| Literature DB >> 34434654 |
Yang Tai1, Chong Zhao1, Jinhang Gao1, Tian Lan1,2, Huan Tong1,2.
Abstract
BACKGROUND: Liver cirrhosis is one of the leading causes of death worldwide. MicroRNAs (miRNAs) can regulate liver fibrosis, but the underlying mechanisms are not fully understood, and the interactions between miRNAs and mRNAs are not clearly elucidated.Entities:
Keywords: Bioinformatics; Hepatic stellate cell; Liver fibrosis; mRNA; miRNA
Year: 2021 PMID: 34434654 PMCID: PMC8351572 DOI: 10.7717/peerj.11910
Source DB: PubMed Journal: PeerJ ISSN: 2167-8359 Impact factor: 2.984
Figure 1Flow diagram of data collection and processing.
Dif-, differentially expressed; PPI, protein-protein interaction; Tar-, target.
Primer sequences for qRT-PCR.
| hsa-miR-1234-3p | TCGGCCTGACCACCCACCCCAC |
| hsa-miR-146b-5p | TGAGAACTGAATTCCATAGGCT |
| hsa-miR-150-5p | CTGGTACAGGCCTGGGGGACAG |
| hsa-miR-224-3p | AAAATGGTGCCCTAGTGACTACA |
| hsa-miR-30b-3p | CTGGGAGGTGGATGTTTACTTC |
| hsa-miR-3135b | GGCTGGAGCGAGTGCAGTGGTG |
| hsa-miR-3162-3p | TCCCTACCCCTCCACTCCCCA |
| hsa-miR-3195 | CGCGCCGGGCCCGGGTT |
| hsa-miR-4725-3p | TGGGGAAGGCGTCAGTGTCGGG |
| hsa-miR-548aj-3p | TAAAAACTGCAATTACTTTTA |
| hsa-miR-548x-3p | TAAAAACTGCAATTACTTTC |
| hsa-miR-548z | CAAAAACCGCAATTACTTTTGCA |
| hsa-miR-890 | TACTTGGAAAGGCATCAGTTG |
Figure 2Identification of differentially expressed miRNAs (DEMs).
(A–C): Volcano plots of differentially expressed miRNAs between ALD-CH and Normal (A), HCV-CH and Normal (B), and NASH-CH and Normal (C), respectively. The red dots represented upregulated miRNAs, the green dots represented downregulated miRNAs, and the gray blots represented miRNAs with no significant difference. D: Venn diagram of identified DEMs among ALD-CH, HCV-CH and NASH-CH. E: Heatmap of DEMs via hierarchical cluster analysis. Colors from green to red represented the miRNA expression abundance from poor to rich. ALD-CH, alcohol liver disease-induced cirrhosis; DEMs, differentially expressed miRNAs; HCV-CH, hepatitis C virus-induced cirrhosis; NASH-CH, nonalcoholic steatohepatitis-induced cirrhosis.
The differentially expressed miRNAs.
| hsa-miR-1234-3p | Down | −2.43 | 6.00E−04 | −1.83 | 9.80E−03 | −2.37 | 1.30E−03 |
| hsa-miR-146b-5p | Up | 2.41 | 3.60E−03 | 2.18 | 1.69E−02 | 3.02 | 9.45E−05 |
| hsa-miR-150-5p | Up | 2.9 | 4.42E−06 | 2.49 | 4.00E−03 | 2.9 | 8.00E−04 |
| hsa-miR-224-3p | Up | 2.04 | 2.70E−03 | 2.41 | 1.50E−03 | 3.27 | 5.70E−05 |
| hsa-miR-30b-3p | Down | −1.66 | 2.50E−03 | −2.99 | 5.33E−05 | −1.88 | 4.10E−03 |
| hsa-miR-3135b | Up | 2.28 | 3.00E−04 | 2.38 | 6.00E−04 | 1.76 | 1.35E−02 |
| hsa-miR-3162-3p | Down | −3.41 | 6.41E−07 | −1.7 | 8.40E−03 | −2.56 | 1.31E−05 |
| hsa-miR-3195 | Up | 2.56 | 9.59E−05 | 2.48 | 1.00E−04 | 1.76 | 2.60E−03 |
| hsa-miR-4725-3p | Up | 2.81 | 2.70E−03 | 2.56 | 1.57E−02 | 1.75 | 4.49E−02 |
| hsa-miR-548aj-3p | Down | −2.2 | 1.00E−04 | −1.75 | 1.64E−02 | −2.26 | 7.00E−04 |
| hsa-miR-548x-3p | Down | −2.06 | 3.00E−04 | −1.57 | 9.50E−03 | −1.66 | 4.00E−03 |
| hsa-miR-548z | Down | −2.38 | 3.00E−04 | −1.89 | 1.21E−02 | −1.85 | 1.40E−03 |
| hsa-miR-890 | Down | −2.07 | 8.40E−03 | −1.84 | 8.80E−03 | −1.97 | 6.90E−03 |
Notes.
ALD-CH, alcohol liver disease-induced cirrhosis; HCV-CH, hepatitis C virus-induced cirrhosis; NASH-CH, non-alcoholic steatohepatitis induced cirrhosis.
Figure 3Identification of differentially expressed mRNAs (DEGs).
(A) Volcano plot of differentially expressed mRNAs between Cirrhosis and Normal. The red dots represented upregulated mRNAs, the green dots represented downregulated mRNAs, and the gray blots represented mRNAs with no significant difference. (B) Heatmap of DEGs via hierarchical cluster analysis. Colors from green to red represented the mRNAs expression abundance from poor to rich. (C) Venn diagram of the identified DEGs and the predicted target genes of DEMs. DEGs, differentially expressed mRNAs; DEMs, differentially expressed miRNAs.
Figure 4MiRNA-mRNA interaction networks.
The miRNA-mRNA interaction networks for upregulated miRNAs vs. downregulated mRNAs (A), and downregulated miRNAs vs. upregulated mRNAs (B). The red arrowheads represented miRNAs, and the green circles represented the target mRNAs.
The target genes for differentially expressed miRNAs.
| hsa-miR-1234-3p | Down | 50 | |
| hsa-miR-146b-5p | Up | 5 | |
| hsa-miR-150-5p | Up | 23 | |
| hsa-miR-224-3p | Up | 13 | |
| hsa-miR-30b-3p | Down | 100 | |
| hsa-miR-3135b | Up | 26 | |
| hsa-miR-3162-3p | Down | 72 | |
| hsa-miR-3195 | Up | 14 | |
| hsa-miR-4725-3p | Up | 22 | |
| hsa-miR-548aj-3p | Down | 2 | |
| hsa-miR-548x-3p | Down | 1 | |
| hsa-miR-548z | Down | 7 | |
| hsa-miR-890 | Down | 26 |
Figure 5Enrichment analysis of differentially expressed mRNAs (DEGs).
(A–C): Top 10 enriched GO terms of the corresponding biological process (A), molecular function (B) and cellular component (C) for DEGs. (D–E): Top 20 enriched pathways for DEGs based on the KEGG (D) and Reactome (E) pathway databases. DEGs, differentially expressed mRNAs.
Figure 6Protein-protein interaction (PPI) network.
Each node represented a protein encoded by a DEG, and the edges between nodes represented interactions between proteins. The top 20 hub genes were labeled in orange and associated with larger circles. DEGs, differentially expressed mRNAs; PPI, protein-protein interaction.
Top 20 hub genes in PPI network.
| 1 | 24 | 11 | 15 | ||
| 2 | 23 | 12 | 15 | ||
| 3 | 23 | 13 | 15 | ||
| 4 | 20 | 14 | 15 | ||
| 5 | 20 | 15 | 15 | ||
| 6 | 19 | 16 | 14 | ||
| 7 | 19 | 17 | 13 | ||
| 8 | 17 | 18 | 13 | ||
| 9 | 16 | 19 | 12 | ||
| 10 | 16 | 20 | 12 |
Notes.
PPI, protein-protein interaction.
Figure 7Biological analyses of the hub genes.
(A) PPI network analysis of the hub genes. Each node represented a protein encoded by a hub gene, and the edges between nodes represented interactions between proteins. (B) GO enrichment analysis was performed for the hub genes, and the top 10 enriched items were presented in the histogram. (C) Bubble chart of the enriched Reactome pathways for the hub genes. DEGs, differentially expressed mRNAs; PPI, protein-protein interaction.
Figure 8Validation in HSCs by qRT-PCR.
LX2 cells were treated with TGF- β1 or vehicle alone for 24 h. (A–B) Expression of α-SMA was determined by immunofluorescence staining (A, 400 × magnification) and Western blotting (B). (C–D): Expression of upregulated DEMs (C) and downregulated DEMs (D) was validated by qRT-PCR. The data were presented as mean ± standard deviation. n = 3/group, * P < 0.05. α-SMA, α-smooth muscle actin; DAPI, 4′, 6-diamino-2-phenylindole; DEMs, differentially expressed miRNAs; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSCs, hepatic stellate cells; qRT-PCR, quantitative real-time PCR; TGF- β1, transforming growth factor- β1.