Genotypic Characteristics of Hepatoblastoma as Detected by Next Generation Sequencing and Their Correlation With Clinical Efficacy.

BACKGROUND: Hepatoblastoma (HB) is the most common malignant embryonic liver tumor type in children under 3 years of age. In the present study, the next generation sequencing (NGS) method was used to detect the genotype characteristics of HB and summarize the correlation between the common mutation genotypes noted in this disease and the clinical treatment and prognosis. The results may aid clinical prognosis and the successful application of targeted drugs.
METHODS: Initially, DNA was extracted from tumor tissue specimens and peripheral blood derived from 19 pediatric patients with HB. Subsequently, DNA panel and NGS methods were used to detect tumor diagnosis and the expression levels of treatment-associated genes, followed by the summary of genotype characteristics. In addition, in order to further assess the application of immunotherapy in HB, immunohistochemical detection of programmed cell death 1 ligand 1 (PDL1) was performed in combination with tumor mutation burden (TMB) and DNA mismatch repair status analysis. Furthermore, the clinical treatment effect and prognosis of the pediatric patients were statistically analyzed according to the characteristics of the genotype. Overall prognosis and prognostic analyses in different groups were performed by Kaplan-Meier and log-rank tests, respectively. Finally, expression validation and diagnostic analysis of commonly reported genes were performed in the GSE75271 dataset, which was obtained from the Gene Expression Omnibus (GEO) database.
RESULTS: In the present study, certain mutated genes, including nuclear factor erythroid 2-related factor 2 (NFE2L2), catenin β1 (CTNNB1), MYCN, tumor protein p53, axis inhibition protein 1 (AXIN1) and adenomatous polyposis coli (APC) were associated with the pathogenesis of HB. During TMB and DNA mismatch repair status analyses, pediatric patients had a low TMB. All of them did not present with microsatellite instability. The immunohistochemical results indicated lower expression levels of PDL1 in HB. The complete remission (CR) rate of pediatric patients in the gene abnormality group was lower than that of the non-reported disease-associated gene abnormality group. The 2-year overall survival rate and disease-free survival rate of 19 pediatric patients with HB were 72.1% and 42.4%, respectively. Receiver operating characteristic (ROC) analysis demonstrated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and insulin growth factor 2 (IGF2) may be potential biomarkers that could be used for the diagnosis of HB.
CONCLUSION: The genotype changes in HB were more common and the CR rate of the pediatric patients with an altered genotype was lower than that of pediatric patients without an altered genotype. In addition, pediatric patients with HB exhibited lower TMB compared with adult patients. Moreover, the data indicated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 may be potential biomarkers that can be used for the diagnosis of HB.

Introduction

Hepatoblastoma (HB) is the most common malignant embryonic tumor of the liver in children (most common under 3 years of age), accounting for approximately 79% of all pediatric malignant liver tumors, with an average annual incidence of 1.5 per million population (1–3). Abdominal masses are major clinical manifestations of HB (4). Clinically, the treatment of HB mainly includes surgery and chemotherapy (2, 5). The cause of HB remains unclear. However, previous studies have shown that the incidence of HB in premature infants with very low birth weight is high (6). In addition, children with very low birth weight exhibit a higher risk of HB than those with normal weight (7). The incidence of HB in pediatric patients with Beckwith-Wiedemann syndrome has recently increased 10-fold (from 1,000 to 10,000) (8, 9).

HB is a disease mainly caused by the activation of the WNT pathway, which involves the activating mutation/deletion of exon 3 of the catenin β1 (CTNNB1) gene (10). Certain rare gene mutations lead to the activation of the WNT pathway, such as those occurring in the genes axis inhibition protein 1 (AXIN1), axis inhibition protein 2 (AXIN2) and adenomatous polyposis coli (APC) (can only be observed in cases associated with familial adenomatous polyposis) (11). Previous studies reported that the mutation frequency of CTNNB1 and nuclear factor, erythroid 2 like 2 (NFE2L2) was 80% and 13%, respectively (12). An additional study demonstrated that the mutation frequency of NFE2L2 was approximately 10% (10). To date, a high number of studies have been performed on the genotype of patients with HB. However, a lower number of reports have been conducted on the correlation between genotype and HB prognosis. In the present study, statistical methods were used to analyze the genotype characteristics of 19 pediatric patients with HB. Subsequently, the clinical data, clinical efficacy and prognosis of these patients were analyzed. Finally, the correlations between genotype and clinical phenotype and between genotype and clinical efficacy of HB were summarized. The present study may provide a basis for the application of targeted drugs for the treatment of HB.

Materials and Methods

Patients

A total of 19 Han nationality pediatric patients with HB were selected who were hospitalized in our hospital between November 1, 2018 and March 31, 2020. These patients included 17 patients with recurrence or metastasis and 2 patients with unsatisfactory decrease in the levels of alpha-fetoprotein (AFP) prior to surgery. The tumor and plasma samples were collected for genetic testing in Rendong Medical Laboratory.

The parents of the pediatric patients with HB signed the informed consent form for their participation in the study protocol, which included examination and treatment. The present study was approved by the Medical Ethics Committee of the Beijing Tongren Hospital, Capital Medical University (approval no. TRECKY2019-033).

Sample Source and Processing

The plasma samples were centrifuged at 1,600 x g and 16,000 x g for 10 min. A Blood Genomic DNA Mini kit (CW Biotech) was used to extract genomic DNA (gDNA) from white blood cells. The gDNA was used as a reference genome. A QIAamp DNA FFPE Tissue kit (Qiagen, Inc.) was used to extract tumor DNA from 5-10 formalin fixed paraffin-embedded (FFPE) sections (5-mm thick). Qubit detection was performed on the extracted DNA. In case the total amount of DNA was >3 µg and the A260/280 ratio was within the range of 1.8-2.0, the quality of DNA was determined to meet the requirements for subsequent experiments.

Genetic Testing

The NimbleGen SeqCap EZ capture panel was used to capture the coding regions of the genes. In each sample, 200-500 ng FFPE DNA or 500 ng gDNA were used for library preparation and quantification using KAPA Hyper Prep protocols. Briefly, the DNA samples were fragmented by nebulization and the fragmented DNA was repaired. An ‘A’ was ligated to the 3′ end. Subsequently, Illumina adapters were ligated to the fragments and the samples were size selected aiming for a 350-400 base pair product. The size selected product was PCR amplified and the concentration of the final product was determined using the QubitDsDNHS Assay kit. Nimblegen/IDT was used for 16-h hybridization capture of 4-6 libraries at 47/65°C. Washing, recovery and amplification were carried out in sequence according to the standard procedures of the NimbleGen SeqCap EZ and IDT panels. The AMPure XP (Beckman Coulter, Inc.) and Qubit™ dsDNA HS Assay kits (Thermo Fisher Scientific, Inc.) were used for library purification and quantification, respectively. LuminaNextseq500 (pe75) sequencer was used for library sequencing.

Data Processing and Bioinformatics Analysis

The original data (13), bioinformatics and mutation (14–16) analyses were performed according to the methods reported in the literature. Initially, the processed data were compared with the reference genome to delete duplicate readings. Subsequently, the data sequence that aligned to a single mode of the genome was also aligned to the exome region. Finally, associated mutations were annotated and analyzed. The depth distribution and coverage uniformity of single bases was assessed in the target region. The sources of the mutation databases included the following: Catalogue Of Somatic Mutations In Cancer, Oncology Knowledge Base, MD Anderson, China Kadoorie Biobank, 1000 Genomes Project, Single Nucleotide Polymorphism Database, ClinVar, NHLBI GO Exome Sequencing Project, Exome Aggregation Consortium, Ensembl, Human Gene Mutation Database and University of California Santa Cruz.

Diagnosis, Staging and Grouping of HB

The stage of HB was based on the pretreatment extent of disease (PRETEXT) stage and Children’s Oncology Group (COG) Evans stage system. The risk group was based on the risk factors that affected the prognosis (12). The detailed inclusion criteria for the patients with HB were as follows (12): Pediatric patients younger than 14 years and a clear diagnosis of HB. In addition, the pediatric patients who met one of the following conditions were considered as high-risk cases: (1) Concentration of serum AFP <100 ng/ml; (2) patients were PRETEXT IV stage prior to operation; (3) postoperative patients with COG IV stage; (4) patients who had invasion of portal vein (P+), inferior vena cava or hepatic vein (V+). The patients who did not receive regular treatment and follow-up were excluded.

Clinical Treatment

According to the Chinese Guidelines for the Diagnosis and Treatment of Childhood HB, the main therapeutic drugs used were platinum and anthracycline. However, in order to reduce the cardiotoxicity of anthracyclines, different chemotherapeutic regimens were used for pediatric patients with different stage HB in China. The pediatric patients in the low-risk group were mainly treated with the “cisplatin + 5-fluorouracil + vincristine” combination, whereas the pediatric patients in the medium-risk group were mainly treated with the “cisplatin + 5-fluroracil + vincristine + doxorubicin” combination. In addition, the pediatric patients in high-risk group were mainly treated with “cisplatin + adriamycin”, “carboplatin + adriamycin” and “ifosfamide + carboplatin + etoposide”. VIT is a second-line solution. If the treatment regimen recommended by the guidelines was ineffective, “vincristine + lrinotecan + temozolomide” or “vincristine + lrinotecan + cisplatin + cyclophosphamide” and other regimens were applied at a later stage and the relevant results were further explained.

Analysis of DNA Mismatch Repair Status and Tumor Mutation Burden (TMB)

Deficient mismatch repair results in a strong mutator phenotype known as microsatellite instability (MSI) (17). In the present study, NGS method was used to evaluate the length distribution of 309 microsatellite loci to determine the MSI status (18). More than 20% of unstable microsatellite sites are unstable. MSI was considered when the unstable loci accounted for more than 20% of total loci. TMB was defined as the number of somatic, coding, base substitution, and indel mutations per megabase of genome examined.

Efficacy Assessment and Prognosis

According to the Chinese Guidelines for the Diagnosis and Treatment of Childhood HB, the efficacy assessment and prognostic criteria of HB were as follows: Complete tumor disappearance upon physical examination and computed tomography or magnetic resonance imaging and normal concentration of AFP for >4 weeks. These criteria were considered necessary for complete remission (CR). Tumor shrinkage ≥50% in the absence of any evidence of new lesions or disease progression was regarded as the partial response (PR). Tumor shrinkage <50% in the absence of any evidence of new lesions or tumor growth was defined as stable disease. Tumor enlargement ≥25%, development of a new tumor or increased AFP levels were considered disease progression (PD). Biopsy confirmation, clear imaging evidence and 3 increase in the serum AFP levels within 4 weeks was considered disease recurrence.

In the present study, the deadline for the follow-up period was May 31, 2020 or the time of death due to cancer progression. Survival analysis was performed. CR and PR represented effective treatment and PD and time of death represented ineffective treatment.

Diagnostic Analysis and Expression Verification in the GSE75271 Dataset

Expression validation and diagnostic analyses of commonly reported genes were performed in the GSE75271 dataset (involving 50 HB samples and five normal controls), which was obtained from the Gene Expression Omnibus (GEO) database (19). Receiver operating characteristic (ROC) analysis was also performed using pROC package in R language. The sensitivity and specificity at the cut-offs was calculated as determined in a previous report (20). The diagnostic ability was evaluated by the area under curve (AUC) values in the ROC curve. In the expression verification, the Wilcoxon signed-rank test was used to analyze the statistical difference between the normal control and the HB groups.

Statistical Analysis

In the present study, all statistical analyses were performed using SPSS21 (IBM Corp.). Normally distributed and skewed distribution data were presented as the mean ± standard deviation and median (or quartile), respectively. The Fisher exact probability test analysis of the chi-squared test was used for the analysis of the comparison of count data in different groups. The overall prognosis analysis was analyzed by the Kaplan-Meier method. The prognostic analysis in the different groups was analyzed using the log-rank test. Expression verification was performed using the Wilcoxon signed-rank test in order to analyze significant differences. P<0.05 was considered to indicate a statistically significant difference.

Results

Clinical Features of 19 Pediatric Patients With HB

The “pwr” package in R was used for power analysis, which was analyzed by the chi-squared power calculation. The effect value (w)=0.5060481, sample size (n)=19, degree of freedom=1 and significance threshold (sig. level)=0.05 were initially input followed by the output power level (power)=0.5971157. The closer the power to 1, the more accurate fit of the sample size on the experiment. In the present study, the power was estimated to 0.5971157, indicating that the sample size was medium but not optimal. In total, 9 males and 10 females were enrolled as pediatric patients with HB. The age of onset range and the median age of onset were 11-120 months and 33 months, respectively. No family history of familial adenomatous polyposis and Beckwith-Wiedemann syndrome was noted in all cases. The specific clinical characteristics of 19 pediatric patients with HB are shown in .

Table 1

Clinical features of 19 pediatric patients with HB.

Feature	Number of cases	Proportion (%)
Initial symptom
Abdominal mass and liver space are  occupied	9	47.37%
Abdominal pain and bloating	9	47.37%
Fever, fatigue and wasting	1	5.26%
AFP value at onset (ng/mL)
726-2170000, median: 31877
<100	0	0
≥100	19	100%
PRETEXT staging
PRETEXT II	5	26.32%
PRETEXT III	11	57.89%
PRETEXT IV	3	15.79%
Intrahepatic lesion at onset
Single lesion	13	68.42%
Many lesions	6	31.58%
COG staging
COG II	4	21.05%
COG III	6	31.58%
COG IV	9	47.37%
Pulmonary metastatic disease	7	36.84%
Single lung metastasis	2	10.53%
Double lung metastasis	5	26.32%
Other distant metastases
Osseous metastasis	1	5.26%
Brain metastases	1	5.26%
Other high risk factors affecting prognosis
V+	2	10.53%
P+	2	10.53%
E+	2	10.53%
H+	1	5.26%
N+	2	10.53%
Pathological type
Epithelium type	12	63.16%
Fetal type	2	10.53%
Embryonal	1	5.26%
Fetal and embryonic mixed type	7	36.84%
Giant beam type	1	5.26%
Embryo and giant beam mixed type	1	5.26%
Epithelium and lobus intermedius mixed type	7	36.84%

HB, hepatoblastoma; AFP, alpha-fetoprotein; PRETEXT, pretreatment extent of disease; COG, children’s oncology group; V+, invade inferior vena cava or hepatic vein; P+, invasion of the portal vein; E+, extra-hepatic and intra-abdominal disease; H+, rupture of tumor or intraperitoneal hemorrhage; N+, lymph node invasion.

Genotypic Characteristics of Next-Generation Sequencing

In the present study, 642 genes with coding regions were captured. The genes with mutation abundance ≥5% are shown in . In total, 7 out of 19 pediatric (36.84%) patients with HB exhibited CTNNB1 gene alterations, among which, 5 patients had single nucleotide variants and two gene indel deletion alterations. In the present study, no CTNNB1 gene deletions were detected, which may be associated with the small sample size of the population or ethnic differences. There was 1 patient who exhibited both single nucleotide variation of tumor protein p53 (TP53, also known as p53) gene and point mutation of the CTNNB1 gene. The MYCN proto-oncogene and the basic helix-loop-helix transcription factor gene were amplified in 1 patient. Moreover, 2 patients exhibited single nucleotide variation of the NFE2L2 gene. Indel deletion alterations of the AXIN1 gene were noted in 1 patient with chronic hepatitis B. It is interesting to note that 1 patient presented with single nucleotide variations of APC, insulin like growth factor 2 (IGF2), dicer 1, ribonuclease III (DICER1), notch receptor 1 (NOTCH1) and phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta (PIK3C2B) genes. In addition, 1 patient exhibited a single nucleotide variant of the B cell lymphoma 6 (BCL6) gene.

Table 2

Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.

Medical record No	Genetic changes associated with HB paroxysm	Abundance / Amplification multiple	Unknown genetic change	Abundance / Amplification multiple	MSI	TMB	PDL1	Pathological type	β-catenin	Recurrence or metastasis	Survival time	Prognosis
1	NFE2L2 c.230A>G p.D77G	48.30%	KMT2D c.5467G>T p.G1823X	11.70%	MSS	3.9	<1%	Epithelium and lobus intermedius mixed type	Positive	Metastasis	9	PR
			NUP210L c.4475G>A p.G1492E	20.00%
			ARID1A c. 2714C>G p.A905G	18.50%
			TRIM23 c.868G>T p.A290S	16.80%
			PTPRB c.5432A>G p.K1811R	11.90%
			AURKA amplification	1.51
2					MSS	0	<1%	Epithelium and lobus intermedius mixed type	Positive	Recurrence	17	CR
3			ARID1A	37.20%	MSS	1.69	1.00%	Fetal and embryonic mixed type	Positive	Recurrence	29	CR
			c.4764-4770delT p.A1589fs
4	NFE2L2 c.92G>C p.G31A	22.00%	EP300 c.3244_3245delinsTT p.Q1082L	48.70%	MSS	1.69	<1%	Fetal type	Positive	Recurrence	21	CR
			PARP1 c.2680G>T p.G894N	29.00%
5	CTNNB1 c.101G>T p.G34V	11.60%			MSS	3.18		Epithelium and lobus intermedius mixed type	Positive	Recurrence	23	PR
6					MSS	0		Fetal and embryonic mixed type	Positive	No	12	CR
7	MYCN amplification	1.5	TCF7L2 c.1258C>T p.R420W	26.00%	MSS	2.25	1-2%	Epithelium and lobus intermedius mixed type	Focal positive	Recurrence	22	Dead
			MED12 c.5382G>T p.Q1794H	24.70%
8			USP9X c.1916C>T p.P639L	37.90%	MSS	3.93	2.00%	Embryo and giant trabecular mixed type	Positive	Recurrence	15	PR
			NOTCH3 c.3991C>G p.P1331A	10.20%
9	CTNNB1 c.1003A>C p.K335Q	45.50%			MSS	1.69		Fetal and embryonic mixed type	Positive	Recurrence	30	Dead
10			BCL6 c.959A>G p.N320S	12.70%	MSS	2.25		Fetal type	Positive	Metastasis	21	CR
			HIST1H3F c.148C>G p.R50G	11.90%
11	CTNNB1 c.94G>A p.D32N	23.00%	INPP4A c.959A>G p.N320S	14.80%	MSS			Fetal and embryonic mixed type	Positive	Recurrence or metastasis	17	PD
	TP53 c.743G>A p.R248Q	47.30%	RFWD2 c.173C>G p.S58W	13.90%
12	CTNNB1 c.121A>G p.T41A	27.50%			MSS			Fetal and embryonic mixed type	Positive	No	20	CR
13	AXIN1	13.11%	EPHA7 c.1909C>T p.R637C	7.16%	MSS	22		giant beam type	Positive	Recurrence after PD	50	Dead
	c.516_537del CATGAAGCAGCTGATCGATCCT p.I172Mfs*63		NRAS c.182A>G p.Q61R	6.26%
14	APC c.5465T>A p.V1822D	11.20%	PIK3C2B c.533C>T p.P178L	36.50%	MSS	5	0	Fetal type	Positive	Recurrence or metastasis	40	PR
			IGF2	31.61%
			c.517_538dup ACACCTGGAAGCAGTCCACC p.Q180Rfs*78
			NORCH1 c.1820G>T p.C607F
			DICER1	28.96%
			c.4082A>G p.K1361R
			c.4064A>G p.N1355S	25.40%
				25.06%
15	CTNNB1 c.53_241+117del306	47.50%			MSS	0		Epithelium and lobus intermedius mixed type	negative	PD	25	Dead
16	CTNNB1	21.20%	NUP93 c.180-2A>T	41.40%	MSS	1.34	1-2%	Epithelium and lobus intermedius mixed type	Positive	Recurrence or metastasis	24	CR
	c.66_95del p.His24_Ser33del		PREX2 c.2741C>G p.A914G	38.30%
			PAK7 c.1573T>C p.F525L	28.60%
17			ATRX c.2701C>G p.I901V	8.14%	MSS	9		Epithelium and lobus intermedius mixed type	Positive	Recurrence	9	CR
			PTCH1 c.2479A>G p.S827G	5.60%
			MPL c.173C>T p.A58VG	6.40%
18	CTNNB1 c.94G>A p.D32N	14.14%			MSS	4.8		Fetal and embryonic mixed type	Positive	Recurrence	15	CR
19					MSS	1.11		Fetal and embryonic mixed type	Positive	Recurrence	23	CR

Only genetic changes with mutation abundance ≥5% are listed; MSI, microsatellite instability; MSS, microsatellite stability; TMB, tumor mutation burden; CR, complete remission; PR, partial response; PD, disease progression.

The tumor mutation burden (TMB) was assessed in 17 pediatric patients with HB. The range and median of TMB was 0-22 mut/Mb and 2.25 mut/Mb, respectively. The TMB in only 1 patient reached 22 mut/Mb. Moreover, the patient exhibited a partially missing base of the AXIN1 gene. The DNA mismatch repair status analysis indicated that all patients with HB did not exhibit microsatellite instability ().

Immunohistochemical Analysis

Due to the infrequent use of immunotherapy for pediatric solid tumors, only 8 patients were tested for the expression of programmed cell death 1 ligand 1 (PDL1). In order to further investigate the application of immunotherapy in HB, immunohistochemical detection of PDL1 was performed in 8 pediatric patients with HB. The percentage of tumor cells was measured that indicated partial or complete membrane staining at any intensity. The results further indicated that the percentage of all of PDL1 staining in the tumor cells was ≤2% (), which demonstrated the lower positive expression of PDL1 in HB. Immunohistochemical analysis of PDL1 is shown in . Immunohistochemical detection of β-catenin was performed in 19 pediatric patients with HB (). The degree of cell staining accounted for >1/4 of the total cells, which were considered positive. Among them, only case 15 was negative and exhibited a splice point deletion mutation of the CTNNB1 gene (c.53_241+117del306). In addition, case 7 was focally positive and exhibited an amplification mutation of the MYCN gene. The remaining immunohistochemical results of β-catenin included positive to strong positive cases.

Figure 1

PDL1 immunohistochemical analysis. (A, B) Immunohistochemical analysis of PDL1. The percentage of positive-stained cells was 1% (X200); (C) Positive control image of immunohistochemical analysis of PDL1 (X200). (D) Negative control imaging of immunohistochemical analysis of PDL1 (X200). PDL1, programmed cell death ligand 1.

Genotype and Efficacy Analysis

A total of 17 out of 19 pediatric patients with HB relapsed and were accompanied by distant metastasis. CR was achieved in 2 patients without recurrence or metastasis (). These patients were divided into the gene abnormality group and the non-reported disease-associated gene abnormality group based the presence of the commonly reported genes was associated with the pathogenesis of childhood HB (CTNNB1, NFE2L2, AXIN1, TP53, APC, IGF2). A total of 12 patients were identified in the gene abnormality group, among whom 11 patients, exhibited recurrence and metastasis. In total, 7 patients (6 patients exhibited recurrence and metastasis) were present in the non-reported disease-related gene abnormality group. Non-significant differences were noted with regards to recurrence and metastasis between the two groups (P=0.614). The prognosis of the two groups was compared. Among 12 patients in the gene abnormality group, 4 cases did not survive, 1 developed PD, 3 exhibited PR and 4 CR. Moreover, 7 and 5 cases were noted with effective and ineffective treatment, respectively. Among the 7 patients in the non-reported disease-associated gene abnormality group, 1 case of PR and 6 cases of CR were present, whereas all the cases received effective treatment. There were 4 cases of CR (33.33%, 4/12) in the gene abnormality group. There were 6 cases of CR (85.71%, 6/7) in the gene abnormality group. There was a statistical difference between the two groups in view of CR rate (P=0.027).

Overall Prognostic Analysis

The follow-up time range of 19 pediatric patients with HB was 9-50 months (4 cases died), with a median follow-up time of 21 months. The 2-year overall survival rate of 19 pediatric patients with HB was 72.1% and their survival time was 37.7 ± 5.99 months. The survival curve of these pediatric patients with HB is shown in . Among the 19 patients, 10 cases exhibited a CR. The 2-year disease-free survival rate was 42.4%. The disease-free survival time was 29.71 ± 3.92 months. The disease-free survival curve of 19 pediatric patients with HB is shown in .

Figure 2

Analysis of overall prognosis by survival curve. (A) Survival curve of 19 pediatric patients with HB; (B) Disease-free survival curve of 19 pediatric patients with HB. Group-censoring represents the cases that did not survive. HB, hepatoblastoma.

Genotype and Prognosis Analysis

The prognostic analysis between the gene abnormality group and the non-reported disease-associated gene abnormality group demonstrated that the 2-year overall survival rates of the two groups were 64.3% and 100%, respectively (). The difference was not statistically significant (chi-squared=0.536, P=0.464). According to the TMB, the patients were divided into TMB ≥5 mut/Mb group and TMB <5 mut/Mb group. The 2-year overall survival rates of the two groups were 100% and 57.1%, respectively (). No significant differences were noted between the two groups (chi-squared=2.616, P=0.106).

Figure 3

Analysis of prognostic survival curves corresponding to different patient groups. (A) Survival curves between the gene abnormality group and the non-reported disease-related gene abnormality group; (B) Survival curves of different groups of TMB. The group-censoring represents the cases that did not survive. TMB, tumor mutation burden.

Diagnostic Analysis and Expression Verification

The GSE75271 dataset was used to investigate commonly reported genes. ROC analysis and expression verification were performed. CTNNB1, NFE2L2, AXIN1, APC, MYCN, IGF2, TP53 and BCL6 were selected for diagnostic analysis (). ROC analysis demonstrated that with the exception of TP53 and BCL6, the AUC of other genes was >0.7. The data indicated that the CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 genes may be potential biomarkers for the diagnosis of HB. Simultaneously, expression verification of these genes was performed. With the exception of TP53 and BCL6, the expression levels of other genes were significantly different between case and control groups (P<0.05) (). This suggested that CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 may play an important regulatory role in the pathological mechanism of HB. In addition, the expression trends of specific genes, such as MYCN and BCL6, were inconsistent with those reported in the literature, which may be associated with the small number of normal control samples in the GSE75271 dataset. Unfortunately, the prognostic data for HB were not available in public databases. Therefore, prognostic analysis of these genes could not be performed.

Figure 4

Diagnostic analysis of (A) CTNNB1, (B) NFE2L2, (C) AXIN1, (D) APC, (E) MYCN, (F) IGF2, (G) TP53 and (H) BCL6. CTNNB1, catenin β1; NFE2L2, factor erythroid 2-related factor 2; AXIN1, axis inhibition protein 1; APC, adenomatous polyposis coli; IGF2, insulin growth factor 2; BCL6, B cell lymphoma 6; AUC, area under curve.

Discussion

The two main primary liver malignancies derived from hepatocytes in children are HB and hepatocellular carcinoma (HCC), among which HB is more common than HCC (21). HB is the most common hepatic tumor noted in children, which accounts for 43% of liver tumors or two-thirds of liver malignancies in children (22). Several unique genetic features have been found in HB and HCC, including germline mutations of certain genes, hallmark cytogenetic changes and repeated mutations in the main somatic cells described in these tumors (21). In addition, the present study performed a comprehensive genetic analysis of HB and HCC using NGS, which not only confirmed the previously discovered frequent mutations of CTNNB1 and p53 genes in HB and HCC, but also identified new genetic changes in tumor-associated genes, including AXIN, APC, cyclin-dependent kinase inhibitor 2a (CDKN2A), inverted formin 2 (INF2) and AT-rich interactive domain 2 (ARID2) (21).

Previous studies have shown that changes in the expression levels of the p53 gene are associated with poor prognosis of HCC (23, 24). The results of all-exon detection noted in 15 cases with HB indicated that the CTNNB1 and NFE2L2 mutations were present in 12 and 2 cases, respectively (12). In addition, it was found that the repeated mutations of CTNNB1 and the activation of the NFE2L2/kelch-like ECH-associated protein 1 pathway played an important role in the occurrence of HB, which confirmed the stability loss of the genome and the deletions of the telomerase reverse transcriptase promoter as prominent characteristics of aggressive HB with HCC features (12). A previous report examined 27 patients with HB and demonstrated that CTNNB1 (point mutations and deletion mutations) and AXIN1 (point mutations) gene mutations accounted for 70.4% and 7.4% of the cases, respectively. This confirmed that the WNT signaling pathway played an important role in the pathogenesis of HB (25). In addition, hepatitis B virus (HBV)-associated HCC is more likely to indicate high frequency of p53 or AXIN1 mutations that cause chromosomal instability, while the most common CTNNB1 gene mutation in HCC is not associated with chronic HBV infection (26, 27). It has been reported that APC gene mutations play an important role in sporadic HB and WNT pathway activation (11, 28). In the present study, 7 patients (36.84%) with CTNNB1 gene alteration were noted, which suggested a lower percentage than that reported in the literature (10, 21, 25). Single nucleotide variation and gene insertion or deletion of CTNNB1 was found in 5 and 2 patients, respectively. In addition, 1 patient with TP53 gene alteration presented with CTNNB1 gene point mutations. Concomitantly, both APC and AXIN1 exhibited one genetic alteration. Although the proportion of patients with various genetic changes was low, the positive β-catenin expression was present in 18 cases. This indicated that the activation of the WNT pathway played an important role in the occurrence of HB. It is interesting to note that the CTNNB1 genotype (c.53_241+117del306) of case 15, the CTNNB1 genotype (c.66_95del p.His24_Ser33del) of case 16 and the AXIN1 genotype (c.516_537del CATGAAGCAGCTGATCGATCCT p.I172Mfs*63) of case 13 have not been previously reported in the relevant literature. This provides an additional direction for subsequent research.

The BCL6 gene is closely associated with the pathogenesis of B-cell lymphoma (29). The expression or activity of BCL6 is decreased in glioblastoma tumor specimens and cell lines, whereas induction of cell apoptosis is increased and proliferation is reduced (30). In addition, BCL6 can also increase the sensitivity of glioma to targeted therapy (30). The MYCN gene is a member of the MYC family of proto-oncogenes, which participates in the development of human and animal cancers by regulating cell proliferation and cell death (31, 32). In neuroblastoma, MYCN expansion was associated with poor prognosis and treatment failure (31–33). Previous studies have not examined MYCN gene amplification in HB (34, 35). However, previous studies in recent years demonstrated that MYCN expression was significantly increased in HB, whereas MYCN knockdown inhibited the proliferation of HB cells (36, 37). This indicated that BCL6 and MYCN may have an important regulatory role in the development of HB.

The prognosis of HB is associated with several factors, such as initial AFP level, age, co-morbidity and pathological subtype (38). At present, the research on the genotypes of HB-associated disease is mostly associated with the research of targeted therapy (39, 40). In the present study, the CR rate of the gene abnormality group was lower than that of the non-reported disease-associated gene abnormality group. No significant differences were noted (P=0.013). Notably, the patients with TP53 gene mutation presented with MYCN gene amplification and AXIN1 gene deletion and demonstrated a poor prognosis. In addition, the 2-year overall survival rates of patients in the gene abnormality group and the non-reported disease-associated gene abnormality group were 64.3% and 100%, respectively. Although no significant differences were noted between the two groups (chi-squared=0.536, P=0.464), the survival rate of the patients in the gene abnormality group was lower than that of the non-reported disease-associated gene abnormality group. This further suggested that changes in the genotype of different genes can be used to predict the prognosis of patients with HB.

In the present study, TMB was assessed in 17 patients. The range and median of TMB were 0-22 mut/Mb and 2.25 mut/Mb, respectively. TMB was present in only 1 patient with HB, who reached 22 mut/Mb. The microsatellite state analysis indicated that all of the 19 patients did not exhibit microsatellite instability. This result is consistent with a previous study, which demonstrated that recurrent and metastatic HB exhibited a lower TMB (5). The interaction of PDL1 with its receptor programmed cell death 1 (PD1) inhibited T cell activity (41). Various types of cancer express high levels of the PDL1 protein. The PDL1/PD1 signaling pathway is activated to evade T-cell immunity (42). Inhibition of the PDL1/PD1 pathway can enhance T cell response and mediate antitumor activity (43). The expression of the PDL1 protein can be used as a biomarker for predicting which patients are more likely to respond to immunotherapy (44). Immunohistochemical detection of PDL1 in 8 patients with HB demonstrated low percentage of PDL1 positive expression (≤2%), which was consistent with previously reported results (45). In addition, the expression levels of PD-L1 in common solid tumors of pediatric patients are generally deficient (46). Although immunohistochemical analysis of PD-L1 can be used to predict the treatment response of patients receiving anti-PD1 or anti-PDL1 therapy, certain patients who present with negative PD-L1 expression may also benefit from immunotherapy (47). In the present study, immunohistochemical detection of PDL1 expression in patients with HB indicated a low percentage of PDL1, which may be caused by the small sample size. Additional verification in larger sample-size studies is required. In addition, a limited number of studies have been performed on the immunohistochemical detection of PDL1 expression in patients with HB. Whether immunotherapy is effective in the treatment of HB remains to be further confirmed.

The present study contains certain limitations. Firstly, the sample size was small, which led to a certain degree of error. Additional patients are required to expand the sample size. Secondly, the follow-up time of each group was inconsistent and the follow-up time period had to be adjusted for further confirmation. Thirdly, the molecular mechanisms of the identified mutant genes in HB remain unclear and should be further studied.

In the present study, statistical methods were used to analyze the genotype characteristics, clinical data, clinical efficacy and prognosis of 19 pediatric patients with HB. The results of the present study demonstrated that different genotypes may play an important regulatory role in the physiology and pathology of HB, which is helpful for the assessment of the clinical prognosis and the application of targeted drugs and immunotherapy. In addition, the data indicated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 may be potential biomarkers that can be used for the diagnosis of HB.

Data Availability Statement

The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.

Ethics Statement

The studies involving human participants were reviewed and approved by Medical Ethics Committee of the Beijing Tongren Hospital, Capital Medical University (TRECKY2019-033). Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin.

Author Contributions

Conception and design, HH, WZ and DH. Administrative support, DH. Provision of materials and samples, WZ and DH. Data collection and collation, HH, TZ and JL. Data analysis and interpretation, YW, FL and YM. All authors contributed to the article and approved the submitted version.

Funding

This present study was funded by the “Dengfeng” Talent Cultivation Plan of Beijing Municipal Hospital Administration (Project Number: DFL20180201), the Pediatric Medical Coordinated Development Center of Beijing Municipal Administration of Hospitals (No: XTZD20180205) and the Beijing Yizhuang Economic and Technological Development Zone Leading Program [No: (2017)-8].

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.