTTACTGCGCGTCTTCTGG
Claudin-1ForwardTGGAGGATGACCAGGTGAAGANM_001013611
ReverseCGAGCCACTCTGTTGCCATA
Muc2ForwardATTGTGGTAACACCAACATTCATCNM_001318434.1
ReverseCTTTATAATGTCAGCACCAACTTCTC
IL-1βForwardCTCACAGTCCTTCGACATCTTCXM_015297469.1
ReverseCGGTACATACGAGATGGAAACC
TNF-αForwardGACAGCCTATGCCAACAAGTAAY765397.1
ReverseTCCACATCTTTCAGAGCATCAA
ACCForwardTACAGAGGTACCGGAGTGGTNM_205505.1
ReverseTCTTCCCGAAGGGCAAAGAC
ACLYForwardTCAAGTATGCCCGTGTCACCNM_001030540.1
ReverseTTCACCACTAAACGCTCGCT
SCD1ForwardCCTTGCGATACGTCTGGAGGXM_005025224.1
ReverseCGAAACACAGAACGGCCCA

2.8. Statistical Analysis

The Gaussian distribution of data was analyzed by the Kolmogorov–Smirnov test (SPSS 20.0, Chicago, IL, USA). The variance of the data was analyzed by the homogeneity of variance test (SPSS 20.0). Statistical analysis was performed with one-way ANOVA followed by LSD's multiple comparison tests or Student's t-test with Welch's correction with SPSS 20.0. The linear or quadratic verification was performed by SPSS 20.0. Data presented in the article are shown as means ± SEM and are considered significant at P < 0.05.

3. Results

3.1. Dietary Valine Supplementation Alleviated Intestinal Morphology of Laying Hens

As shown in Figures 1(a) and 1(c), in the duodenum, the villus height and the villus height/the crypt depth (V/C) were shown linearly or quadratic increase with increasing of dietary valine levels, and valine treatment significantly alleviated the crypt depth in a quadratic manner (Figure 1(b)). As the increase of dietary valine levels, the villus height and the V/C of the jejunum were significantly increased (Figures 1(a) and 1(c)), whereas the crypt depth was no different among different groups (Figure 1(b)). Consistent with the duodenum, the villus height and the V/C of the ileum were significantly improved and a decreased crypt depth (Figures 1(a)–1(c)). Based on improved villus height and V/C and decreased crypt depth, we conclude that diet supplemented with valine alleviated the intestinal morphology of laying hens.
Figure 1

Effects of dietary valine supplementation on villi morphology of small intestine of laying hens (n = 6). (a) Villus height. (b) Crypt depth. (c) Villus height/crypt depth (V/C). (d) Duodenum. (e) Jejunum. (f) Ileum. A-DMeans with different superscripts within a column differ significantly (P < 0.05).

3.2. Dietary Valine Treatment Altered the Structure of the Cecum Microbiota of Laying Hens

The Con (0.59% Val, basal diet did not supplement L-Val) and V4 (0.79%Val, a basal diet supplemented 0.2031% L-Val) groups were selected to analyze microbiota differences, which has a significant difference in laying rate. Among which the coverage index, a marker of sequencing depth, indicated that the data met the requirements of subsequent analysis (Table 3). As shown in Table 3 and Figures 2(a)–2(c), dietary valine treatment did not affect the α and β diversity of cecum microbiota. The relative abundance of bacteria was further evaluated at various levels. As shown in Figures 2(d)–2(f), valine treatment significantly changed the microbiota composition of phylum, class, and order levels. At the phylum level, compared with the Con group, valine treatment significantly decreased the relative abundances of Fusobacteriota and Deferribacterota (Figure 2(g)). At the class level, valine treatment significantly decreased the relative abundances of Fusobacteriia and Deferribacteres (Figure 2(h)). At the order level, valine treatment significantly decreased the relative abundance of Fusobacteriales (Figure 2(i)).
Table 3

The microbial alpha diversity based on whole OTU table in the cecal contents of laying hens treatment with valine (n = 6).

ItemsConVal P
Coverage0.9998 ± 0.00020.9998 ± 0.0002>0.9999
Observed species523.00 ± 18.60535.33 ± 26.560.71
Chao1591.38 ± 20.42589.25 ± 23.900.95
ACE580.29 ± 17.45584.87 ± 24.760.883
Shannon4.65 ± 0.084.55 ± 0.140.55
Simpson0.02 ± 0.000.03 ± 0.010.32
PD46.02 ± 1.2447.40 ± 2.020.96
Figure 2

Dietary valine treatment changed the composition and structure of cecal microbiota of laying hens (n = 6). (a)–(c) The microbial beta diversity was accessed by principal component analysis (PCA), principal coordinate analysis (PCoA), and nonmetric multidimensional scaling (NMDS) analysis based on the OTU level. (d) Relative abundance > 1% of bacterial phyla. (e) Relative abundance of class level. (f) Relative abundance of order level. (g)–(i) The relative abundance of significant differential bacteria on phylum, class, and order level. (j) LEfSe cladogram. (k) LEfSe bar. Statistical differences between two groups were calculated by Student's t-test with Welch's correction. ∗P < 0.05 was regarded as statistically significant.

Microbial compositions between groups of laying hens were further analyzed using linear discriminant analysis coupled with effect size (LEfSe). The results showed that 5 taxa in the valine treatment group were significantly less abundant than those in the Con group (Figures 2(j) and 2(k)). At the phylum level, our LEfSe analysis indicated that Fusobacteriota and Campilobacterota were significantly enriched in the cecum of laying hens in the Con group; at the class level, Fusobacteriia and Campylobacteria were significantly enriched in the Con group; at the order level, Fusobacteriales, Corynebacteriales, and Campylobacterales were significantly enriched in the Con group, whereas Eubacteriales was significantly enriched in the valine treatment group. At the family level, Fusobacteriaceae, Corynebacteriaceae, Campylobacteraceae, and Aerococcaceae were significantly enriched in the Con group but UCG-010 (p__Firmicutes.c__Clostridia.o__Oscillospirales.f__UCG-010.g__norank) was significantly enriched in the valine treatment group. At the genus level, Fusobacterium, Corynebacterium, Aeriscardovia, Campylobacter, Anaerobiospirillum, and Aerococcus were significantly enriched in the Con group, whereas norank_f__UCG-010, Oribacterium, and Frisingicoccus were significantly enriched in the valine group. In summary, these analyses demonstrated that diet supplemented with valine altered the composition and structure of cecal microbiota of laying hens primarily decreased those Fusobacteriota and Deferribacterota containing Fusobacterium, Corynebacterium, Aeriscardovia, Campylobacter, Anaerobiospirillum, and Aerococcus, and increased SCFA producers.

3.3. Dietary Valine Treatment Altered Cecum Short-Chain Fatty Acid (SCFA) Composition of Laying Hens

SCFAs or BCFAs (produced by BCAAs metabolism) play an important role in maintaining host metabolism and homeostasis [19]. We, therefore, tested the contents of SCFAs in Con (0.59% valine) and V4 (0.79% valine) groups based on the cecum microbiota data. As shown in Figure 3(a), valine treatment altered the relative ratio of different SCFAs between the Con and Val group. Compared with the Con group, the concentrations of acetic, isobutyric acid, valeric acid, and isovaleric acid in the cecal contents of laying hens treated with 0.79% Val were significantly decreased (Figure 3(b)). There is no difference observed in the contents of total acid, propionic acid, and butyric although the total acid and propionic acid showed an increasing trend (Figure 3(b)). To determine whether there is a potential association between the alteration of the gut microbiota and host metabolism, we analyzed the correlation between the relative abundance of the gut microbiota and the SCFAs using Spearman correlation analysis (Figures 3(c)–3(e)). At phylum level (Figure 3(c)), the correlation analysis revealed that the abundance of Deferribacterota was positively correlated with the contents of isovaleric, and the abundance of Synergistota was positively correlated with the contents of propionic. At class level (Figure 3(d)), the abundance of Deferribacteres was positively correlated with the contents of isovaleric, and the abundance of Synergistia was positively correlated with the contents of propionic. At order level (Figure 3(e)), the abundances of Deferribacterales, Corynebacteriales, and Enterobacterales were positively correlated with the contents of isovaleric, whereas the Clostridia_UGC-014, Opitutales, and Syntrophomonadales were negatively correlated. The abundance of unclassified_c__Bacteroidia was positively correlated with the contents of valeric but the abundances of Erysipelotrichales and Clostridiales were negatively correlated. The abundance of Rhizobiales was positively correlated with the contents of isobutyric but the Opitutales and Syntrophomonadales were negatively correlated. The abundance of Rhizobiales was positively correlated with the contents of butyric, whereas Erysipelotrichales and Clostridiales were negatively correlated. The abundance of Synergistales was positively correlated with the contents of propionic. The abundances of Verrucomicrobiales and Rhizobiales were positively correlated with the contents of acetic but Clostridiales and Erysipelotrichales were negatively correlated. The abundance of Rhizobiales was positively correlated with the contents of total acid but the Clostridiales was negatively correlated. Together, Spearman correlation analysis demonstrated that the abundances of Deferribacterota, Deferribacteres, Deferribacterales, Corynebacteriales, and Enterobacterales were positively correlated with the contents of isovaleric.
Figure 3

Dietary valine treatment changed the concentrations of short-chain fatty acids (SCFAs) in the cecum of laying hens and the correlation analysis between SCFAs and gut microbiota (n = 6). (a) The relative ratio of different SCFAs. (b) Total acid, acetic, propionic, butyric, isobutyric, valeric, and isovaleric acid. (c)–(e) Spearman correlation analysis between cecal microbiota at phylum, class, and order levels and SCFAs contents. Statistical differences between two groups were calculated by Student's t-test with Welch's correction. A-BMeans with different superscripts within a column differ significantly (P < 0.05) or ∗P < 0.05 was regarded as statistically significant.

3.4. Dietary Valine Supplementation Improved Intestinal Barrier and Inflammation Responses via GCN2

Based on the improved intestinal morphology, increased total acid and propionic, and decreased pathogenic bacteria in the cecum of laying hens, we hypothesized that valine treatment could improve intestinal barrier and inflammation responses of laying hens. Therefore, we further measured the mRNA expression levels of epithelial integrity-associated tight junction proteins (ZO-1, Occludin, and Claudin 1) and mucins [Muc2] in the jejunum by qRT -PCR. Our results showed dietary valine treatment did not change the mRNA relative expression levels of the tight junction-associated genes, i.e., Claudin-1, ZO-1, and Occludin (Figures 4(i)–4(k)) but significantly increased the expression level of Muc2 (Figure 4(h)). The production of cytokines in the gastrointestinal tract can significantly influence the homeostasis and regulation of gut physiological function. Our data revealed that serum IL-10, TNF-α, IFN-γ, IL-1β, and IL-17 were linearly or quadratically decreased with increasing dietary valine levels, whereas the IL-6 and IL-12 were not significantly different (Figures 5(a)–5(g)). Previous reports indicated that GCN2 ameliorated gut inflammation by inhibiting inflammasome activation and enhancing autophagy resulted in the reduction of IL-1β and IL-17 production (8). We further investigated whether decreased IL-1β and IL-17 were induced by GCN2 activation. We found with increasing dietary valine levels, the mRNA expression levels of GCN2, eukaryotic initiation factor 2α (eIF2α), Atg5, and IL-1β in the jejunum first showed significantly increased and then decreased in a linear or quadratic manner which was consistent with decreased serum inflammatory cytokines, but the expression level of Atg7 was significantly increased (Figures 4(a)–4(f)). Dietary valine treatment did not affect the mRNA expression levels of Caspase1 and TNF-α (Figures 4(g) and 4(e)). Taken together, these results revealed that diet supplemented valine could enhance the intestinal barrier of laying hens by upregulating the expression of Muc2 and activating GCN2 signaling pathways triggering autophagy to inhibiting inflammatory responses and ultimately downregulate the production of IL-1β, IL-17, TNF-α, and IFN-γ.
Figure 4

mRNA expression levels of GCN2-related genes, inflammatory cytokines, and intestinal barrier in the jejunum of laying hens (n = 6 − 8). (a) GCN2. (b) eIF2α. (c) Atg5. (d) Atg7. (e) Caspase1. (f) IL-1β. (g) TNF-α. (h) Muc2. (i) Claudin-1. (j) ZO-1. (k) Occludin. A-BMeans with different superscripts within a column differ significantly (P < 0.05).

Figure 5

Effects of dietary valine supplementation on serum cytokines. (a) IL-6. (b) IL-10. (c) IL-12. (d) IL-1β. (e) IL-17. (f) TNF-α. (g) IFN-γ. A-DMeans with different superscripts within a column differ significantly (P < 0.05).

3.5. Laying Hens Displays Severe Liver Steatosis when Fed High Levels of Valine Diets

Based on the SCFAs or BCFAs data, we found that acetic acid, isobutyric acid, valeric acid, and isovaleric acid from the 0.79% level valine group were significantly decreased compared with the Con group (0.59% Val), which has been confirmed that could inhibit both cAMP-mediated lipolysis and insulin-stimulated de novo lipogenesis in human and rat adipocytes [19]. Whether decreased BCFAs could result in liver metabolic disorders of laying hens remains unclear. Thus, we further explored whether diet supplemented with valine could affect the lipid metabolism of the liver in laying hens. Our H&E staining results showed the liver of laying hens fed with high levels of valine diet (0.74 and 0.79%) for 8 weeks appeared very pale, macrovesicular steatosis, and mild lobular inflammation compared with 0.59, 0.64, and 0.69% dietary valine, suggesting severe liver steatosis (Figure 6). This observation was confirmed by histological examination of the liver OA staining, which revealed extensive lipid deposition manifested as macro- and microvesicular steatosis (Figure 6). Compared with 0.74% dietary valine, laying hens fed with 0.79% dietary valine showed larger pale areas and macrovesicular steatosis and broader lipid deposition (Figure 6). With the increase of dietary valine levels, valine treatment dramatically increased serum and liver TG and the serum T-CHO contents, but did not affect liver T-CHO of laying hens (Figures 7(a), 7(b), 7(e), and 7(f)). Laying hens fed with 0.74 and 0.79% dietary valine has higher TG and T-CHO contents compared with laying hens fed with 0.59, 0.64, and 0.69% dietary valine (Figure 7). Valine treatment resulted in significantly increased enzyme activities of liver AST and ALT (Figures 7(g) and 7(h)) but did not affect serum AST and ALT activities (Figures 7(c) and 7(d)). In particular, the activities of AST and ALT in the liver of laying hens fed with 0.74 and 0.79% dietary valine were highest (Figures 7(g) and 7(h)). Taken together, these results suggest that long-term being fed high levels of valine (0.74 and 0.79%) rapidly resulted in liver steatosis caused by the deposition of triglycerides in the laying hens.
Figure 6

High levels of dietary valine treatment promoted liver steatosis of laying hens (n = 6). H&E: hematoxylin and eosin (100 ×). OA: oil red O (100 ×).

Figure 7

Effects of dietary valine treatment on serum and liver parameters changes (n = 6 − 8). (a) Serum TG. (b) Serum T-CHO. (c) Serum AST. (d) Serum ALT. (e) Liver TG. (f) Liver T-CHO. (g) Liver AST. (h) Serum ALT. A-BMeans with different superscripts within a column differ significantly (P < 0.05).

3.6. Dietary Valine Treatment Stimulated Lipogenesis and Inhibited Lipolysis via GCN2

The accumulation of hepatic triglycerides in laying hens fed high levels of valine (0.74 and 0.79%) were likely to reflect an imbalance in hepatic triglyceride synthesis, β-oxidation of fatty acids. Previous reports found that GCN2 eIF2α kinase and activating transcription factor 4 (ATF4) regulated fatty-acid homeostasis in the liver during deprivation of an essential amino acid or high-fat diet (HFD) [17, 18]. We first investigated whether genes underlying the synthesis of triglycerides were upregulated in laying hens during valine supplementation. These proteins included GCN2, eIF2α, ATF4, ATP citrate lyase (ACLY), stearoyl-CoA desaturase 1 (SCD1), fatty acid synthase (FASN), acetyl-CoA carboxylase (ACC), sterol regulatory element-binding proteins 1c (SREBP-1c), peroxisome proliferator-activated receptor γ (PPARγ), acyl-CoA oxidase 1 (ACOX1), carnitine palmitoyltransferase-1 (CPT1), and peroxisome proliferation-activated receptor α (PPARα), playing a central role in the normal process of lipid metabolism. The mRNA levels of GCN2, eIF2α, ATF4, and PPARγ first showed significantly increased and then decreased in a quadratic manner as dietary valine levels increased from 0.59% to 0.79% (Figures 8(a)–8(c) and 8(h)). After valine treatment, ACLY mRNA expression level showed significantly linearly increased as dietary valine increased (Figure 8(e)), whereas the FASN mRNA expression levels only significantly increased with 0.74% dietary valine (Figure 8(g)). However, the mRNA expression levels of SCD1and SREBP-1c showed significantly linear or quadratic decreases with increasing dietary valine levels (Figures 8(f) and 8(i)). Interestingly, dietary valine treatment significantly downregulated the mRNA levels of fatty acid oxidation-related genes such as CPT1, ACOX1, and PPARα in a linear or quadratic manner (Figures 8(j)–8(l)). There is no significant difference observed in the mRNA expression level of ACC among all groups (Figure 8(d)). In summary, these results revealed that fed high levels of valine stimulated lipogenesis through GCN2-eIF2α-ATF4 and inhibited fatty acids oxidation associated genes expression and ultimately promoted the progress of fatty liver.
Figure 8

mRNA expression levels of GCN2 signaling ways, lipogenesis- and lipolysis-associated genes in the liver of laying hens (n = 6 − 8). (a) GCN2. (b) eIF2α. (c) ATF4. (d) ACC. (e) ACLY. (f) SCD1. (g) FASN. (h) PPARγ. (i) SREBP-1c. (j) PPARα. (k) CPT1. (l) ACOX1. A-CMeans with different superscripts within a column differ significantly (P < 0.05).

3.7. Dietary Valine Treatment Accelerated Oxidative Stress Caused by NAFLD of Laying Hens

It has been well established that oxidative stress plays an important role in the development of NAFLD resulting in hepatic steatosis. To determine whether valine treatment affects oxidative stress in the liver of laying hens, we measured the activity of antioxidases. The activities of CAT, T-SOD, and GSH-Px, the contents of GSH and GSSG in the serum, and the contents of GSSG in the liver were significantly decreased with increasing dietary valine levels (Figures 9(a)–9(f)). The activities of CAT, T-SOD, and GSH-Px in the liver and the concentrations of GSH and GSSG in the serum of laying hens fed with 0.74 and 0.79% dietary valine were significantly lower compared with laying hens fed with 0.59, 0.64, and 0.69% dietary valine (Figures 9(a)–9(f)). The activity of T-AOC showed an increasing trend whereas had no effect on MDA levels and GSH contents of liver (Figures 9(g)–9(i)). Taken together, the above results indicated that high levels of dietary valine treatment promoted the development of NAFLD which resulted in oxidative stress by inhibiting antioxidase production.
Figure 9

Effects of dietary valine treatment on antioxidase changes (n = 6 − 8). (a) Liver CAT. (b) Liver T-SOD. (c) Liver GSH-Px. (d) Serum GSH. (e) Serum GSSG. (f) Liver GSSG. (g) Liver T-AOC. (h) Liver MDA. (i) Liver GSH. A-BMeans with different superscripts within a column differ significantly (P < 0.05).

3.8. Dietary Valine Treatment Differentially Regulates Endoplasmic Reticulum Stress and Inflammation Response of the Liver in Laying Hens

Recent reports indicated that GCN2 promoted myocardial oxidative stress under stress conditions through upregulating its downstream targets, ATF4, and C/EBP homologous protein (CHOP) [23]. In addition, ATF4 deficiency protected mice from HFD-induced oxidative stress and TG accumulation [24]. However, whether dietary valine treatment could affect endoplasmic reticulum stress and inflammatory responses of NAFLD remains unclear. We found that liver proinflammatory cytokines such as TNF-α and IFN-γ showed linearly or quadratically decreased with increasing dietary valine levels (Figures 10(d) and 10(e)), whereas IL-12, IL-17, and IL-1β showed linear or quadratic significantly increased (Figures 10(c), 10(f), and 10(g)). Compared with laying hens fed with 0.74% dietary valine, the concentrations of IL-17and IL-1β in the liver of laying hens fed with 0.79% dietary valine were significantly increased, suggesting NAFLD further aggravated the liver inflammatory responses (Figures 10(c), 10(f), and 10(g)). The liver concentration of IL-10 was significantly increased after valine feeding but did not affect IL-6 levels in all groups (Figures 10(a) and 10(b)). RT-PCR analysis demonstrated that the mRNA expression levels of Cytochrome C (Cyt C), ER stress markers such as ATF4, CHOP, and GRP78, and Caspase 3, 7, and 9 were differentially regulated after valine feeding. Dietary valine treatment induced the downregulation of Cyt C, ATF4, GRP78, Caspase 3, and 7 in a linear or quadratic manner (Figures 11(a), 11(b), 11(d), 11(e), and 8(c)), whereas CHOP and Caspase 9 were significantly upregulated with increasing dietary valine levels (Figures 11(c) and 11(f)). Taken together with inflammatory cytokines indicated that dietary valine treatment may differentially regulate ER stress and liver inflammatory response during the development of NAFLD.
Figure 10

Effects of dietary valine treatment on liver cytokines (n = 6 − 8). (a) IL-6. (b) IL-10. (c) IL-12. (d) TNF-α. (e) IFN-γ. (f) IL-17. (g) IL-1β. A-BMeans with different superscripts within a column differ significantly (P < 0.05).

Figure 11

mRNA expression levels of ER stress-associated genes in the liver of laying hens (n = 6 − 8). (a) Cyt C. (b) GRP78. (c) CHOP. (d) Caspase 3. (e) Caspase 7. (f) Caspase 9. A-BMeans with different superscripts within a column differ significantly (P < 0.05).

4. Discussion

In the small intestine, the epithelium comprises repeating crypt-villus units where the crypt produces new epithelial cells and the intestinal villus absorbs nutrients including BCAAs from the gut luminal [25, 26]. The villous length and the V/C value are always assessed to reflect the intestinal digestion and absorption, and a higher villous length and the V/C value generally represent better intestinal morphology. In the present study, dietary valine treatment significantly improved the small intestinal villous length and V/C value and decreased crypt depth, which was consistent with Pereira et al.'s report [27]. In the small intestine, valine is metabolized by the intestinal epithelial cells (IECs) to produce glutamine. Glutamine could promote the proliferation and differentiation of mucosal cells by activating cell cycle progression associated gene expression and ultimately enhance the function of the intestinal mucosal system and ameliorate intestinal morphology [28]. Pereira et al.'s report found that 53-week-old Hy-Line W36 laying hen treatment with L-glutamic acid significantly promoted the proliferation of jejunum villus although it did not affect the villus height and width but had a quadratic effect on crypt depth [27]. In addition, we also found dietary supplementation valine ameliorated intestinal villus injury, and villus appears to be arranged more closely and neatly. The reduced villus injury not only contributes to the absorption of intestinal nutrients but also contributes to inhibiting intestinal inflammation and ultimately ameliorates the production performance of laying hens. Gut microbiota plays key roles in shaping intestinal morphology, resistance to pathogens infection, and maintaining intestinal homeostasis [29]. We found dietary valine treatment significantly changed the cecum microbiota of laying hens, which agreed with previous studies [7, 30]. In the current trial, dietary valine treatment did not affect the cecum microbiota α and β diversity of laying hens, which may be associated with the valine was mainly absorbed in the small intestine. However, valine treatment significantly decreased the abundances of Fusobacteriota and Deferribacterota at the phylum level, Fusobacteriia and Deferribacteres at the class level, and the Fusobacteriales at the order level. Fusobacteriota has long been considered an opportunistic pathogen [31]. For example, Fusobacterium nucleatum commonly causes opportunistic infection and is significantly enriched in colorectal cancer (CRC) tissues, which could promote cancer cell proliferation, tumor immune escape, recurrence, and chemotherapy resistance, etc. [31, 32]. Deferribacterota also showed significantly decreased in the valine treat group, which has been found to increase in an experimental inflammatory bowel diseases (IBD) pig model [33]. Consistently, our LEfSe analysis revealed that Fusobacteriota, Fusobacteriia, Fusobacteriales, Fusobacterium, Campilobacterota, Campylobacteria, Campylobacterales, Campylobacter, Corynebacteriales, Corynebacterium, Aeriscardovia, Anaerobiospirillum, and Aerococcus were significantly enriched in the Con group, whereas Eubacteriales, UCG-010 (p__Firmicutes.c__Clostridia.o__Oscillospirales.f__UCG-010.g__norank), norank_f__UCG-010, Oribacterium, and Frisingicoccus were significantly enriched in the Val treatment group. As a prevalent foodborne bacterial pathogen, Campylobacter is mainly colonized in the jejunum [34]. The initial campylobacter colonization of broiler chickens resulted in a transient growth rate reduction and proinflammatory response, whereas late colonization induced proinflammatory responses with changes in the cecal microbiota [35]. Corynebacterium, Aerococcus, and Anaerobiospirillum are rare pathogens and usually cause clinical infections, diarrhea, colitis, etc. [36-38]. As a member of the Bifidobacteriaceae family, Aeriscardovia was significantly enriched in the Con group, whereas there is no more about its function report [39]. However, dietary valine treatment significantly improved the abundance of short-chain fatty acids producers such as Eubacteriales, UCG-010 (p__Firmicutes.c__Clostridia.o__Oscillospirales.f__UCG-010.g__norank), norank_f__UCG-010, Oribacterium, and Frisingicoccus [40, 41]. Consistently, we also found SCFAs such as total acid and propionic acid showed increasing trends after valine treatment. The Spearman correlation analysis between gut microbiota and SCFAs revealed that the concentration of isovaleric was positively associated with the abundances of Deferribacterota, Deferribacteres, Deferribacterales, and Corynebacteriales, which was further proven by significantly decreased abundances of Deferribacterota, Deferribacteres, Deferribacterales, and cecal isovaleric content. Consistently, Yang et al. found middle-aged mice fed with a branch-chain amino acid-enriched mixture (BCAAem) diet significantly increased the abundances of Akkermansia and Bifidobacterium and decreased the ratio of Enterobacteriaceae [7]. In laying hens, dietary threonine supplementation to the low crude protein (CP) diet recovered the cecal microbiota diversity and significantly increased the abundance of potentially beneficial bacteria [30]. Above these results suggest that dietary valine supplementation ameliorated gut microbiota by decreasing pathogens' bacteria enrichment, increasing the abundance of probiotics and the contents of total acid and propionic acid. SCFAs contribute to maintaining normal gut function and stopping pathogenic bacteria invasion, while the decreases of SCFAs concentrations led to pathogens passing through the intestinal barrier more easily and induce chronic intestinal inflammation [42]. For example, sodium butyrate at a concentration ranging between 1 and 10 mM significantly improved epithelial barrier function in E12 human colon cells by increasing the expression levels of mucin 2 (Muc2) [43]. Our results suggested that laying hens fed with dietary valine significantly improved the mRNA expression levels of Muc2 in the jejunum. Dong et al. found that dietary threonine supplementation to the low CP diet significantly increased the ileal sIgA contents and Muc2 and sIgA mRNA expression levels, which was agreed with our results [30]. During the peak laying period, laying hens are susceptible to pathogens and usually result in chronic inflammation and accelerate the production of proinflammatory cytokines, i.e., IL-6, IL-12, TNF-α, and IFN-γ, and inhibit the production of the anti-inflammatory cytokine IL-10 [44]. In the current study, dietary valine treatment significantly downregulated the mRNA expression levels of GCN2, eIF2α, Atg5, IL-1β, and corresponding serum proinflammatory cytokines such as IL-6, TNF-α, IFN-γ, IL-1β, and IL-17. Acute amino acid starvation suppressed intestinal inflammation by suppressing inflammasome activation and triggering autophagy in mice mediated by GCN2 inhibited the production of proinflammatory cytokines IL-1β and IL-17 [8]. Consistently, valine treatment significantly upregulated the Atg7 expression levels which may be indicated valine activated GCN2 triggering autophagy and inhibited the production of IL-1β and IL-17. In primary bovine mammary epithelial cells, arginine depletion activated GCN2 mediated autophagy and ultimately contributed to IFN-γ-induced malignant transformation of primary bovine mammary epithelial cells [45]. However, GCN2 deletion accelerated intestinal inflammation and promoted the production of IL-1β, IL-17, TNF-α, and IFN-γ [8, 45]. Above these results suggested that dietary valine treatment could alleviate intestinal barrier injury and inflammatory responses of laying hens during the peak laying period, which may be mediated by GCN2 triggering autophagy activation. The liver is the vital organ for the de novo fatty acid synthesis and the intermediary metabolism of lipids and energy of laying hens [46]. However, BCAAs are considered as the major risk factor of hepatic steatosis in individuals with insulin resistance and also may be a potential biomarker of cardiometabolic disease [11, 47]. Yet, we found that laying hens fed with high levels of valine (0.74 and 0.79%) showed severe hepatic steatosis caused by triglycerides deposition. Laying hens supplemented with high levels of valine (0.74 and 0.79%) also significantly increased the liver activities of ALT and AST, which are especially useful biomarkers for detecting liver injury. As a sensor of amino acid availability, GCN2 was activated and involved in repressing lipid synthesis during leucine deprivation, and GCN2 deficiency resulted in rapidly liver steatosis and aberrant protein production in Gcn2−/−mice [17]. Diet supplemented with high levels of valine (0.74 and 0.79%) significantly upregulated the mRNA expression levels of fatty acids and triglycerides synthesis associated genes such as ACLY and FASN. These results were partly consistent with an in vivo study showing that mice fed high BCAA diet developed hepatosteatosis, triglyceride content, and fat scores, and ALT and AST were significantly elevated [12]. Diet-enriched BCAAs significantly increased the mRNA expression levels of hepatic de novo lipogenesis-associated marker genes including ACLY, SCD1, FAS, and ACC [12]. However, we found high levels of valine diets (0.74 and 0.79%) significantly downregulated SCD1and SREBP-1c mRNA levels, whereas did not affect ACC, which may be caused by high levels of valine (0.74 and 0.79%) inhibited the expression levels of GCN2-eIF2α-ATF4. Previous results have demonstrated that excess BCAAs directly contributed to de novo lipogenesis or via increased ACLY phosphorylation mediated by the branched-chain ketoacid dehydrogenase kinase (BCKDK) [48, 49]. The latest research demonstrated that a low isoleucine diet reprogramed liver and adipose metabolism by increasing hepatic insulin sensitivity and ketogenesis and increasing energy expenditure, activating the FGF21-UCP1 axis [50]. Their reports also indicated that restriction of dietary isoleucine or valine promoted metabolic health in mice and that restriction of dietary isoleucine was required for the metabolic benefits of a low-protein diet [50]. Above these results may indicate the unique roles for each of the dietary BCAAs in the development of NAFLD and liver metabolism. Gcn2+/+ mice fed a leucine-deficient diet significantly downregulated mRNAs encoding proteins linked to the synthesis of fatty acids and triglycerides including SREBP-1c, ACL, FAS, SCD, G6PD, and ME [17]. However, GCN2 deficiency attenuated HFD-induced upregulation of SREBP-1c; PPARγ and their downstream target genes (FASN, SCD1, CD36, etc.) in fatty liver suggested a potential mechanism for the GCN2-dependent regulation of lipogenesis [18]. While fed with a leucine-deficient diet, Atf4−/− mice did not develop fatty liver, and FAS mRNA was repressed similarly to in Atf4+/+mice, but the GCN2-dependent regulation of Asns was dependent upon ATF4 [17]. These results are consistent with the observed significantly increased GCN2, eIF2α, and ATF4 mRNA expression levels with the increase of dietary valine concentration from 0.59 to 0.69%. However, high levels of dietary valine (0.74 and 0.79%) significantly downregulated the expression levels of GCN2-eIF2α-ATF4, which may be associated with the unrepressed overexpression of lipogenic genes such as ACLY. PPARγ, a secondary activator of lipogenic gene expression in the liver [51], and targeted deletion of PPARγ in hepatocytes attenuated HFD-induced hepatic steatosis and upregulation of SREBP-1c [52]. The expression levels of PPARγ were consistent with GCN2-eIF2α-ATF4, whereas the SREBP-1c and its downstream target genes such as SCD1 showed significantly decreased with increasing valine concentrations. This may indicate that valine could stimulate lipogenesis in a dose-dependent manner mediated by GCN2-eIF2α-ATF4, whereas excessive secretion of triglycerides, in turn, represses their expression. In addition to altered triglyceride synthesis, impairment of β-oxidation could also contribute to increasing the accumulation of triglycerides in the liver of laying hens. We showed that the transcription factor PPARα involved in mitochondrial β-oxidation and fatty acid transport, and its target genes related to regulatory enzymes of fatty acids β-oxidation such as CPT1, ACOX1 were significantly downregulated in the liver of laying hens fed with valine. Taken together, these results suggested that valine could stimulate lipid synthesis and inhibit fatty-acid β-oxidation via GCN2-eIF2α-ATF4, resulting in NAFLD of laying hens. Hepatic steatosis, lipotoxicity, and inflammation are considered to play key roles in the pathological progression of NAFLD [53]. Intracellular lipid accumulation results in a cascade of events in hepatocytes including oxidative stress, endoplasmic reticulum stress, and inflammation, and then induces hepatocyte death and fibrosis [54]. Redox imbalance including increased concentrations of reactive oxygen species (ROS) and impaired antioxidant defense system has been suggested to be highly associated with NAFLD pathogenesis [55]. The components of the endogenous antioxidant defense system, including GSH, GSH-Px, SOD, and CAT, play an important role in free radical scavenging and maintaining the intracellular redox balance [56]. Dietary valine treatment significantly decreased the activities of CAT, T-SOD, and GSH-Px, and the concentrations of GSH and GSSG in a linear or quadratic manner with increasing dietary valine levels. Compared with normal healthy subjects, NAFLD/NASH patients present increased levels of ROS and lipid peroxidation products and decreased levels of antioxidant enzymes like SOD, CAT, and antioxidant compounds such as GSH [57], which has been proven by our results. Overproduction of ROS can subsequently lead to antioxidant defenses, lipid peroxidation, and even oxidative damage in organisms. Furthermore, oxidative stress initiates cell apoptosis which is mediated by the translocation of proapoptotic protein Bad to mitochondria followed by the downregulation of antiapoptotic protein Bcl-2, which resulted in the reduction of membrane potential and Cyt C release and subsequently leading to caspase activation [58]. Inconsistent with these reports, we observed that the relatively high dose of valine treatment (0.79%) significantly downregulated the mRNA expression of Cyt C and caspase 3, whereas upregulated caspase 9 expression. In addition, ER stress plays a vital role in the development of hepatic steatosis and NASH by activating the unfold protein response (UPR) although the exact contribution of ER stress to the pathogenesis of NAFLD remains unclear [59]. Our data showed the expression levels of ER chaperones Grp78 and caspase 7 were downregulated upon valine treatment, whereas the Chop was upregulated. Caspase 7 is known to be essential for ER stress-induced apoptosis. The notion that enhanced ER stress-induced apoptosis within liver cells may be relevant in the progression from steatosis to NASH in humans was supported by the display of elevated ER stress markers, namely, CHOP and GRP78, in the liver biopsies from patients with NASH [60]. ER stress activated NF-κB in Kupffer cells releasing mediators like IL-1β and TNF-α [61, 62]. TNF-α induced the accumulation of liver TG resulted in hepatocyte steatosis and NAFLD development [63, 64]. TNF-α is the first proinflammatory factor released in the immune response and can increase ROS in the liver and induce lipid peroxidation [65]. It is well known that IFN-γ plays an important role in disease resistance and the immune response in chickens. We found the reduction of TNF-α and IFN-γ after valine treatment, which may be due to valine inhibit NF-κB activation or associated with downregulated mRNA expression of Grp78 and caspase 7. It is reported that PPARγ can mitigate the inflammatory response by inhibiting NF-κB expression and the activation of PPARγ can delay the production of TNF-α at injury sites, regulate the adaptation of cells to stress, and prevent the apoptotic signals caused by inflammatory factors [66]. However, we found the contents of IL-1β, IL-17, and IL-12 in the liver were significantly increased that maybe was induced by upregulated Chop and Caspase 9. The deficiency of IL-1β and inflammatory corpuscle components could impede the inflammatory response induced by the fatty liver [67, 68]. Recent reports indicated that IL-17 can promote M1-type macrophage polarization and exacerbated liver inflammatory response to accelerating the progression of NAFLD in mice [69]. GCN2 was required to inhibit the production of ROS and IL-1β resulted in inhibition of TH17 responses and eventually inhibit the production of IL-17 and alleviated inflammatory response [8]. Consistently, we found high levels of valine (0.74 and 0.79%) treatment significantly inhibited the expression levels of GCN2-eIF2α-ATF4 in the liver, which maybe was associated with enhanced inflammatory response. The levels of serum IL-12 were associated with the severity of NAFLD, and elevated levels of serum IL-12 were observed in more severe NAFLD progression, which was agreed with our results [70]. As a traditional marker of inflammation, IL-6 was reported to act as both proinflammatory and anti-inflammatory cytokines in different liver injury models (short- and long-term exposure) [71]. We found dietary valine treatment did not affect the concentrations of IL-6 in the liver. In addition, with increasing dietary valine levels, the concentration of IL-10 showed significantly increased; the possible reason may be that lipid accumulation triggers the inflammatory defense system. Consequently, it can be concluded that high levels of valine (0.74 and 0.79%) accelerated the development of NAFLD which resulted in hepatocytes apoptosis and inflammatory response mediated by oxidative- and ER-stress in laying hens.

5. Conclusion

In summary, our study demonstrated that valine could improve gut health by ameliorating intestinal barrier function, inhibiting inflammatory response mediated by GCN2-eIF2α signaling pathways, and decreasing the abundance of cecum pathogenic bacteria. Our results also suggested that long-term intake of high levels of valine (0.74 and 0.79%) could accelerate the occurrence and development of NAFLD in laying hens by promoting hepatic lipogenesis mediated by GCN2-eIF2α-ATF4 and inhibiting fatty acids oxidation. NAFLD induced by high levels of valine (0.74 and 0.79%) is resulting in oxidative stress, ER stress, and inflammatory response of laying hens. As duality of valine in gut and liver metabolic, we speculate that GCN2 may act as a master regulator plays different roles in gut and liver metabolism.
  66 in total

1.  CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR-gamma.

Authors:  Stephan Herzig; Susan Hedrick; Ianessa Morantte; Seung-Hoi Koo; Francesco Galimi; Marc Montminy
Journal:  Nature       Date:  2003-11-13       Impact factor: 49.962

2.  Microbiota-Derived Metabolic Factors Reduce Campylobacteriosis in Mice.

Authors:  Xiaolun Sun; Kathryn Winglee; Raad Z Gharaibeh; Josee Gauthier; Zhen He; Prabhanshu Tripathi; Dorina Avram; Steven Bruner; Anthony Fodor; Christian Jobin
Journal:  Gastroenterology       Date:  2018-02-01       Impact factor: 22.682

3.  Lack of interleukin-1α or interleukin-1β inhibits transformation of steatosis to steatohepatitis and liver fibrosis in hypercholesterolemic mice.

Authors:  Yehuda Kamari; Aviv Shaish; Einav Vax; Shay Shemesh; Michal Kandel-Kfir; Yaron Arbel; Sarita Olteanu; Iris Barshack; Shahar Dotan; Elana Voronov; Charles A Dinarello; Ron N Apte; Dror Harats
Journal:  J Hepatol       Date:  2011-02-24       Impact factor: 25.083

4.  Effects of dietary threonine supplementation on intestinal barrier function and gut microbiota of laying hens.

Authors:  X Y Dong; M M M Azzam; X T Zou
Journal:  Poult Sci       Date:  2017-10-01       Impact factor: 3.352

Review 5.  Fusobacterium nucleatum - symbiont, opportunist and oncobacterium.

Authors:  Caitlin A Brennan; Wendy S Garrett
Journal:  Nat Rev Microbiol       Date:  2019-03       Impact factor: 60.633

6.  Ileocolitis associated with Anaerobiospirillum in cats.

Authors:  H E V De Cock; S L Marks; B A Stacy; T S Zabka; J Burkitt; G Lu; D J Steffen; G E Duhamel
Journal:  J Clin Microbiol       Date:  2004-06       Impact factor: 5.948

7.  The adverse metabolic effects of branched-chain amino acids are mediated by isoleucine and valine.

Authors:  Deyang Yu; Nicole E Richardson; Cara L Green; Alexandra B Spicer; Michaela E Murphy; Victoria Flores; Cholsoon Jang; Ildiko Kasza; Maria Nikodemova; Matthew H Wakai; Jay L Tomasiewicz; Shany E Yang; Blake R Miller; Heidi H Pak; Jacqueline A Brinkman; Jennifer M Rojas; William J Quinn; Eunhae P Cheng; Elizabeth N Konon; Lexington R Haider; Megan Finke; Michelle Sonsalla; Caroline M Alexander; Joshua D Rabinowitz; Joseph A Baur; Kristen C Malecki; Dudley W Lamming
Journal:  Cell Metab       Date:  2021-04-21       Impact factor: 27.287

8.  Histological changes, lipid metabolism, and oxidative and endoplasmic reticulum stress in the liver of laying hens exposed to cadmium concentrations.

Authors:  M K Zhu; H Y Li; L H Bai; L S Wang; X T Zou
Journal:  Poult Sci       Date:  2020-03-05       Impact factor: 3.352

9.  The BCKDH Kinase and Phosphatase Integrate BCAA and Lipid Metabolism via Regulation of ATP-Citrate Lyase.

Authors:  Phillip J White; Robert W McGarrah; Paul A Grimsrud; Shih-Chia Tso; Wen-Hsuan Yang; Jonathan M Haldeman; Thomas Grenier-Larouche; Jie An; Amanda L Lapworth; Inna Astapova; Sarah A Hannou; Tabitha George; Michelle Arlotto; Lyra B Olson; Michelle Lai; Guo-Fang Zhang; Olga Ilkayeva; Mark A Herman; R Max Wynn; David T Chuang; Christopher B Newgard
Journal:  Cell Metab       Date:  2018-05-17       Impact factor: 31.373

10.  The Anti-Oxidation and Mechanism of Essential Oil of Paederia scandens in the NAFLD Model of Chicken.

Authors:  Qiang Wu; Huaqiao Tang; Hongbin Wang
Journal:  Animals (Basel)       Date:  2019-10-22       Impact factor: 2.752

View more
  5 in total

1.  Alterations in Intestinal Antioxidant and Immune Function and Cecal Microbiota of Laying Hens Fed on Coated Sodium Butyrate Supplemented Diets.

Authors:  Sasa Miao; Zuopeng Hong; Huafeng Jian; Qianqian Xu; Yating Liu; Xiaoming Wang; Yan Li; Xinyang Dong; Xiaoting Zou
Journal:  Animals (Basel)       Date:  2022-02-22       Impact factor: 2.752

2.  Amino Acid and Fatty Acid Metabolism Disorders Trigger Oxidative Stress and Inflammatory Response in Excessive Dietary Valine-Induced NAFLD of Laying Hens.

Authors:  Huafeng Jian; Qianqian Xu; Xiaoming Wang; Yating Liu; Sasa Miao; Yan Li; Tianming Mou; Xinyang Dong; Xiaoting Zou
Journal:  Front Nutr       Date:  2022-04-12

3.  Dietary γ-Aminobutyric Acid Supplementation Inhibits High-Fat Diet-Induced Hepatic Steatosis via Modulating Gut Microbiota in Broilers.

Authors:  Qu Chen; Dan Hu; Xiaoting Wu; Yuyan Feng; Yingdong Ni
Journal:  Microorganisms       Date:  2022-06-24

4.  Microbiome analysis reveals the effects of black soldier fly oil on gut microbiota in pigeon.

Authors:  Suzhen Liu; Houqiang Luo; Meng Wang; Qingyan Wang; Longchuan Duan; Qingsong Han; Siwei Sun; Caixia Wei; Junjie Jin
Journal:  Front Microbiol       Date:  2022-09-06       Impact factor: 6.064

5.  Broussonetia papyrifera Polysaccharide Alleviated Acetaminophen-Induced Liver Injury by Regulating the Intestinal Flora.

Authors:  Baichang Xu; Kaiyuan Hao; Xiaogang Chen; Enyun Wu; Dongyang Nie; Geyin Zhang; Hongbin Si
Journal:  Nutrients       Date:  2022-06-25       Impact factor: 6.706

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.