| Literature DB >> 34393802 |
Hongwei Han1,2, Guangda Peng1, Maureen Meister3, Hongwei Yao4, Jenny J Yang5, Ming-Hui Zou6, Zhi-Ren Liu1, Xiangming Ji3.
Abstract
Although a few studies show that the use of electronic nicotine delivery systems (ENDS) may ameliorate objective and subjective outcomes in COPD smokers who switched to electronic cigarettes, it is unclear whether e-cigarette exposure alters lung pathological features and inflammatory response in COPD. Here, we employed βENaC-overexpressing mice bearing COPD-like pulmonary abnormality, and exposed them to ENDS. We found that ENDS exposure aggravated airspace enlargement and mucus production in βENaC-overexpressing mice, which was associated with increased MMP12 and Muc5ac, respectively. ENDS exposure to mice significantly increased the numbers of macrophages, particularly in M2 macrophages in bronchoalveolar lavage (BAL) fluid, despite ENDS did not induce M2 macrophage polarization in a cultured murine macrophage cell line (RAW264.7). There were no changes in neutrophils in BAL fluid by ENDS exposure. Multiple cytokine productions were increased including M-CSF, IL-1r α , IL-10, and TGF-β1, in BAL fluid from mice when exposed to ENDS. The Sirius Red staining and hydroxyproline assay showed ENDS-exposed mice displayed enhanced fibrotic phenotypes compared to control mice. In conclusion, ENDS exposure enhances airspace enlargement, mucus secretion, and fibrogenesis in COPD mice. This is associated with increased MMP12, inflammatory responses, and M2 macrophage phenotype. This study provides pre-clinical data implicating that electronic cigarette exposure is not safe in COPD patients who want to replace traditional cigarettes with ENDS.Entities:
Keywords: COPD; ENDS; M2 macrophage; inflammation; lung fibrosis
Year: 2021 PMID: 34393802 PMCID: PMC8355703 DOI: 10.3389/fphar.2021.726586
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
FIGURE 1E-cigarette exposure aggravates COPD in βENaC mice. (A) Experimental schematic of whole body ENDS exposure in βENaC mice. (B) ENDS exposure caused emphysematous phenotypes changes in βENaC mice. Representative data of H&E staining images using lung sections of sham air (left) (n = 4) or ENDS exposed (right) (n = 4) mice. (C) Quantification of the free distance between gas exchange surfaces in lungs of βENaC mice with or without ENDS exposure. (D,F) Determination of mRNA levels of COPD-related proteins MMP12 (D) and Muc5ac (F) in lung tissues from βENaC mice with or without ENDS exposure by qPCR. (E) Representative images of Periodic Acid-Schiff staining in lung sections of βENaC mice with or without ENDS exposure. The inset indicates the enlarged image of the boxed area showing positive staining. All data presented at mean SEM.
PCR primers used in this study.
| Gene | Species | Forward sequence | Reverse sequence |
|---|---|---|---|
| Cyclophilin | Mouse | CTTCGAGCTGTTTGCAGACAA AGT | AGATGCCAGGACCTGTATGCT |
| SCNN1B | Mouse | CCTCCAAGAGTTCAACTACCG | TCTACCAGCTCAGCCACAGTG |
| M-CSF | Mouse | ATGAGCAGGAGTATTGCCAAGG | TCCATTCCCAATCATGTGGCTA |
| IL-1R | Mouse | GCTCATTGCTGGGTACTTACAA | CCAGACTTGGCACAAGACAGG |
| IL-10 | Mouse | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| MMP12 | Mouse | CGCAGCTCTAGGAGCATGTG | TGGGCTAGTGTACCACCTTTG |
| Muc5ac | Mouse | GGACTTCAATATCCAGCTACGC | CAGCTCAACAACTAGGCCATC |
| TGFβ-1 | Mouse | CTCCCGTGGCTTCTAGTGC | GCCTTAGTTTGGACAGGATCTG |
FIGURE 2E-cigarette exposure elevates inflammatory response. (A–D) Determination of mRNA levels of inflammatory cytokines in lung tissues from βENaC mice with or without ENDS exposure by qPCR. (E) Representative images of Diff-Quik staining of BAL from βENaC mice with or without ENDS exposure (n = 4 per group). (F) Quantification of Diff-Quik staining as in (E) (n = 4 per group). All data presented at mean SEM.
FIGURE 3E-cigarette increases macrophage numbers in lungs. (A,C) FACS analysis of cell population of CD45+F4/80+ macrophages and CD11b+Ly6G+ neutrophils in lung tissues of βENaC mice with or without ENDS exposure (n = 3 per group). (B,D) Quantification of FCAS analysis of macrophage and neutrophil population as in (A) and (C), respectively. All data presented at mean SEM.
FIGURE 4E-cigarette increases the population of M2 phenotype of macrophages. (A) FACS analysis of the cell population of F4/80+CD206+ M2 macrophages in lung tissues of βENaC mice with or without ENDS exposure (n = 3 per group). The M2 macrophages were pre-gated on live CD45+ cells. (B) Quantification of FACS analysis of CD45+F4/80+CD206- non-M2 macrophage cell number in lung tissues of βENaC mice with or without ENDS exposure. (C) Quantification of FACS analysis of CD45+F4/80+CD206+ M2 macrophage cell number in lung tissues of βENaC mice with or without ENDS exposure. (D) Quantification of FACS analysis of CD206+CD45+F4/80+ M2 phenotype percentage in CD45+F4/80+ total macrophages in lung tissues of βENaC mice with or without ENDS exposure. (E) Representative images of immunohistochemical (IHC) staining of Arginase I in lung tissues of βENaC mice with or without ENDS exposure. The inset indicates the enlarged image of the boxed area showing positive staining. (F) Quantification of IHC staining of Arginase I as in (E). The positive staining areas were calculated as percentages of total area, using five randomly selected sections per mouse, a total of four mice in each group. (G) Representative blots showing the expression level of Arginase I after indicated treatments. Actin was used as an internal control. Raw264.7 were treated with DMSO or ENDS (50 mg/ml) or IL-4+IL-13 (IL-4 20 ng/ml; IL-13 20 ng/ml) for 48 h and harvested for analysis of protein expression by western blot. Columns and error bars represent means SEM.
FIGURE 5E-cigarette exposure enhances fibrosis in the lungs. (A) Representative images of Pico-Sirius Red staining in lung sections from βENaC mice with or without ENDS exposure (n = 4 per group). The inset indicates the enlarged image of the boxed area showing positive staining. (B) Quantitative analysis of Pico-Sirius Red staining as in (A). The positive staining areas were calculated as percentages of total area, using five randomly selected sections per mouse, a total of four mice in each group. (C) Representative images of -SMA IHC staining in lung sections from βENaC mice with or without ENDS exposure (n = 4 per group). The inset indicates the enlarged image of the boxed area showing positive staining. (D) Quantitative analysis of -SMA IHC staining as in (C). The positive staining areas were calculated as percentages of total area, using five randomly selected sections per mouse, a total of four mice in each group. (E) Measurement of collagen contents by hydroxyproline assay using lung tissues of βENaC mice with or without ENDS exposure (n = 4 per group). Columns and error bars represent means SEM.