Literature DB >> 34386416

A Novel Tumor Suppressor Gene, ZNF24, Inhibits the Development of NSCLC by Inhibiting the WNT Signaling Pathway to Induce Cell Senescence.

Bo Pang1, Yong Wang1, Xiaoyan Chang2.   

Abstract

OBJECTIVE: Understanding the characteristics of tumor suppressor genes (TSGs) is of great significance for the development of new targeted treatment strategies for non-small cell lung cancer (NSCLC). Therefore, this present article is to explore the underlying molecular mechanism of ZFN24 inhibiting the development of NSCLC.
METHODS: We performed RT-PCR and Western blotting for evaluating associated RNA and protein expression. CCK8, colony forming and sphere-forming assays were used to evaluate the proliferation and stemness of NSCLC cells. NSCLC cell senescence was examined by β-galactosidase staining assay. Luciferase assay was performed to evaluate β-catenin transcriptional activity. The effect of ZNF24 on NSCLC cells in vivo was evaluated by the xenograft tumor experiment.
RESULTS: Ectopic expression of ZNF24 significantly inhibited cell viability, colony forming ability, and stemness of NSCLC cells. WNT signaling pathway was inhibited by ZNF24 resulting in NSCLC cell senescence. β-catenin transcriptional activity was significantly inhibited by ZNF24 (P < 0.05). Ectopic expression of ZNF24 significantly inhibited xenotransplant tumors growth in vivo (P < 0.05).
CONCLUSION: ZNF24 could notably inhibit the development of NSCLC by inhibiting the WNT signaling pathway.
Copyright © 2021 Pang, Wang and Chang.

Entities:  

Keywords:  WNT signaling pathway; ZNF24; non-small cell lung cancer (NSCLC); senescence; tumor suppressor genes (TSGs)

Year:  2021        PMID: 34386416      PMCID: PMC8353233          DOI: 10.3389/fonc.2021.664369

Source DB:  PubMed          Journal:  Front Oncol        ISSN: 2234-943X            Impact factor:   5.738


Introduction

Non-small cell lung cancer (NSCLC) is the main form of lung cancer, the main cause of cancer-related death, and its 5-year survival rate is extremely low (1–3). Although progress has been made in various treatments, the effective treatment options available to NSCLC patients are still very limited (4–6). The difficulties in treating NSCLC patients are mainly due to our limited understanding of NSCLC tumorigenesis at the molecular level. In recent years, the study of molecular mechanisms related to NSCLC tumorigenesis has received more and more attention (5, 7–10). At present, several intracellular signaling pathways are known to be altered in NLCSC, including p53 pathway, MAPK pathway, retinoblastoma (Rb) pathway and WNT/β-catenin pathway (11–16). Previous studies found abnormally activated WNT signaling pathway transcription of WNT target genes (17–19). It is well known that transcriptional activity of β-catenin is a key factor in WNT signaling activity (20). Specifically, β-catenin moves to the nucleus after WNT signal activation, and then forms complexes with its co-transactor including, T cell factor (TCF), lymph enhancer factor binding factor (LEF), and cAMP response element binding protein (CREB)/E1A binding protein p300 (CBP/p300) to activate transcription of the downstream target genes of the WNT signaling pathway (17, 21, 22). Furthermore, previous research has shown that GATA4 inhibits the transcriptional activity of β-catenin, thereby leading to the senescence of hepatocellular carcinoma (HCC) cells. Therefore, we speculated that β-catenin might be related to the development of NSCLC tumor cells. Zinc finger transcription factor 24 (ZNF24), as a member of Zinc finger transcription factor family, is rarely reported in NSCLC at present. Liu Xinyang et al. found that ZNF24 was able to inhibit tumor cell migration and invasion in gastric cancer (23). Furthermore, it has been reported that another member of Zinc finger transcription factor family, ZNF191, is able to affect the proliferation of HCC by regulating the transcription of β-catenin in HCC (24), indicating that zinc finger transcription factor family may play a crucial role in tumor development. Therefore, we speculated that ZNF24 had a great possibility to be related to the development of NSCLC. Analysis results of the TCGA NSCLC data showed that the expression of ZNF24 was high in paracancerous tissues and low in NSCLC tumor tissues, implying ZNF24 might be a novel tumor suppressor gene of NSCLC. In addition, ectopic expression of ZNF24 significantly inhibited NSCLC cell viability, colony forming and stemness. In addition, ZNF24 significantly inhibited xenotransplant tumors growth in vivo as well. In conclusion, our study revealed a novel NSCLC tumor suppressor gene and provided some new clues for developing new targeting therapies for NSCLC patients.

Materials and Methods

Ethnics Statement

All mice were housed in a pathogen-free environment at the Anhui Medical University. All experimental protocols were approved by the Institutional Committee for Animal Care and Use at Anhui Medical University. All animal work was performed in accordance with the approved protocol (Ethical code: No.20190330-05). The protocol for collecting tumor samples was approved by The First Affiliated Hospital of Anhui Medical University (). Written consent was obtained from every patient who donated tumor samples. All work was performed in accordance with the approved protocol (Ethical code: No.20180397).
Table 1

Patient samples characteristics.

Cases (n = 4)
Age
 ≤461
 >463
Gender
 Male3
 Female1
Tumor size
 ≤1.5 cm1
 >1.5 cm3
TNM stage
 I0
 II0
 III3
 IV1
Tumor differentiation
 High-moderate1
 Low3
Lymph node metastasis
 Positive1
 Negative3
Patient samples characteristics.

Reagent

Reagents included: cell Signaling Senescence β-Galactosidase Staining Kit (CST, Boston, USA); fetal bovine serum, DMEM/F12 medium, RPMI medium1640, and DMEM, penicillin and PBS (GE™ Hyclone, Utah, USA); Doxycycline (Sigma, St. Louis, Missouri, USA); Cell Counting Kit-8 (Dojindo Molecular Technologies, Kumamoto, Japan); Lipofectamine 3000 (Invitrogen, California, USA); dual-specific luciferase assay kit (Promega, Wisconsin, USA); fibroblast growth factor (FGF) and epidermal growth factor (EGF) (PeproTech, New Jersey, USA). Antibodies including anti-ZNF24 (ab254636), anti-GAPDH (ab76523), anti-CyclinD1 (ab16663), anti-CyclinB1 (ab32053), anti-CyclinE1 (ab33911), anti-cMYC (ab71676), anti-C-Jun (ab15475), anti-fra1 (ab252421), anti-HA (ab236632), anti-flag (ab205606), anti-β-catenin (ab32503), anti-β-actin (ab8227), anti-TCF1 (ab188865), anti-LEF1 (ab2324), anti-Cleaved Caspase-9 (ab2324), and anti-Cleaved Caspase-3 (ab2302) were purchased from Abcam Co., Ltd, Cambridge, UK.

Cell Culture

A549, PC9, H23, H460 and H1299 cells were maintained in RPMI 1640 medium containing 10% FBS (SH30087.01, Hyclone, Utah (UT), United States), 100 U/ml penicillin (SH30010, Hyclone, Utah (UT), United States), and 100 mg/ml streptomycin. HEK293 cells were maintained in DMEM/F12 medium containing 10% FBS (SH30087.01, Hyclone, United States), 100 U/ml penicillin (SH30010, Hyclone, United States), and 100 mg/ml streptomycin. HSAEC-37 cells and HBEC-30 cells were maintained in SAGM Medium Bullet Kit (CC-3118, LONZA, Switzerland). All cells were cultured in a humidified atmosphere at 37°C with 5% CO2.

Generation of Engineered Cell Lines

Two packaging plasmids (pSPAX2 and pMD2.g) and the ZNF24 expression vector plvx-ZNF24-puro were transfected into HEK293 cells using Lipofectamine 2000 reagent. After incubation for 4–6 h, the medium was changed into DMEM complete medium. Then 48 h after transfection the medium containing the recombinant virus was filtered and used to infect cells in the presence of polybrene (8 mg/ml). Infected cells were then selected by cultivating them with puromycin (0.5 mg/ml) for 7 days before the experiment.

Spheroid Formation Assay

Cells of each group were dissociated into single cell suspension then washed twice with PBS. The cells were resuspended in serum-free DMEM/F12 medium and 500 cells in each well of low adhesion 24-well plates (spheroid microplates) were inoculated. Spheroid microplates were placed in a humidified incubator set to 37°C and 5% CO2. Spheroid formation and growth were assessed 1–2 weeks after cell culture via microscopic examination using an inverted microscope.

Realtime PCR

The total mRNA of the cells was extracted with Trizol reagent (#15596018, Life Technologies, USA). Then cDNA was generated using QuantiTect Reverse Transcription Kit (#205313, Qiagen, Shanghai, China). Real-time PCR was performed using the Hermo Fisher Scientific Maxima SYBR Green/Rocket qPCR Master Mixed Trial (#K0221) kit in the StepOnePlus system (Applied Biosystems, USA). Primer sequences were as follows. ZNF24-Forward: GTGACAGTGCTGGAGGATTTGG ZNF24- Reverse: GGTTCTCCACAGCATCAAGCTC cyclin-D1-Forward: TCTACACCGACAACTCCATCCG cyclin-D1-Reverse: TCTGGCATTTTGGAGAGGAAGTG c-MYC-Forward: GGACCCGCTTCTCTGAAAG c-MYC- Reverse: GTCGAGGTCATAGTTCCTGTTG c-JUN-Forward: CCTTGAAAGCTCAGAACTCGGAG c-JUN-Reverse: TGCTGCGTTAGCATGAGTTGGC fra1-Forward: GGAGGAAGGAACTGACCGACTT fra1-Reverse: CTCTAGGCGCTCCTTCTGCTTC WISP1-Forward: AAGAGAGCCGCCTCTGCAACTT WISP1-Reverse: TCATGGATGCCTCTGGCTGGTA MMP7-Forward: TCGGAGGAGATGCTCACTTCGA MMP7-Reverse: GGATCAGAGGAATGTCCCATACC GAPDH-Forward: GAAGGTGAAGGTCGGAGTC GAPDH-Reverse: GAAGATGGTGATGGGATTTC

CO-IP Assay

Cells were lysed with the following lysate buffers: 50 mM Tris PH7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton, 10% glycerol, and a mixture of protease and phosphatase inhibitors (Roche, Basel, Switzerland). Cell debris was removed at 13,000 g× 5 min, and then the cell lysates were incubated with 1 μg primary antibody and 15 μl protein A/G beads (Santa Cruz Biotechnology) for 2 h. After washing, beads were boiled at 100°C for 5 min and then Western blot was performed.

Western Blot

The cells were lysed with the following lysate buffers: 50 mM Tris PH7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton, 10% glycerol, and a mixture of protease and phosphatase inhibitors (Roche, Basel, Switzerland) to extract the whole protein. Then the protein concentration was determined using Bradford method. A total of 30–40 μg protein (according to the protein concentration) was used for SDS-polyacrylamide gel electrophoresis; after SDS-polyacrylamide gel electrophoresis, the separated proteins were electrophoretically transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA). The primary antibody used in this study was diluted 1:500 in 5% skim milk.

Colony Formation Assay

Cells were dissociated using trypsin and suspended in the culture medium; the different groups of cells were then seeded into six-well plates, with 200 cells in each well gently shaken to disperse the cells evenly. Crystal violet staining was performed 2–3 weeks after cell culture when visible clones appeared, and the number of clones was counted.

Top-Flash Assay

The reporter plasmid and ZNF24 expression plasmid were co-transfected into HEK293 cells using Lipofectamine 3000. Forty-eight hours after transfection, cell luciferase activity was detected by using a dual luciferase assay kit (Promega). Luciferase activity was measured using the Glomax20/20 Luminometer (Promega).

Cell Cycle Detection by Flow Cytometry

Cells of each treatment group were dissociated into single cell suspension in a 1.5 ml centrifuge tube and centrifuged at 4°C for 300 g× 5 min, then the supernatant was discarded; 3 ml of pre-cooled PBS was added to wash the cells twice, centrifuged at 4°C for 300 g× 5 min, and the supernatant was discarded. By using pre-cooled 75% ethanol cells were fixed, and the tube was placed in the refrigerator at −20°C overnight. The centrifuge tube was taken out the next day, and PI staining was performed as in the following steps: centrifuged the tube 300 g× 5 min at 4°C→discarded the supernatant→added 3 ml of pre-cooled PBS to wash the cells→discarded the supernatant→added 400 µl PBS, 50 µl RNase (1 mg/ml), and 10 µl propidium iodide (PI) respectively. After PI staining, the tube was put in the dark at room temperature for 30 min and then cell cycle detection was performed by flow cytometer (Biosciences AccuriC6, BD, U.S.).

Cell Proliferation Test

Cell proliferation test was performed according to CCK-8 manuscript in days 0, 1, 2, and 4 after transfection.

Transgenic Mouse Model

Kraslsl-G12D/+ mice were housed in separate cages (humidity 60–65%, temperature 22–25°C) in a SPF animal laboratory with a 12-h light/dark cycle and specific pathogen-free conditions. After 1 to 2 weeks of adaptive feeding, virus nasal drops were administered to 4–6-week-old Kraslsl-G12D/+ mice at a titer of 2 × 106 PFU per mouse. Six months after the virus infection, the mice were euthanized by cervical dislocation, and the lungs of the mice were collected for paraffin embedding.

In Vivo Xenograft Model

A total of eight healthy 6–8 weeks old nude mice [Beijing Institute of Pharmacology, Chinese Academy of Medical Sciences (Beijing, China)] were raised in an SPF animal laboratory in separate cages, laboratory humidity 60–65%, temperature 22–25°C, and provide free food and water under a 12-h light and dark cycle. The experiment was started after one week of adaptive feeding, and the health status of the nude mice before the experiment was observed. Nude mice were randomly divided into two groups, four in each group. During the feeding process, 5 × 106 A549i cells were subcutaneously injected into the mice for related processing and measurement. After 30 days of rearing, the mice were euthanized, the tumors were weighed and embedded in sections, and ZNF24 was tested by IHC.

H&E Staining

Lung tissue samples were fixed with 10% neutral formalin buffer, dehydrated, and embedded in paraffin. The samples were then cut into 1–5 m thickness and stained with hematoxylin and eosin (H&E).

IHC Staining

IHC protocol-1 of Bond max (Leica) was used for IHC staining of xenograft tumor sections, and antigen retrieval was performed using ER2 protocol according to Bond max (Leica).

Statistical Analysis

All experiments in this study were repeated at least two times and the average values of three experiments were presented as the mean standard seriation (SD) calculated by STDEV formula in Excel. The significance of all data was estimated by a Tukey’s multiple-comparison test in the ANOVA analysis using the Sigma Stat 3.5 software. Importantly, statistical significance was accepted when P <0.05.

Results

ZNF24 Is a Novel and Clinically Relevant NSCLC TSG

Currently, NSCLC patients have very limited therapeutic options in clinical practice. We analyzed the changes in gene expression of NSCLC in order to identify TSG, which is functionally important in NSCLC, with a view to finding drug targets for NSCLC patients. The analysis results of TCGA NSCLC data showed that the expression of ZNF24 was high in para cancerous tissues and low in NSCLC tumor tissues (). This was consistent with the results of our NSCLC clinical samples, that protein and mRNA levels of ZNF24 in para-tumoral tissues were significantly higher in comparison to the NSCLC tumor tissues (). In addition, in the survival curve analysis, results demonstrated that high levels of ZNF24 expression in NLSCLC tumors were significantly associated with longer survival in all stages (). Taken together, these results suggested that ZNF24 was a clinically relevant TSG.
Figure 1

ZNF24 is a novel and clinically relevant NSCLC suppressor gene. (A) ZNF24 mRNA expression in TCGA NSCLC tissue and GTEX lung tissue; the data of “Normal Tissue” comes from GTEX database and the data of “Solid Tissue Normal” and “Primary Tumor” comes from TCGA database; (B) Expression of ZNF24 protein in para-tumoral tissues and tumor tissues in indicated clinical samples, T, tumor; P-T, para-tumor; (C) Expression of ZNF24 mRNA in para-tumoral tissues and tumor tissues in indicated clinical samples; (D) K–M survival analysis of TCGA NSCLC patients. Data are representative of three independent experiments and were analyzed by unpaired t-test. Error bars denote SD. **P < 0.01, ***P < 0.001.

ZNF24 is a novel and clinically relevant NSCLC suppressor gene. (A) ZNF24 mRNA expression in TCGA NSCLC tissue and GTEX lung tissue; the data of “Normal Tissue” comes from GTEX database and the data of “Solid Tissue Normal” and “Primary Tumor” comes from TCGA database; (B) Expression of ZNF24 protein in para-tumoral tissues and tumor tissues in indicated clinical samples, T, tumor; P-T, para-tumor; (C) Expression of ZNF24 mRNA in para-tumoral tissues and tumor tissues in indicated clinical samples; (D) K–M survival analysis of TCGA NSCLC patients. Data are representative of three independent experiments and were analyzed by unpaired t-test. Error bars denote SD. **P < 0.01, ***P < 0.001.

Ectopic Expression of ZNF24 Inhibits the Proliferation and Stemness of NSCLC Cells

We verified the function of ZNF24 by ectopic expression of ZNF24 in human NLSCLC cell lines. As shown in , ZNF24 protein expression level in human NLSCLC cell lines (A549, PC9, H23, H460 and H1299 cells) was significantly lower than that in lung epithelial cells (HSAEC-37 and HBEC-30 cells). We selected A549 and PC9 cell lines to construct a doxycycline (DOX)-induced ZNF24 expression cell lines (named A549i and PC9i, respectively; ). Results showed that ectopic expression of ZNF24 significantly reduced the growth rate and the colony forming ability of A549i and PC9i cells (). Furthermore, ZNF24 also reduced the sphere-forming ability of A549i and PC9i cells, which implied that ZNF24 reduced the cell stemness of A549i and PC9i cells (). To sum up, our data suggested that ZNF24 performed TSG function in NSCLC cells.
Figure 2

Ectopic expression of ZNF24 inhibits the proliferation and stemness of NSCLC cells. (A) Western blot analysis of ZNF24 expression in the indicated NSCLC cell lines (A549, PC9, H23, H460, and H1299 cells) and lung epithelial cells (HSAEC-37 and HBEC-30 cells). Whole-cell lysates from the indicated cells were analyzed by immunoblots with the indicated antibodies; (B) Effects of DOX-induced expression of ZNF24 in A549i and PC9i cell lines. Whole-cell lysates from the indicated cells were analyzed by immunoblots with the indicated antibodies; (C) ZNF24 ectopic expression inhibited A549i and PC9i cell viability. A549i and PC9i cells (1 × 103) were treated without or with DOX (1 µg/ml) for 48 h, then cell viability was detected by CCK-8 assay kit for indicated time points; (D, E) ZNF24 inhibited colony forming of A549i (D) and PC9i (E) cells. A549i and PC9i cells were treated with or without DOX for 48 h before colony forming assay; (F, G) ZNF24 inhibited sphere formation ability of A549i and PC9i cells. Representative images of sphere assay of A549i and PC9i cells (F) and statistics of sphere formation (G). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. **P < 0.01, ***P < 0.001.

Ectopic expression of ZNF24 inhibits the proliferation and stemness of NSCLC cells. (A) Western blot analysis of ZNF24 expression in the indicated NSCLC cell lines (A549, PC9, H23, H460, and H1299 cells) and lung epithelial cells (HSAEC-37 and HBEC-30 cells). Whole-cell lysates from the indicated cells were analyzed by immunoblots with the indicated antibodies; (B) Effects of DOX-induced expression of ZNF24 in A549i and PC9i cell lines. Whole-cell lysates from the indicated cells were analyzed by immunoblots with the indicated antibodies; (C) ZNF24 ectopic expression inhibited A549i and PC9i cell viability. A549i and PC9i cells (1 × 103) were treated without or with DOX (1 µg/ml) for 48 h, then cell viability was detected by CCK-8 assay kit for indicated time points; (D, E) ZNF24 inhibited colony forming of A549i (D) and PC9i (E) cells. A549i and PC9i cells were treated with or without DOX for 48 h before colony forming assay; (F, G) ZNF24 inhibited sphere formation ability of A549i and PC9i cells. Representative images of sphere assay of A549i and PC9i cells (F) and statistics of sphere formation (G). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. **P < 0.01, ***P < 0.001.

ZNF24 Inhibits NSCLC Tumorigenesis In Vivo

In order to verify the TSG function of ZNF24 in vivo, we tested the tumor formation in the lungs of a ZNF24 knockout transgenic mouse model. Jacks and colleagues previously reported on a viral CRISPR/Cas9 system that knocked out the target gene in lsl-KrasG12D transgenic mice and simultaneously activated the KRAS mutation (25) (). Through viral nasal drops, we successfully knocked out ZNF24 in the pneumonocyte of lsl-KrasG12D transgenic mice (). Twelve weeks after virus infection, the number of tumors in mice infected with pSECC-sgZNF24 lentivirus (group sgZNF24) was significantly higher than that in mice infected with pSECC-sgTomato lentivirus (group sgTd), and the tumor size in group sgZNF24 was significantly larger than that in group sgTd (). Taken together, these data suggested ZNF24 was able to inhibit NSCLC tumorigenesis in vivo.
Figure 3

ZNF24 inhibits NSCLC tumorigenesis in vivo. (A) Schematic diagram of experimental design of pSECC-Cre-Cas9-sgZNF24 lentivirus infected Kras G12D L/L mice; (B, C) ZNF24 mRNA (B) and protein (C) expression level in livers of mice at 12 weeks after lentivirus infection; (D) lungs of the indicated mice were shown at 12 weeks after lentivirus infection (scale bar, 1 cm); (E) H&E staining of lung sections of panel (D) (scale bars, 500 µm, 100 µm); (F) Statistics of lung tumor nodule number in indicated groups; (G) Statistics of the maximal tumor sizes (diameters). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. *P < 0.05; **P < 0.01; ***P < 0.001.

ZNF24 inhibits NSCLC tumorigenesis in vivo. (A) Schematic diagram of experimental design of pSECC-Cre-Cas9-sgZNF24 lentivirus infected Kras G12D L/L mice; (B, C) ZNF24 mRNA (B) and protein (C) expression level in livers of mice at 12 weeks after lentivirus infection; (D) lungs of the indicated mice were shown at 12 weeks after lentivirus infection (scale bar, 1 cm); (E) H&E staining of lung sections of panel (D) (scale bars, 500 µm, 100 µm); (F) Statistics of lung tumor nodule number in indicated groups; (G) Statistics of the maximal tumor sizes (diameters). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. *P < 0.05; **P < 0.01; ***P < 0.001.

ZNF24 Induces NSCLC Cell Senescence by Inhibiting WNT Signal Pathway

TSGs exercise their tumor suppressor function mainly by inducing cell aging, apoptosis, and cycle arrest. Flow cytometric analysis results demonstrated that ZNF24 caused a significant increase of the percentage of G0/G1 phase A549i (49.13 to 56.23%) and PC9i (54.13 to 61.5%) cells and significant decrease of the percentage of S phase A549i (24.80 to19.07%) and PC9i (19.80 to 14.07%) cells (). In addition, through the detection of the expression of cell cycle-related proteins, it was found that ZNF24 significantly inhibited the expression of cylinD1 on mRNA and protein levels in A549i and PC9i cells ( and ). Since cylinD1 is a target gene of WNT signaling pathway (26), we speculated that ZNF24 might inhibit WNT signaling pathway. qRT-PCR data confirmed our hypothesis that ZNF24 significantly reduced the WNT signaling pathway target gene mRNA expression level, including cylinD1, c-MYC, cJUN, fra-1, WISP1, and MMIP7 in A549i and PC9i cells ( and ). Furthermore, the Western results confirmed that ZNF24 expression reduced the protein levels of c-MYC, cJUN, and fra-1 ( and ). Previous studies by Lu et al. have shown that the WNT signaling pathway is associated with tumor cell senescence (27). This was consistent with our β-galactosidase staining results that ZNF24 induced A549i and PC9i cell senescence ( and ). Cellular senescence is commonly induced by cyclin-dependent kinase (CDK) inhibitors (CKIs). However, Western blot results showed no significant changes of p53, p16 or p21 level before and after ZNF24 expression in A549i cells (), indicating that ZNF24 induced senescence of NSCLC cells through a non-canonical pathway. These above results indicated that ZNF24 induced NSCLC cells senescence by inhibiting WNT signal pathway.
Figure 4

ZNF24 induces NSCLC cell senescence by inhibiting WNT signaling pathway. (A, B) ZNF24 induces G0/G1 cell cycle arrest in A549i (A) and PC9i (B) cells. A549i and PC9i were treated without or with DOX (1 µg/ml) for 48 h, then FACS analysis was used to analyze cell cycle distribution and statistics of cell cycle distribution. (C, D) ZNF24 ectopic expression effect on cyclin-B1, cyclin-D1, and cyclin-E1 mRNA (C) and protein (D) expression level in A549i cells; (E, F) ZNF24 ectopic expression effect on WNT signaling pathway target gene mRNA (E) and protein (F) expression level in A549i cells; (G) ZNF24 ectopic expression induced senescence of A549i cells. A549i cells were treated without or with DOX (1 µg/ml) for 48 h, then senescent cells were determined by senescence-associated β-galactosidase activity analysis (left) and statistics of senescence β-galactosidase staining positive cells (right). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. *P < 0.05, ***P < 0.001. ns, not statistically significant.

ZNF24 induces NSCLC cell senescence by inhibiting WNT signaling pathway. (A, B) ZNF24 induces G0/G1 cell cycle arrest in A549i (A) and PC9i (B) cells. A549i and PC9i were treated without or with DOX (1 µg/ml) for 48 h, then FACS analysis was used to analyze cell cycle distribution and statistics of cell cycle distribution. (C, D) ZNF24 ectopic expression effect on cyclin-B1, cyclin-D1, and cyclin-E1 mRNA (C) and protein (D) expression level in A549i cells; (E, F) ZNF24 ectopic expression effect on WNT signaling pathway target gene mRNA (E) and protein (F) expression level in A549i cells; (G) ZNF24 ectopic expression induced senescence of A549i cells. A549i cells were treated without or with DOX (1 µg/ml) for 48 h, then senescent cells were determined by senescence-associated β-galactosidase activity analysis (left) and statistics of senescence β-galactosidase staining positive cells (right). Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. *P < 0.05, ***P < 0.001. ns, not statistically significant.

ZNF24 Inhibits the Activation of WNT Signaling Pathway by Competitively Binding β-Catenin

Next, we tried to explore the relevant molecular mechanism of ZNF24 inhibiting the activation of WNT signaling pathway. Previous studies have shown that β-catenin transcriptional activity is a key factor in WNT signaling activity (20). Top-flash assay data showed that ZNF24 expression significantly inhibited β-catenin transcriptional activity in a dose dependent manner (). In order to find out the molecular mechanism underlying ZNF24 inhibiting β-catenin transcriptional activity, we performed the Co-IP assay and found out that there was an interaction between endogenous ZNF24 and β-catenin in A549i cells (). Usually, the activation of WNT signal requires stable β-catenin to form a complex with TCF1/LEF1 in the nucleus to drive the expression of target genes (28). Co-IP assay results showed that ectopically overexpressed ZNF24 inhibited the interaction of β-catenin with LEF1 or TCF1 in HEK293 cells (). Furthermore, this inhibition was confirmed that ZNF24 also inhibited recruitment of endogenous LEF1 or TCF1 by endogenous β-catenin in A549i cells (). We used bimolecular fluorescence complementary assay technology to quantitatively measure the ability of ZNF24 to block the interaction between β-catenin and LEF1/TCF1 (29). This method is to fuse β-catenin with N-termini of firefly luciferase or LEF1/TCF1 with the C-termini of firefly luciferase, respectively. Therefore, when these fusion proteins are expressed in A549i cells, luciferase activity is a direct reading of the interaction between β-catenin and LEF1/TCF1. The results showed that ZNF24 effectively inhibited the interaction between β-catenin and LEF1/TCF1 (). Taken together, these data suggested that ZNF24 inhibited the activation of WNT signaling pathway by preventing β-catenin to form a complex with TCF1/LEF1.
Figure 5

ZNF24 inhibits the activation of WNT signaling pathway by competitively binding β-catenin. (A) ZNF24 expression significantly inhibited β-catenin transcriptional activity in a dose dependent manner; (B) Endogenous ZNF24 was associated with β-catenin in A549i cells. Coimmunoprecipitation experiments were performed with anti-ZNF24 or anti-β-catenin, and the immunoprecipitated and whole cell lysates (input) were analyzed by immunoblots with indicated antibodies; (C, D) Co-IP assay results showed ectopically overexpressed ZNF24 inhibited interaction of β-catenin with LEF1 (C) or TCF1 in HEK293 cells (D, E) Co-IP assay results showed ZNF24 inhibited recruitment of endogenous LEF1 or TCF1 by endogenous β-catenin in A549i cells; (F) Top-flash assay results showed ZNF24 significantly inhibited interaction of β-catenin with LEF1 or TCF1. Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. ***P < 0.001.

ZNF24 inhibits the activation of WNT signaling pathway by competitively binding β-catenin. (A) ZNF24 expression significantly inhibited β-catenin transcriptional activity in a dose dependent manner; (B) Endogenous ZNF24 was associated with β-catenin in A549i cells. Coimmunoprecipitation experiments were performed with anti-ZNF24 or anti-β-catenin, and the immunoprecipitated and whole cell lysates (input) were analyzed by immunoblots with indicated antibodies; (C, D) Co-IP assay results showed ectopically overexpressed ZNF24 inhibited interaction of β-catenin with LEF1 (C) or TCF1 in HEK293 cells (D, E) Co-IP assay results showed ZNF24 inhibited recruitment of endogenous LEF1 or TCF1 by endogenous β-catenin in A549i cells; (F) Top-flash assay results showed ZNF24 significantly inhibited interaction of β-catenin with LEF1 or TCF1. Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. ***P < 0.001.

ZNF24 Inhibited NSCLC Tumor Growth In Vivo

To investigate the role of ZNF24 on NSCLC in an in vivo system, we xenografted tumors in nude mice. NSCLC cells were inoculated subcutaneously in nude mice, and 6 days after we randomized the mice for treatment with DOX-containing food or normal food, we euthanized them 24 days after the xenograft (). As shown in , body weight of the mice did not change significantly during the experiment, indicating that DOX treatment is non-toxic. Data showed that ectopic expression of ZNF24 significantly shrunk xenografted tumor volume and weight in comparison to the control diet group (). Furthermore, IHC staining assay results showed that DOX-containing food diet successfully induced ZNF24 expression in nude mice (). ZNF24 expression significantly inhibited the WNT signaling pathway target gene mRNA expression level in vivo (). In addition, Western blot results showed that ZNF24 expression was able to induce cell apoptosis in vivo (). Taken together, our data demonstrated ectopic expression of ZNF24 could inhibit NSCLC xenografted tumor growth in nude mice.
Figure 6

ZNF24 and inhibited NSCLC xenografted tumors growth in nude mice. (A) Schematic diagram of experimental design of transplanted tumor in nude mice; (B) Changes in body weight of nude mice during feeding with DOX (DOX+) food or normal food (DOX−); (C–E) The volume and weight of tumors of mice fed DOX food were strongly suppressed compared with control group tumors. Tumor volume was recorded every 3 days by measuring its diameter with Vernier caliper, and the tumors were weighed after 30 days of rearing when the mice were euthanized; (F) IHC staining of NSCLC xenografted tumors of nude mice treated fed with DOX food (DOX+) or normal food (DOX−) indicated antibodies were added during IHC staining assay. (G) ZNF24 expression effect on cyclin-B1, cyclin-D1, and cyclin-E1 mRNA expression level in xenografted tumors. (H) ZNF24 expression effect on cell apoptosis markers: Cleaved Caspase-9 and Cleaved Caspase-3 in xenografted tumors. Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. ***P < 0.001. ns, not statistically significant.

ZNF24 and inhibited NSCLC xenografted tumors growth in nude mice. (A) Schematic diagram of experimental design of transplanted tumor in nude mice; (B) Changes in body weight of nude mice during feeding with DOX (DOX+) food or normal food (DOX−); (C–E) The volume and weight of tumors of mice fed DOX food were strongly suppressed compared with control group tumors. Tumor volume was recorded every 3 days by measuring its diameter with Vernier caliper, and the tumors were weighed after 30 days of rearing when the mice were euthanized; (F) IHC staining of NSCLC xenografted tumors of nude mice treated fed with DOX food (DOX+) or normal food (DOX−) indicated antibodies were added during IHC staining assay. (G) ZNF24 expression effect on cyclin-B1, cyclin-D1, and cyclin-E1 mRNA expression level in xenografted tumors. (H) ZNF24 expression effect on cell apoptosis markers: Cleaved Caspase-9 and Cleaved Caspase-3 in xenografted tumors. Data are representative of three independent experiments analyzed by unpaired t-test. Error bars denote SD. ***P < 0.001. ns, not statistically significant.

Discussion

As a heterogeneous tumor, lung cancer has more than 50 histomorphology subtypes, among which non-small cell lung carcinoma (NSCLC) is the most common, accounting for about 80–85% of lung cancer (30–32). In spite of the great development of clinical research and innovative therapies in recent decades, the 5-year survival rate of NSCLC is still estimated to be only 18% (33). The current clinical difficulties encountered in the treatment of NSCLC are caused by drug resistance due to the huge heterogeneity of NSCLC itself, and on the other hand, our extremely limited understanding of the molecular mechanisms of NSCLC-related pathogenesis (34, 35). Therefore, it is increasingly important to study the relevant molecular mechanisms in the development of NSCLC. In our current work, we have found that the expression of ZNF24 in the tumor tissues of lung cancer patients is significantly higher than that in the adjacent tissues. At the same time, we functionally verified the tumor suppressor function of ZNF24 in NLCSC. In addition, we analyzed the GETX and TCGA databases and found that the expression of ZNF24 in normal lung tissue was also significantly higher than that in lung tissue (). The effect of this highly expressed ZNF24 on the related molecular mechanisms and molecular pathways in normal lung cells is worthy of further investigation. This will also be a research focus of our follow-up work. Based on in vivo and in vitro data, we demonstrated a previously undiscovered role of ZNF24 inducing NSCLC tumor cell senescence. This finding might be exploited in NSCLC patients not expressing or expressing very low levels of ZNF24, given that there are now viral and non-viral systems that deliver target genes to target tissue cells and tumor cells. The in vivo results showed that the ectopic expression of ZNF24 significantly inhibited the growth of NSCLC tumors. In addition, the transgenic mouse model also confirmed that the expression of ZNF24 significantly inhibited the occurrence and development of NSCLC in vivo. Many members of zinc finger transcription factor family could be associated with tumor prognosis and patient outcomes, such as ZNF191, ZNF71, and ZNF322 (24, 36). In addition, the higher the level of ZNF71 the better the survival of NSCLC patients, which is similar to our results that high levels of ZNF24 expression in NLSCLC patients were significantly associated with longer survival in all stages. Furthermore, recent studies have shown that ZNF24 is a tumor suppressor gene for HCC (23, 37). These suggest that it is of clinical significance to elucidate the molecular mechanism of how ZNF24 functions as a tumor suppressor in NSCLC. In this study, we found out that ZNF24 functioned as a tumor suppressor in NSCLC through inhibiting the WNT signaling pathway. In most reports, β-catenin, an important transcription factor in the classic WNT signaling pathway, is considered to be a proto-oncogene (20, 21). This is consistent with our data that ZNF24 inhibited WNT signaling pathway by preventing β-catenin to form a complex with TCF1/LEF1. Previous studies by Lu et al. show that the WNT signaling pathway is associated with tumor cell senescence which is consistent with our findings that ZNF24 induces cell NSCLC senescence by inhibiting the WNT signaling pathway. Our in vivo data suggests that ZNF24 also induces tumor inhibition through the WNT signaling pathway in vivo. This gives us a hint that NSCLC patients lacking ZNF24 may have higher classical WNT signaling activity. This suggests that inhibitors of the WNT signaling pathway (such as ICG-001, MSAB) might be used in the treatment of NSCLC. In addition, in follow-up studies, we will explore the effect of ZNF24 on NSCLC in vivo in the case of activating β-catenin transcriptional activity (38). In conclusion, our research revealed a novel NSCLC tumor suppressor ZNF24 and elucidated the molecular mechanism of how ZNF24 functions as a tumor suppressor in NSCLC. Also, we reported a previously undiscovered molecular mechanism of ZNF24 that induced NSCLC tumor cell senescence. Given the high frequency of ZNF24 deficiency among NSCLC patients, our current work may offer a therapeutic opportunity for ZNF24 deficient NSCLC patients. In addition, due to the high proportion of ZNF24 deficient NSCLC patients, our work is likely to provide treatment opportunities for NSCLC patients with ZNF24 deficiency.

Data Availability Statement

The original contributions presented in the study are included in the article/. Further inquiries can be directed to the corresponding author.

Ethics Statement

The studies involving human participants were reviewed and approved by Anhui Medical University. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by Anhui Medical University.

Author Contributions

BP, YW, and XC performed the experiments. Study was designed by BP and XC. BP and XC conceived and wrote the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This work was financially supported by National Key Research and Development Plan (2018YFC1311900), National Natural Science Foundation of China Youth Project (81700606) and Youth Cultivation Fund of the First Affiliated Hospital of Anhui Medical University.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  38 in total

Review 1.  Fluorescence complementation: an emerging tool for biological research.

Authors:  Y John Shyu; Chang-Deng Hu
Journal:  Trends Biotechnol       Date:  2008-09-17       Impact factor: 19.536

2.  Zinc finger transcription factor 191, directly binding to β-catenin promoter, promotes cell proliferation of hepatocellular carcinoma.

Authors:  Guoyuan Liu; Songmin Jiang; Chenji Wang; Wei Jiang; Zulong Liu; Chao Liu; Hexige Saiyin; Xianmei Yang; Suqin Shen; Deke Jiang; Ping Zhou; Dingding Han; Xiaohui Hu; Qing Yi; Long Yu
Journal:  Hepatology       Date:  2012-06       Impact factor: 17.425

3.  Alterations and correlations of the components in the Wnt signaling pathway and its target genes in breast cancer.

Authors:  Shinji Ozaki; Satoshi Ikeda; Yasuyo Ishizaki; Takeshi Kurihara; Noriaki Tokumoto; Masahiko Iseki; Koji Arihiro; Tsuyoshi Kataoka; Mazazumi Okajima; Toshimasa Asahara
Journal:  Oncol Rep       Date:  2005-12       Impact factor: 3.906

4.  The Impact of the Fourth Edition of the WHO Classification of Lung Tumours on Histological Classification of Resected Pulmonary NSCCs.

Authors:  Patrick Micke; Johanna Sofia Margareta Mattsson; Dijana Djureinovic; Björn Nodin; Karin Jirström; Lena Tran; Per Jönsson; Maria Planck; Johan Botling; Hans Brunnström
Journal:  J Thorac Oncol       Date:  2016-02-09       Impact factor: 15.609

5.  Non-Canonical Hedgehog Signaling Is a Positive Regulator of the WNT Pathway and Is Required for the Survival of Colon Cancer Stem Cells.

Authors:  Joseph L Regan; Dirk Schumacher; Stephanie Staudte; Andreas Steffen; Johannes Haybaeck; Ulrich Keilholz; Caroline Schweiger; Nicole Golob-Schwarzl; Dominik Mumberg; David Henderson; Hans Lehrach; Christian R A Regenbrecht; Reinhold Schäfer; Martin Lange
Journal:  Cell Rep       Date:  2017-12-05       Impact factor: 9.423

6.  Rapid modelling of cooperating genetic events in cancer through somatic genome editing.

Authors:  Francisco J Sánchez-Rivera; Thales Papagiannakopoulos; Rodrigo Romero; Tuomas Tammela; Matthew R Bauer; Arjun Bhutkar; Nikhil S Joshi; Lakshmipriya Subbaraj; Roderick T Bronson; Wen Xue; Tyler Jacks
Journal:  Nature       Date:  2014-10-22       Impact factor: 49.962

7.  ZNF322A-mediated protein phosphorylation induces autophagosome formation through modulation of IRS1-AKT glucose uptake and HSP-elicited UPR in lung cancer.

Authors:  Chantal Hoi Yin Cheung; Chia-Lang Hsu; Tsai-Yu Lin; Wei-Ting Chen; Yi-Ching Wang; Hsuan-Cheng Huang; Hsueh-Fen Juan
Journal:  J Biomed Sci       Date:  2020-06-23       Impact factor: 8.410

8.  Progastrin-Releasing Peptide Precursor and Neuron-Specific Enolase Predict the Efficacy of First-Line Treatment with Epidermal Growth Factor Receptor (EGFR) Tyrosine Kinase Inhibitors Among Non-Small-Cell Lung Cancer Patients Harboring EGFR Mutations.

Authors:  Juanjuan Dong; Sihao Tong; Xianfeng Shi; Chao Wang; Xin Xiao; Wenping Ji; Yimian Sun
Journal:  Cancer Manag Res       Date:  2021-01-05       Impact factor: 3.989

9.  Down-regulation of canonical and up-regulation of non-canonical Wnt signalling in the carcinogenic process of squamous cell lung carcinoma.

Authors:  Domokos Bartis; Veronika Csongei; Alexander Weich; Edit Kiss; Szilvia Barko; Tamas Kovacs; Monika Avdicevic; Vijay K D'Souza; Judit Rapp; Krisztian Kvell; Laszlo Jakab; Miklos Nyitrai; Tamas F Molnar; David R Thickett; Terezia Laszlo; Judit E Pongracz
Journal:  PLoS One       Date:  2013-03-07       Impact factor: 3.240

Review 10.  Lung Cancer: Understanding Its Molecular Pathology and the 2015 WHO Classification.

Authors:  Kentaro Inamura
Journal:  Front Oncol       Date:  2017-08-28       Impact factor: 6.244

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.