| Literature DB >> 34455547 |
Ana Luiza Soares Fraiha1, Ana Carolina Diniz Matos1, João Luis Reis Cunha2, Beatriz Senra Álvares da Silva Santos1,3, Maria Vitória Chaves Peixoto1, Anna Gabriella Guimarães Oliveira2, Grazielle Cossenzo Florentino Galinari1, Heloíza Irtes de Jesus Nascimento1, Maria Isabel Maldonado Coelho Guedes1, Alexandre de Magalhães Vieira Machado3, Erica Azevedo Costa1, Zélia Inês Portela Lobato4.
Abstract
The swine influenza A virus (SIAV) subtypes/lineages H1N1pdm09, H3N2, H1N2, and H1N1 of seasonal human origin are widespread in Brazilian swine herds. A monovalent inactivated H1N1pdm09 vaccine was licensed in Brazil in 2014. However, there are concerns about its efficacy due to the limited vaccine cross-protection against heterologous viruses and the potential for exacerbated reactions against vaccine strains. Thus, monitoring SIAVs subtypes/lineages that are circulating in the Brazilian swine population is important, by applying a fast and efficient diagnostic test in herd field samples. A RT-PCR assay was developed, using primers specific for HA subtyping of Brazilian SIAV, and was used to evaluate the occurrence of subtypes from samples collected between 2012 and 2019. From 167 field samples positive for influenza A, 117 were subtyped by nested RT-PCR assay. A higher occurrence of H1N1pdm was observed from 2012 to 2015, H3N2 in 2017, and H1hu in 2017 to 2019. A hemagglutination inhibition test was performed in serum samples received from 2017 to 2019, confirming these data. The molecular data highlights the importance of H1hu and H3N2 detection since there are no vaccines available for the subtypes/lineages and raises an alert of H1hu for its potential to infect humans. Serological data suggest a cyclical profile of occurrence between the H3N2 and H1N1pdm over time. Monitoring SIAVs circulating in Brazilian swine herds is necessary, which provides the relevant information for field veterinarians to apply effective control measures on the properties.Entities:
Keywords: Brazil; Genotyping; H1N1pdm; H1hu; H3N2; Influenza virus; Serology; Swine
Mesh:
Year: 2021 PMID: 34455547 PMCID: PMC8402972 DOI: 10.1007/s42770-021-00550-y
Source DB: PubMed Journal: Braz J Microbiol ISSN: 1517-8382 Impact factor: 2.476
Sets of primers sequences used in nested RT-PCR assays
| Reaction subtype/lineage | Set of primers | Primers sequences (5’–3’) | Position | Amplicon length (bp) | Tm (°C) |
|---|---|---|---|---|---|
| 1st reaction/H1 | FW1H1 | AGCAAAAGCAGGGGAAAAYA | 781–798 | 616bp | 50 |
| RV1H1 | CCCCATAGYAYRAGGACTTC | 534–553 | |||
| 2nd reaction/H1pdm | FW2H1pdm | CCAATCATGACTCGAACAAC | 391–410 | 159bp | 52 |
| RV2H1pdm | ATAGCACGAGGACTTCTTTCT | 529–549 | |||
| 2nd reaction/H1hu | FW2H1hu | GCGTTGCCGGATGGATCTTA | 233–252 | 303bp | 55 |
| RV2H1hu | ACAGACCATTCTTCCCCGTCA | 515–535 | |||
| 1st reaction/H3 | FW1H3 | ATATGTTCAAACGTCAGGGAGA | 651–672 | 544bp | 52 |
| RV1H3 | GTCGATTGCTGCTTGAGTGC | 1175–1194 | |||
| 2nd reaction/H3 | FW1H3 | ATATGTTCAAACGTCAGGGAGA | 651–672 | 279bp | 52 |
| RV2H3 | TTCCCATTTGGAGTGACGCA | 910–929 |
The H1N1pdm09, H1N1hu, and H3N2 virus strains were used as positive controls for HA nested RT-PCR assays
| Strain | State origin/country | Species | Collection year | Reference strain (HA gene) |
|---|---|---|---|---|
| H1N1pdm09 | Minas Gerais/Brazil | Swine | 2009 | JQ666849* |
| H1N1hu | Santa Catarina/Brazil | Swine | 2013 | EPI_ISL_575027** |
| H3N2 | Paraná/Brazil | Swine | 2017 | EPI_ISL_574871** |
*GenBank accession number
**GISAID accession number
Total subtyped samples in 2012–2013, 2014–2015, 2017–2018, and 2019
| Subtypes/lineages | Sampling date (year) | |||
|---|---|---|---|---|
| 2012/2013 | 2014/2015 | 2017/2018 | 2019 | |
| H1N1pdm | 9/14 (64.3%) | 27/35 (77.1%) | 5/22 (22.7%) | 14/46 (30.4%) |
| H1hu | 3/14 (21.4%) | 4/35 (11.4%) | 6/22 (27.2%) | 16/46 (34.8%) |
| H1N1hu | 1/3 (33.3%) | 4/4 (100%) | 0/6 (0%) | 0/46 (0%) |
| H1N2hu | 2/3 (66.6%) | 0/4 (0%) | 1/6 (16%) | 0/16 (0%) |
| H3N2 | 0/14 (0%) | 1/35 (2.9%) | 5/22 (22.7%) | 4/46 (8.7%) |
| H1N1pdm + H1hu | 0/14 (0%) | 3/35 (8.6%) | 1/22 (4.6%) | 6/46 (13%) |
| H1N1pdm + H3N2 | 2/14 (14.3%) | 0/35 (0%) | 1/22 (4.6%) | 1/46 (2.2%) |
| H3N2 + H1hu | 0/14 (0%) | 0/35 (0%) | 1/22 (4.6%) | 5/46 (10.9%) |
| All mixed subtypes/lineages | 0/14 (0%) | 0/35 (0%) | 3/22 (13.6%) | 0/46 (0%) |
| Total subtyped samples | 14 | 35 | 22 | 46 |
Fig. 1Percentage of samples positive for H1N1pdm, H3N2, and H1hu in relation to the total of samples determined by subtyping analyses performed in 2012–2019, not considering coinfections
Fig. 2Percentage ratio of samples tested for antibodies against H1N1pdm, H3N2, and H1N1pdm + H3N2 in 2017, 2018, and 2019